|
Synthego Inc
synthego n a sgrna Synthego N A Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/2+3+a+n+sgrna+synthego/pm42248141-300-124-125 Average 86 stars, based on 1 article reviews
synthego n a sgrna - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Addgene inc
pagm4723 plasmid Pagm4723 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/pAGM4723%3A%3AAtU6p%3A%3AsgRNA2-2x35S-5%E2%80%B2UTR%3A%3ACas9%3A%3ANOST-AtU6p%3A%3AsgRNA1+(Plasmid+%2349772)/bio_rxiv__2023__05__05__539534-300-14-16 Average 91 stars, based on 1 article reviews
pagm4723 plasmid - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
|
Addgene inc
lenti crispr egfp grna vector ![]() Lenti Crispr Egfp Grna Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/lentiCRISPR+-+EGFP+sgRNA+2+(Plasmid+%2351761)/pmc06023958-216-15-17 Average 94 stars, based on 1 article reviews
lenti crispr egfp grna vector - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Addgene inc
addgene plasmid ![]() Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/pUAS%3ACas9T2ACre%3BU6%3AsgRNA1%3BU6%3AsgRNA2+(Plasmid+%2374010)/pmc12823065-25-12-12 Average 92 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Addgene inc
heat shock protein 70 promoter ![]() Heat Shock Protein 70 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/lentiCRISPR+-+C16orf80+sgRNA+2+(Plasmid+%2370650)/bio_rxiv__078527-154-11-23 Average 90 stars, based on 1 article reviews
heat shock protein 70 promoter - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna2 ![]() Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/USP19+sgRNA2+(Plasmid+%2378586)/bio_rxiv__2023__01__31__526410-116-11-22 Average 93 stars, based on 1 article reviews
sgrna2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
2c cas9 tool ![]() 2c Cas9 Tool, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/pUAS%3ACas9T2AGFP%3BU6%3AsgRNA1%3BU6%3AsgRNA2+(Plasmid+%2374009)/pmc05703712-6-0-2 Average 93 stars, based on 1 article reviews
2c cas9 tool - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
px330 ufsp2 sgrna2 ![]() Px330 Ufsp2 Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/px330-UFSP2+sgRNA2+(Plasmid+%23134637)/pmc12013442-83-0-3 Average 93 stars, based on 1 article reviews
px330 ufsp2 sgrna2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pu6a sgrna ![]() Pu6a Sgrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/pU6a%3AsgRNA%232+(Plasmid+%2364246)/pmc05897731-164-11-12 Average 92 stars, based on 1 article reviews
pu6a sgrna - by Bioz Stars,
2026-09
92/100 stars
|
Buy from Supplier |
|
Addgene inc
plr06 pguide b2m sgrna2 ![]() Plr06 Pguide B2m Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/pLR06_pGuide_B2M_sgRNA2+(Plasmid+%23131091)/bio_rxiv__2025__04__09__648007-174-7-9 Average 93 stars, based on 1 article reviews
plr06 pguide b2m sgrna2 - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Addgene inc
sgrna sgrna2 ![]() Sgrna Sgrna2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/HUWE1-sgRNA-2+(Plasmid+%2386925)/pmc08904532-156-2-16 Average 90 stars, based on 1 article reviews
sgrna sgrna2 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
gauuccugcaaccugcucca synthego n a sirt1 sgrna ![]() Gauuccugcaaccugcucca Synthego N A Sirt1 Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sgrna2/2+a+gauuccugcaaccugcucca+n+sgrna+sirt1+synthego/pm37392736-216-59-60 Average 86 stars, based on 1 article reviews
gauuccugcaaccugcucca synthego n a sirt1 sgrna - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Molecular Therapy. Nucleic Acids
Article Title: Targeting the IGF1R Pathway in Breast Cancer Using Antisense lncRNA-Mediated Promoter cis Competition
doi: 10.1016/j.omtn.2018.04.013
Figure Lengend Snippet: Targeting the IGF1R Pathway by Antisense lncRNA IRAIN -Mediated cis Competition (A) The orientation of IGF1R and IRAIN . The antisense IRAIN lncRNA is transcribed from an intronic promoter of the IGF1R gene. (B) Schematic diagram of the antisense lncRNA-mediated cis competition in the IGF1R signaling pathway. In normal tissues, the transcription of the IGF1R / IRAIN locus is balanced. In breast cancer cells, however, IGF1R is upregulated while IRAIN is downregulated. This unbalanced expression leads to increased activation of the IGF1R signaling pathway. An ALIC targeting approach is used to reverse this unbalance. A strong CMV promoter is inserted in front of the IRAIN lncRNA to induce increased production of IRAIN , which then competes in cis with the overlapping IGF1R promoter and dampens the IGF1R signaling pathway in tumor cells. This provides a molecular basis for the development of the precision therapy against breast cancer. (C) ALIC targeting of IGF1R by CRISPR Cas9-guided recombinant knockin. Cas9, CRISPR Cas9; gRNA, Cas9 guiding RNA; pCMV, CMV promoter; pH1, RNA polymerase III H1 promoter; Cre, Cre recombinase; pA, SV40 poly(A) signal; loxP, the locus of X-over P1 recombination site recognized by Cre; Arm 1-2, the genomic sequences used for recombination. Under the guidance of gRNAs, Cas9-mediated genomic recombination at the IRAIN locus, resulting in the insertion of the CMV promoter-puro cassette in front of the IRAIN . After puromycin selection, the cells were treated with Cre to remove the selection marker Puro + . In the selected cell clones, IRAIN is under the control of the strong promoter pCMV. The upregulated transcription of this antisense lncRNA will compete in cis with that of the sense IGF1R mRNA. (D) Initial screening of targeted cell clones by PCR. Primers were designed from the IRAIN arm, selection marker, and vector sequences. PCR was used to identify the wild-type, targeted DNA, and vector DNAs. RIC, control cells that were generated in parallel with ALIC targeting by transfecting the cells with only the donor vector DNA and selected with puromycin. As the control, RIC cells carry the randomly inserted donor vector DNA. Clones 1–12, cell clones that were generated by co-transfection with Cas9 target vector-donor vector DNAs and selected by both puromycin and ganciclovir. Targeting cell clones not only carry the IGF1R targeting allele, but also contain some amount of the randomly inserted donor vector DNA in the genome. Among them, clone 7 contains a minimum amount of randomly inserted vector DNA and was thus used for subsequent studies.
Article Snippet: We constructed the Cas9- IRAIN -gRNA-targeting vector by cloning two IRAIN promoter gRNAs into the
Techniques: Expressing, Activation Assay, CRISPR, Recombinant, Knock-In, Genomic Sequencing, Selection, Marker, Clone Assay, Plasmid Preparation, Generated, Cotransfection
Journal: Frontiers in Cell and Developmental Biology
Article Title: Opportunities for CRISPR/Cas9 Gene Editing in Retinal Regeneration Research
doi: 10.3389/fcell.2017.00099
Figure Lengend Snippet: Resources for zebrafish CRISPR/Cas9 experimental design.
Article Snippet:
Techniques: CRISPR, Plasmid Preparation, Disruption, Transgenic Assay
Journal: Autophagy
Article Title: The Epstein-Barr virus deubiquitinase BPLF1 regulates stress-induced ribosome UFMylation and reticulophagy
doi: 10.1080/15548627.2024.2440846
Figure Lengend Snippet: Reagents used in this paper.
Article Snippet:
Techniques: Recombinant, Diagnostic Assay, Transfection, Mutagenesis, Cloning, cDNA Synthesis, SYBR Green Assay, DC Protein Assay, Protein Purification, Knock-Out, Plasmid Preparation
Journal: Scientific Reports
Article Title: Transiently expressed CRISPR/Cas9 induces wild-type dystrophin in vitro in DMD patient myoblasts carrying duplications
doi: 10.1038/s41598-022-07671-w
Figure Lengend Snippet: Dystrophin correction in immortalized DUPmyo cells electroporated with CRISPR/Cas9-expressing plasmids. ( a ) Schematic of the plasmid where CR0 and CR2 were cloned. ( b ) T7E1 assay performed on HEK293T transfected with the LCR2 plasmid (lentiviral vector expressing sgRNA2), CR0 (negative control plasmid) and CR2 (plasmid expressing sgRNA2). Arrows indicated cleaved bands of expected molecular size in cells expressing the nuclease. LCR2 was used as a reference to evaluate the targeting efficiency of CR2. CR0 did not show cleaved bands as LCR2 and CR2, proving it is a valid negative control for monitoring the targeting effect of CRISPR/Cas9. NT = untreated cells. ( c ) FACS analysis of immortalized DUPmyo-i myoblasts electroporated by NEON. ( d ) T7E1 assay performed on the total pool of electroporated DUPmyo-i cells expressing CR0 and CR2. ( e ) Efficiency of genomic targeting evaluated in T7E1 replicates (n = 3). ( f ) Mutated dystrophin transcript in cells expressing CR0 and CR2 (Kruskall-Wallis test, p = 0.0552) (n = 3 technical replicates/sample). ( g ) Western blot showing dystrophin correction (427 kDa band) in cells expressing CR2. Vinculin (116 KDa band) and meta-vinculin (124 kDa band) were probed as a loading control and a measure of myogenic differentiation, respectively. ( h ) Percentages of mutated dystrophin assessed in electroporated DUPmyo-i (Kruskall-Wallis test, p = 0.0679) (n = 3). i) Comparison of mutated dystrophin observed in patient-myoblasts following LCR2-transduction (n = 4) and CR2 electroporation (n = 3) (Mann–Whitney test, p = 0.4). NT = untreated cells. TotCR0/TotCR2 = total pool of cells expressing CR0/CR2. WT = protein derived from the immortalized murine H2K 2B4 cells, expressing wild-type dystrophin (positive control), LCR2 = transduced cells.
Article Snippet: The best
Techniques: CRISPR, Expressing, Plasmid Preparation, Clone Assay, Transfection, Negative Control, Western Blot, Control, Comparison, Transduction, Electroporation, MANN-WHITNEY, Derivative Assay, Positive Control