sequencing-based Search Results


93
Thermo Fisher mn01253033 sequence based reagent taqman probe
Mn01253033 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mn01253033 sequence based reagent taqman probe/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
mn01253033 sequence based reagent taqman probe - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

95
Chem Impex International h l dab boc ome
H L Dab Boc Ome, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/h l dab boc ome/product/Chem Impex International
Average 95 stars, based on 1 article reviews
h l dab boc ome - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier

90
Thermo Fisher reagent ndufb6 thermo scientific mm07294890 m1 sequence
Reagent Ndufb6 Thermo Scientific Mm07294890 M1 Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reagent ndufb6 thermo scientific mm07294890 m1 sequence/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
reagent ndufb6 thermo scientific mm07294890 m1 sequence - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

86
Thermo Fisher reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence
Reagent Sifxr2 8 Qiagen Si04347833 Tgggtgatatgcatttccgaa Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Thermo Fisher reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence
Reagent Sifxr2 7 Qiagen Si04332454 Ctggaacgcactaaaccctca Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

94
Thermo Fisher rn01525079 sequence based reagent taqman probe
Rn01525079 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rn01525079 sequence based reagent taqman probe/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
rn01525079 sequence based reagent taqman probe - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

94
Thermo Fisher mn00483336 sequence based reagent taqman probe
Mn00483336 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mn00483336 sequence based reagent taqman probe/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
mn00483336 sequence based reagent taqman probe - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

94
Thermo Fisher rn00579806 sequence based reagent taqman probe
Rn00579806 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rn00579806 sequence based reagent taqman probe/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
rn00579806 sequence based reagent taqman probe - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier

86
Thermo Fisher reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence
Reagent Sifxr1 1 Qiagen Si00072233 Atggaatgactgaatctgata Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

93
Thermo Fisher mn00812518 sequence based reagent taqman probe
Mn00812518 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mn00812518 sequence based reagent taqman probe/product/Thermo Fisher
Average 93 stars, based on 1 article reviews
mn00812518 sequence based reagent taqman probe - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

92
Thermo Fisher sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770
Figure 1. <t>SORL1</t> expression in human GAMs is linked to their functional properties.
Sequence Based Reagents Sorl1 Taqman Probe Thermofisher Scientific Hs00983770, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770/product/Thermo Fisher
Average 92 stars, based on 1 article reviews
sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770 - by Bioz Stars, 2026-05
92/100 stars
  Buy from Supplier

86
Thermo Fisher reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence
Figure 1. <t>SORL1</t> expression in human GAMs is linked to their functional properties.
Reagent Sifxr2 6 Qiagen Si04316445 Aaacgtccataaagagttcaa Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

Image Search Results


Figure 1. SORL1 expression in human GAMs is linked to their functional properties.

Journal: EMBO reports

Article Title: SorLA restricts TNFα release from microglia to shape a glioma-supportive brain microenvironment.

doi: 10.1038/s44319-024-00117-6

Figure Lengend Snippet: Figure 1. SORL1 expression in human GAMs is linked to their functional properties.

Article Snippet: Reagent/resource Reference or source Identifier or catalog number Experimental models Human brain tissue samples Department of Neuropathology of the Amsterdam UMC NA HEK293 ATCC CRL-1573 BV2 Przanowski et al, 2018 NA GL261 luc+ /tdT+ Ochocka et al, 2021 NA GL261 WT Ochocka et al, 2021 NA C57BL/6J (M. musculus) Nencki Institute of Experimental Biology, PAS NA SorLA−/− (SorLA-KO/SLKO) C57BL/6J mice Andersen et al, 2005 NA Recombinant DNA pEGFPC2-BIO Swiech et al, 2011 NA GFP-TNFα Manderson et al, 2007 Addgene #28089 SorLA-ΔVPS10P This study NA SorLA-ΔEGF/β-propeller This study NA SorLA-ΔFN3 This study NA SorLA-ΔCR Mehmedbasic et al, 2015 NA SorLA-WT This study NA SorLA mini-VPS10P This study NA SorLA mini-EGF/β-propeller This study NA SorLA mini-FN3 This study NA SorLA mini-CR This study NA Antibodies Anti-Caspase-3 Cell Signaling CS9662 Anti-CD8-alpha Abcam ab217344 Reagent/resource Reference or source Identifier or catalog number Anti-Galectin-3 Biolegend M3/38 Anti-GAPDH Millipore MAB374 Anti-GFP Santa Cruz Biotechnology SC8334 Anti-GM130 BD Biosciences BD610823 Anti-GPX4 Abcam ab125066 Anti-Iba1 WAKO 019-19741 Anti-Iba1 (for iMG staining) Abcam ab5076 Anti-Lamp1 Sigma-Aldrich MABC39 Anti-MPO R&D Systems AF3667 Anti-myc-tag Cell Signaling 2278S Anti-P2RY12 Genetex GTX54796 Anti-PARP Cell Signaling CS9542 Anti-Rab7 Cell Signaling CS95746 Anti-p-RIP1 Cell Signaling CS83613 Anti-RIP1 Cell Signaling CS3493 Anti-p-RIP3 Abcam ab222320 Anti-RIP3 Abcam ab62344 Anti-p-STAT3 Cell Signaling CS9145 Anti-STAT3 Cell Signaling CS9145 Anti-Rab11 BD Biosciences BD610657 Anti-SorLA C-term, produced in rabbit Schmidt et al, 2007 NA Anti-SorLA BD Transduction Laboratories 611861 Anti-SorLA EMD Millipore MABN1793 Anti-SorLA, produced in goat Schmidt et al, 2016 NA Anti-Tmem119 Synaptic Systems 400002 Anti-TNFα Cell Signaling CS11948S Anti-TRFR Abcam ab269513 Anti-Vti1b BD Biosciences BD611404 Oligonucleotides and other sequence-based reagents Sorl1 TaqMan probe ThermoFisher Scientific Hs00983770; Mm01169526 TNFα TaqMan probe ThermoFisher Scientific Mm00443258 © The Author(s) EMBO reports 13 D ow nloaded from https://w w w .em bopress.org on A pril 24, 2024 from IP 113.173.236.9.

Techniques: Expressing, Functional Assay