serpine1 Search Results


86
Huabio Inc serpine1
Serpine1, supplied by Huabio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serpine1/product/Huabio Inc
Average 86 stars, based on 1 article reviews
serpine1 - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

96
Proteintech serpine1
Serpine1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serpine1/product/Proteintech
Average 96 stars, based on 1 article reviews
serpine1 - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

99
Thermo Fisher gene exp serpine1 mm00435858 m1
Gene Exp Serpine1 Mm00435858 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp serpine1 mm00435858 m1/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
gene exp serpine1 mm00435858 m1 - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

90
OriGene length pai 1 sequence
Length Pai 1 Sequence, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/length pai 1 sequence/product/OriGene
Average 90 stars, based on 1 article reviews
length pai 1 sequence - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

96
Thermo Fisher gene exp serpine1 mm00435860 m1
Gene Exp Serpine1 Mm00435860 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp serpine1 mm00435860 m1/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
gene exp serpine1 mm00435860 m1 - by Bioz Stars, 2026-06
96/100 stars
  Buy from Supplier

93
Addgene inc serpine1 bio
Serpine1 Bio, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serpine1 bio/product/Addgene inc
Average 93 stars, based on 1 article reviews
serpine1 bio - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
OriGene monoclonal mouse anti human pai 1 antibody
Monoclonal Mouse Anti Human Pai 1 Antibody, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal mouse anti human pai 1 antibody/product/OriGene
Average 90 stars, based on 1 article reviews
monoclonal mouse anti human pai 1 antibody - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

91
OriGene atccgtttgtgg cgatagcag
Atccgtttgtgg Cgatagcag, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/atccgtttgtgg cgatagcag/product/OriGene
Average 91 stars, based on 1 article reviews
atccgtttgtgg cgatagcag - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

94
Proteintech pai 1
EEAR prevents EMT and collagen deposition via the TGF‐β1/Smad2/3 pathway. The Beas‐2B cells pre‐incubated with EEAR for 1h, followed co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cell viabilities were assayed by MTT ( n = 5 per group). (B) qRT‐PCR assay for TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative western blots for TGF‐β1, p‐Smad2/3 and Smad2/3 protein expression and the quantification of TGF‐β1, p‐Smad2/3 and Smad2/3 western blots ( n = 3 per group). (D) Expression of α‐SMA protein was determined by western blot analysis ( n = 3 per group). (E) Fibronectin gene expression in the Beas‐2B cells was qualified by qRT‐PCR ( n = 3 per group). (F) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantitatives of Collagen I expression in Beas‐2B cells ( n = 3 per group). (G) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantitatives of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (H) Expression of MMP‐12, TIMP‐1, <t>and</t> <t>PAI‐1</t> proteins were determined by western blot analysis ( n = 3 per group). (I) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.
Pai 1, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pai 1/product/Proteintech
Average 94 stars, based on 1 article reviews
pai 1 - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

93
OriGene agcggctgtactgcaaaaacgg cctttgatagacacaactcctctc serpine1 serpine1 human qpcr primer pair
EEAR prevents EMT and collagen deposition via the TGF‐β1/Smad2/3 pathway. The Beas‐2B cells pre‐incubated with EEAR for 1h, followed co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cell viabilities were assayed by MTT ( n = 5 per group). (B) qRT‐PCR assay for TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative western blots for TGF‐β1, p‐Smad2/3 and Smad2/3 protein expression and the quantification of TGF‐β1, p‐Smad2/3 and Smad2/3 western blots ( n = 3 per group). (D) Expression of α‐SMA protein was determined by western blot analysis ( n = 3 per group). (E) Fibronectin gene expression in the Beas‐2B cells was qualified by qRT‐PCR ( n = 3 per group). (F) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantitatives of Collagen I expression in Beas‐2B cells ( n = 3 per group). (G) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantitatives of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (H) Expression of MMP‐12, TIMP‐1, <t>and</t> <t>PAI‐1</t> proteins were determined by western blot analysis ( n = 3 per group). (I) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.
Agcggctgtactgcaaaaacgg Cctttgatagacacaactcctctc Serpine1 Serpine1 Human Qpcr Primer Pair, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/agcggctgtactgcaaaaacgg cctttgatagacacaactcctctc serpine1 serpine1 human qpcr primer pair/product/OriGene
Average 93 stars, based on 1 article reviews
agcggctgtactgcaaaaacgg cctttgatagacacaactcctctc serpine1 serpine1 human qpcr primer pair - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

90
OriGene serpine1 3 utr
SERBP1 or Ago2 silencing increases KCC2 expression. ( A ) Forty-eight hours after transfection with either control siRNA, Ago2 siRNA or SERBP1 siRNA (20 nM), SH-SY5Y cells were transfected with PSSG control plasmid or the <t>Serpine1,</t> or APP or KCC2 3′UTR firefly reporter plasmid. Firefly/renilla luminescence ratios were determined 24 h later. The data are presented as the fold increase of normalized luminescence ratios relative to cells transfected with control siRNA. Data represent the mean of three independent experiments +/− S.E.; * p < 0.05; ** p < 0.01. ( B ) Forty-eight hours after transfection with siAgo2 or siSERBP1 or a control siRNA (200 nM), hippocampal neurons were transfected with control plasmid or KCC2 3′UTR luciferase reporter. Firefly/renilla luminescence ratio was analyzed as described in ( A ). Data represent the mean of three independent experiments ± S.E. * p < 0.05. Individual data points for Ago2 (circles) and Serbp1 (triangles) siRNA transfected cells are indicated in ( A ) and ( B ) panels. ( C ) Representative Western blotting showing KCC2 upregulation in hippocampal neurons after SERBP1 silencing. Nitrocellulose membranes were hybridized with KCC2 or SERBP1 antibodies, as indicated. The GAPDH signal was used to normalize different samples. Means +/− S.E. of KCC2 and SERBP1 protein levels obtained from three independent experiments are presented relative to control cells. * p < 0.05; ** p < 0.01 ( t -test).
Serpine1 3 Utr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/serpine1 3 utr/product/OriGene
Average 90 stars, based on 1 article reviews
serpine1 3 utr - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

97
Thermo Fisher gene exp serpine1 hs00167155 m1
SERBP1 or Ago2 silencing increases KCC2 expression. ( A ) Forty-eight hours after transfection with either control siRNA, Ago2 siRNA or SERBP1 siRNA (20 nM), SH-SY5Y cells were transfected with PSSG control plasmid or the <t>Serpine1,</t> or APP or KCC2 3′UTR firefly reporter plasmid. Firefly/renilla luminescence ratios were determined 24 h later. The data are presented as the fold increase of normalized luminescence ratios relative to cells transfected with control siRNA. Data represent the mean of three independent experiments +/− S.E.; * p < 0.05; ** p < 0.01. ( B ) Forty-eight hours after transfection with siAgo2 or siSERBP1 or a control siRNA (200 nM), hippocampal neurons were transfected with control plasmid or KCC2 3′UTR luciferase reporter. Firefly/renilla luminescence ratio was analyzed as described in ( A ). Data represent the mean of three independent experiments ± S.E. * p < 0.05. Individual data points for Ago2 (circles) and Serbp1 (triangles) siRNA transfected cells are indicated in ( A ) and ( B ) panels. ( C ) Representative Western blotting showing KCC2 upregulation in hippocampal neurons after SERBP1 silencing. Nitrocellulose membranes were hybridized with KCC2 or SERBP1 antibodies, as indicated. The GAPDH signal was used to normalize different samples. Means +/− S.E. of KCC2 and SERBP1 protein levels obtained from three independent experiments are presented relative to control cells. * p < 0.05; ** p < 0.01 ( t -test).
Gene Exp Serpine1 Hs00167155 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp serpine1 hs00167155 m1/product/Thermo Fisher
Average 97 stars, based on 1 article reviews
gene exp serpine1 hs00167155 m1 - by Bioz Stars, 2026-06
97/100 stars
  Buy from Supplier

Image Search Results


EEAR prevents EMT and collagen deposition via the TGF‐β1/Smad2/3 pathway. The Beas‐2B cells pre‐incubated with EEAR for 1h, followed co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cell viabilities were assayed by MTT ( n = 5 per group). (B) qRT‐PCR assay for TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative western blots for TGF‐β1, p‐Smad2/3 and Smad2/3 protein expression and the quantification of TGF‐β1, p‐Smad2/3 and Smad2/3 western blots ( n = 3 per group). (D) Expression of α‐SMA protein was determined by western blot analysis ( n = 3 per group). (E) Fibronectin gene expression in the Beas‐2B cells was qualified by qRT‐PCR ( n = 3 per group). (F) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantitatives of Collagen I expression in Beas‐2B cells ( n = 3 per group). (G) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantitatives of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (H) Expression of MMP‐12, TIMP‐1, and PAI‐1 proteins were determined by western blot analysis ( n = 3 per group). (I) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.

Journal: Advanced Science

Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1

doi: 10.1002/advs.202505256

Figure Lengend Snippet: EEAR prevents EMT and collagen deposition via the TGF‐β1/Smad2/3 pathway. The Beas‐2B cells pre‐incubated with EEAR for 1h, followed co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cell viabilities were assayed by MTT ( n = 5 per group). (B) qRT‐PCR assay for TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative western blots for TGF‐β1, p‐Smad2/3 and Smad2/3 protein expression and the quantification of TGF‐β1, p‐Smad2/3 and Smad2/3 western blots ( n = 3 per group). (D) Expression of α‐SMA protein was determined by western blot analysis ( n = 3 per group). (E) Fibronectin gene expression in the Beas‐2B cells was qualified by qRT‐PCR ( n = 3 per group). (F) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantitatives of Collagen I expression in Beas‐2B cells ( n = 3 per group). (G) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantitatives of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (H) Expression of MMP‐12, TIMP‐1, and PAI‐1 proteins were determined by western blot analysis ( n = 3 per group). (I) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.

Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig), PAI‐1 (1:1000; Cat#66261‐1‐Ig) (all from Proteintech, Wuhan, China unless specified); p‐Smad2/3 (1:1000; Cat#8828; Cell Signaling Technology, Danvers, USA), TIMP‐1 (1:1000; Cat#ab216432; Abcam, Cambridge, USA), Ubiquitin (1:1000; Cat#ab134953; Abcam, Cambridge, USA), Smad2/3 (1:2000; Cat#ab202445; Abcam, Cambridge, USA), TGF‐β1 (1:2000; Cat#ab315254; Abcam, Cambridge, USA), TGF‐βR1 (1:1000; Cat#ab235578; Abcam, Cambridge, USA) and TGF‐βR2 (1:1000; Cat#ab259360; Abcam, Cambridge, USA); Flag (1:1000; Cat#M20008; Abmart, Shanghai, China).

Techniques: Incubation, Quantitative RT-PCR, Expressing, Western Blot, Gene Expression, Migration, Control

RA inhibits TGF‐β1‐induced EMT and collagen deposition by binding to TGF‐β1. (A) Binding affinity analysis of RA with TGF‐β1 was performed by SPR. (B) Binding affinity analysis of RA with TGF‐β1 was performed by CETSA assay ( n = 3 per group). (C) Molecular docking of RA with TGF‐β1 (1KLA) by MOE software. (D) The change of RMSD with time in a molecular dynamics simulation. (E) RMSF was calculated using the molecular dynamics simulation trajectory. (F) Binding free energies and energy components were predicted by MM/GBSA. 50 µg/mL RA was pre‐mixed with or without 5 ng/mL TGF‐β1 in vitro for 1 h, and then the mixture induced Beas‐2B cells for 24 h. (G) Immunoblotting analysis for TGF‐β1 protein and its ubiquitination levels ( n = 3 per group). (H) The TGF‐β1 mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (I) The TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I protein levels in Beas‐2B cells were detected by Immunoblotting analysis. (J) Quantification of TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I proteins western blots ( n = 3 per group). (K) The fibronectin mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (L) The changes of MMP‐2, MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells ( n = 3 per group). (M) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the TGF‐β1 group.

Journal: Advanced Science

Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1

doi: 10.1002/advs.202505256

Figure Lengend Snippet: RA inhibits TGF‐β1‐induced EMT and collagen deposition by binding to TGF‐β1. (A) Binding affinity analysis of RA with TGF‐β1 was performed by SPR. (B) Binding affinity analysis of RA with TGF‐β1 was performed by CETSA assay ( n = 3 per group). (C) Molecular docking of RA with TGF‐β1 (1KLA) by MOE software. (D) The change of RMSD with time in a molecular dynamics simulation. (E) RMSF was calculated using the molecular dynamics simulation trajectory. (F) Binding free energies and energy components were predicted by MM/GBSA. 50 µg/mL RA was pre‐mixed with or without 5 ng/mL TGF‐β1 in vitro for 1 h, and then the mixture induced Beas‐2B cells for 24 h. (G) Immunoblotting analysis for TGF‐β1 protein and its ubiquitination levels ( n = 3 per group). (H) The TGF‐β1 mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (I) The TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I protein levels in Beas‐2B cells were detected by Immunoblotting analysis. (J) Quantification of TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, and Collagen I proteins western blots ( n = 3 per group). (K) The fibronectin mRNA expression in the Beas‐2B cells was assayed by RT‐qPCR ( n = 3 per group). (L) The changes of MMP‐2, MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells ( n = 3 per group). (M) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the TGF‐β1 group.

Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig), PAI‐1 (1:1000; Cat#66261‐1‐Ig) (all from Proteintech, Wuhan, China unless specified); p‐Smad2/3 (1:1000; Cat#8828; Cell Signaling Technology, Danvers, USA), TIMP‐1 (1:1000; Cat#ab216432; Abcam, Cambridge, USA), Ubiquitin (1:1000; Cat#ab134953; Abcam, Cambridge, USA), Smad2/3 (1:2000; Cat#ab202445; Abcam, Cambridge, USA), TGF‐β1 (1:2000; Cat#ab315254; Abcam, Cambridge, USA), TGF‐βR1 (1:1000; Cat#ab235578; Abcam, Cambridge, USA) and TGF‐βR2 (1:1000; Cat#ab259360; Abcam, Cambridge, USA); Flag (1:1000; Cat#M20008; Abmart, Shanghai, China).

Techniques: Binding Assay, Software, In Vitro, Western Blot, Ubiquitin Proteomics, Expressing, Quantitative RT-PCR, Migration, Control

TGF‐β1 and its GlyA46 site are important targets for RA in inhibiting EMT and collagen deposition. Following plasmid transfection, Beas‐2B cells were treated with 50 µg/mL RA in the presence or absence of 5% CSE for 24 h. (A) Western Blot analysis of TGF‐β1 expression in TGF‐β1‐knockdown in Beas‐2B cells and quantification analysis ( n = 3 per group). (B) qPCR analysis of TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells with or without TGF‐β1 knockdown ( n = 3 per group). (D) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (E) and fibronectin (F) mRNA expression in Beas‐2B cells ( n = 3 per group). After plasmid transfection and mutation of specific amino acids to alanine, Beas‐2B cells were treated with 50 µg/mL RA for 24 h. (G) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells ( n = 3 per group). (H) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (I) and fibronectin (J) mRNA expression in Beas‐2B cells ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test, * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Advanced Science

Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1

doi: 10.1002/advs.202505256

Figure Lengend Snippet: TGF‐β1 and its GlyA46 site are important targets for RA in inhibiting EMT and collagen deposition. Following plasmid transfection, Beas‐2B cells were treated with 50 µg/mL RA in the presence or absence of 5% CSE for 24 h. (A) Western Blot analysis of TGF‐β1 expression in TGF‐β1‐knockdown in Beas‐2B cells and quantification analysis ( n = 3 per group). (B) qPCR analysis of TGF‐β1 mRNA expression in Beas‐2B cells ( n = 3 per group). (C) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells with or without TGF‐β1 knockdown ( n = 3 per group). (D) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (E) and fibronectin (F) mRNA expression in Beas‐2B cells ( n = 3 per group). After plasmid transfection and mutation of specific amino acids to alanine, Beas‐2B cells were treated with 50 µg/mL RA for 24 h. (G) Representative wound healing images (scale bar = 500 µm) and corresponding cell migration rates in Beas‐2B cells ( n = 3 per group). (H) Immunoblot analysis of TGF‐β1, TGF‐βR1, TGF‐βR2, p‐Smad2/3, Smad2/3, α‐SMA, collagen I, MMP‐12, MMP‐2, PAI‐1, and TIMP‐1 protein levels in Beas‐2B cells ( n = 3 per group). The qPCR analysis of TGF‐β1 (I) and fibronectin (J) mRNA expression in Beas‐2B cells ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test, * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig), PAI‐1 (1:1000; Cat#66261‐1‐Ig) (all from Proteintech, Wuhan, China unless specified); p‐Smad2/3 (1:1000; Cat#8828; Cell Signaling Technology, Danvers, USA), TIMP‐1 (1:1000; Cat#ab216432; Abcam, Cambridge, USA), Ubiquitin (1:1000; Cat#ab134953; Abcam, Cambridge, USA), Smad2/3 (1:2000; Cat#ab202445; Abcam, Cambridge, USA), TGF‐β1 (1:2000; Cat#ab315254; Abcam, Cambridge, USA), TGF‐βR1 (1:1000; Cat#ab235578; Abcam, Cambridge, USA) and TGF‐βR2 (1:1000; Cat#ab259360; Abcam, Cambridge, USA); Flag (1:1000; Cat#M20008; Abmart, Shanghai, China).

Techniques: Plasmid Preparation, Transfection, Western Blot, Expressing, Knockdown, Migration, Mutagenesis

RA prevents CSE‐induced EMT and collagen deposition via the TGF‐β1‐Smad2/3 pathway. The Beas‐2B cells were pre‐incubated with RA for 1 h, followed by co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cells viability was assayed by MTT ( n = 5 per group). (B) Representative western blots for α‐SMA, p‐Smad2/3, and Smad2/3 protein expression and the quantification of α‐SMA, p‐Smad2/3, and Smad2/3 western blots ( n = 3 per group). (C) The fibronectin mRNA expression in Beas‐2B cells was assessed by qRT‐PCR ( n = 3 per group). (D) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantification of Collagen I expression in Beas‐2B cells ( n = 3 per group). (E) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantification of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (F) The MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells were assessed by western blotting ( n = 3 per group). (G) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.

Journal: Advanced Science

Article Title: Rupestonic Acid of Artemisia Rupestris L. Extract Treats Pulmonary Fibrosis in COPD by Targeting TGF‐β1

doi: 10.1002/advs.202505256

Figure Lengend Snippet: RA prevents CSE‐induced EMT and collagen deposition via the TGF‐β1‐Smad2/3 pathway. The Beas‐2B cells were pre‐incubated with RA for 1 h, followed by co‐incubation with 5% CSE for 24 h. (A) The Beas‐2B cells viability was assayed by MTT ( n = 5 per group). (B) Representative western blots for α‐SMA, p‐Smad2/3, and Smad2/3 protein expression and the quantification of α‐SMA, p‐Smad2/3, and Smad2/3 western blots ( n = 3 per group). (C) The fibronectin mRNA expression in Beas‐2B cells was assessed by qRT‐PCR ( n = 3 per group). (D) Representative IF images (scale bar = 200 µm) of Collagen I (green) and DAPI (blue), and quantification of Collagen I expression in Beas‐2B cells ( n = 3 per group). (E) Representative IF images (scale bar = 200 µm) of MMP‐2 (green) and DAPI (blue), and quantification of MMP‐2 expression in Beas‐2B cells ( n = 3 per group). (F) The MMP‐12, TIMP‐1, and PAI‐1 protein levels in Beas‐2B cells were assessed by western blotting ( n = 3 per group). (G) Representative images (scale bar = 500 µm) of wound healing in Beas‐2B cells and the cell migration rate ( n = 3 per group). Data are shown as means ± SD, and a one‐way analysis of variance was performed for multiple group comparisons, with Tukey's test. * p < 0.05, ** p < 0.01, *** p < 0.001 compared with the control group; # p < 0.05, ## p < 0.01, ### p < 0.001 compared with the CSE group.

Article Snippet: The primary antibodies diluted in 5% BSA, and the detailed information was provided as follows: GAPDH (1:5000; Cat#60004‐1‐Ig), Collagen I (1:1000; Cat#66761‐1‐Ig), α‐SMA (1:2000; Cat#67735‐1‐Ig), MMP‐2 (1:1000; Cat#66366‐1‐Ig), MMP‐12 (1:2000; Cat#66930‐1‐Ig), PAI‐1 (1:1000; Cat#66261‐1‐Ig) (all from Proteintech, Wuhan, China unless specified); p‐Smad2/3 (1:1000; Cat#8828; Cell Signaling Technology, Danvers, USA), TIMP‐1 (1:1000; Cat#ab216432; Abcam, Cambridge, USA), Ubiquitin (1:1000; Cat#ab134953; Abcam, Cambridge, USA), Smad2/3 (1:2000; Cat#ab202445; Abcam, Cambridge, USA), TGF‐β1 (1:2000; Cat#ab315254; Abcam, Cambridge, USA), TGF‐βR1 (1:1000; Cat#ab235578; Abcam, Cambridge, USA) and TGF‐βR2 (1:1000; Cat#ab259360; Abcam, Cambridge, USA); Flag (1:1000; Cat#M20008; Abmart, Shanghai, China).

Techniques: Incubation, Western Blot, Expressing, Quantitative RT-PCR, Migration, Control

SERBP1 or Ago2 silencing increases KCC2 expression. ( A ) Forty-eight hours after transfection with either control siRNA, Ago2 siRNA or SERBP1 siRNA (20 nM), SH-SY5Y cells were transfected with PSSG control plasmid or the Serpine1, or APP or KCC2 3′UTR firefly reporter plasmid. Firefly/renilla luminescence ratios were determined 24 h later. The data are presented as the fold increase of normalized luminescence ratios relative to cells transfected with control siRNA. Data represent the mean of three independent experiments +/− S.E.; * p < 0.05; ** p < 0.01. ( B ) Forty-eight hours after transfection with siAgo2 or siSERBP1 or a control siRNA (200 nM), hippocampal neurons were transfected with control plasmid or KCC2 3′UTR luciferase reporter. Firefly/renilla luminescence ratio was analyzed as described in ( A ). Data represent the mean of three independent experiments ± S.E. * p < 0.05. Individual data points for Ago2 (circles) and Serbp1 (triangles) siRNA transfected cells are indicated in ( A ) and ( B ) panels. ( C ) Representative Western blotting showing KCC2 upregulation in hippocampal neurons after SERBP1 silencing. Nitrocellulose membranes were hybridized with KCC2 or SERBP1 antibodies, as indicated. The GAPDH signal was used to normalize different samples. Means +/− S.E. of KCC2 and SERBP1 protein levels obtained from three independent experiments are presented relative to control cells. * p < 0.05; ** p < 0.01 ( t -test).

Journal: Cells

Article Title: Silencing of Ago-2 Interacting Protein SERBP1 Relieves KCC2 Repression by miR-92 in Neurons

doi: 10.3390/cells11061052

Figure Lengend Snippet: SERBP1 or Ago2 silencing increases KCC2 expression. ( A ) Forty-eight hours after transfection with either control siRNA, Ago2 siRNA or SERBP1 siRNA (20 nM), SH-SY5Y cells were transfected with PSSG control plasmid or the Serpine1, or APP or KCC2 3′UTR firefly reporter plasmid. Firefly/renilla luminescence ratios were determined 24 h later. The data are presented as the fold increase of normalized luminescence ratios relative to cells transfected with control siRNA. Data represent the mean of three independent experiments +/− S.E.; * p < 0.05; ** p < 0.01. ( B ) Forty-eight hours after transfection with siAgo2 or siSERBP1 or a control siRNA (200 nM), hippocampal neurons were transfected with control plasmid or KCC2 3′UTR luciferase reporter. Firefly/renilla luminescence ratio was analyzed as described in ( A ). Data represent the mean of three independent experiments ± S.E. * p < 0.05. Individual data points for Ago2 (circles) and Serbp1 (triangles) siRNA transfected cells are indicated in ( A ) and ( B ) panels. ( C ) Representative Western blotting showing KCC2 upregulation in hippocampal neurons after SERBP1 silencing. Nitrocellulose membranes were hybridized with KCC2 or SERBP1 antibodies, as indicated. The GAPDH signal was used to normalize different samples. Means +/− S.E. of KCC2 and SERBP1 protein levels obtained from three independent experiments are presented relative to control cells. * p < 0.05; ** p < 0.01 ( t -test).

Article Snippet: Serpine1 3′UTR: The last 1332 nts of the Serpine1 3′UTR within the full-length clone SC119781 (Origene, Rockville, MD, USA) (SacII/NotI) and the first 509 nts of the Serpine1 3′UTR within the SG-Luc- Serpine1 plasmid (XbaI/SacII) (Amplicon start: chr7: 100362990; Amplicon end: chr7: 100363963 purchased from Switch Gear Genomic (Carlsbad, CA, USA) were cloned into the PSSG plasmid.

Techniques: Expressing, Transfection, Control, Plasmid Preparation, Luciferase, Western Blot