|
Thermo Fisher
mn01253033 sequence based reagent taqman probe Mn01253033 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mn01253033 sequence based reagent taqman probe/product/Thermo Fisher Average 93 stars, based on 1 article reviews
mn01253033 sequence based reagent taqman probe - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Chem Impex International
h l dab boc ome H L Dab Boc Ome, supplied by Chem Impex International, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/h l dab boc ome/product/Chem Impex International Average 95 stars, based on 1 article reviews
h l dab boc ome - by Bioz Stars,
2026-05
95/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reagent ndufb6 thermo scientific mm07294890 m1 sequence Reagent Ndufb6 Thermo Scientific Mm07294890 M1 Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reagent ndufb6 thermo scientific mm07294890 m1 sequence/product/Thermo Fisher Average 90 stars, based on 1 article reviews
reagent ndufb6 thermo scientific mm07294890 m1 sequence - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence Reagent Sifxr2 8 Qiagen Si04347833 Tgggtgatatgcatttccgaa Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence/product/Thermo Fisher Average 86 stars, based on 1 article reviews
reagent sifxr2 8 qiagen si04347833 tgggtgatatgcatttccgaa sequence - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence Reagent Sifxr2 7 Qiagen Si04332454 Ctggaacgcactaaaccctca Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence/product/Thermo Fisher Average 86 stars, based on 1 article reviews
reagent sifxr2 7 qiagen si04332454 ctggaacgcactaaaccctca sequence - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rn01525079 sequence based reagent taqman probe Rn01525079 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rn01525079 sequence based reagent taqman probe/product/Thermo Fisher Average 94 stars, based on 1 article reviews
rn01525079 sequence based reagent taqman probe - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
mn00483336 sequence based reagent taqman probe Mn00483336 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mn00483336 sequence based reagent taqman probe/product/Thermo Fisher Average 94 stars, based on 1 article reviews
mn00483336 sequence based reagent taqman probe - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rn00579806 sequence based reagent taqman probe Rn00579806 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rn00579806 sequence based reagent taqman probe/product/Thermo Fisher Average 94 stars, based on 1 article reviews
rn00579806 sequence based reagent taqman probe - by Bioz Stars,
2026-05
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence Reagent Sifxr1 1 Qiagen Si00072233 Atggaatgactgaatctgata Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence/product/Thermo Fisher Average 86 stars, based on 1 article reviews
reagent sifxr1 1 qiagen si00072233 atggaatgactgaatctgata sequence - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Thermo Fisher
mn00812518 sequence based reagent taqman probe Mn00812518 Sequence Based Reagent Taqman Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mn00812518 sequence based reagent taqman probe/product/Thermo Fisher Average 93 stars, based on 1 article reviews
mn00812518 sequence based reagent taqman probe - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770 ![]() Sequence Based Reagents Sorl1 Taqman Probe Thermofisher Scientific Hs00983770, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770/product/Thermo Fisher Average 92 stars, based on 1 article reviews
sequence based reagents sorl1 taqman probe thermofisher scientific hs00983770 - by Bioz Stars,
2026-05
92/100 stars
|
Buy from Supplier |
|
Thermo Fisher
reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence ![]() Reagent Sifxr2 6 Qiagen Si04316445 Aaacgtccataaagagttcaa Sequence, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence/product/Thermo Fisher Average 86 stars, based on 1 article reviews
reagent sifxr2 6 qiagen si04316445 aaacgtccataaagagttcaa sequence - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
Image Search Results
Journal: EMBO reports
Article Title: SorLA restricts TNFα release from microglia to shape a glioma-supportive brain microenvironment.
doi: 10.1038/s44319-024-00117-6
Figure Lengend Snippet: Figure 1. SORL1 expression in human GAMs is linked to their functional properties.
Article Snippet: Reagent/resource Reference or source Identifier or catalog number Experimental models Human brain tissue samples Department of Neuropathology of the Amsterdam UMC NA HEK293 ATCC CRL-1573 BV2 Przanowski et al, 2018 NA GL261 luc+ /tdT+ Ochocka et al, 2021 NA GL261 WT Ochocka et al, 2021 NA C57BL/6J (M. musculus) Nencki Institute of Experimental Biology, PAS NA SorLA−/− (SorLA-KO/SLKO) C57BL/6J mice Andersen et al, 2005 NA Recombinant DNA pEGFPC2-BIO Swiech et al, 2011 NA GFP-TNFα Manderson et al, 2007 Addgene #28089 SorLA-ΔVPS10P This study NA SorLA-ΔEGF/β-propeller This study NA SorLA-ΔFN3 This study NA SorLA-ΔCR Mehmedbasic et al, 2015 NA SorLA-WT This study NA SorLA mini-VPS10P This study NA SorLA mini-EGF/β-propeller This study NA SorLA mini-FN3 This study NA SorLA mini-CR This study NA Antibodies Anti-Caspase-3 Cell Signaling CS9662 Anti-CD8-alpha Abcam ab217344 Reagent/resource Reference or source Identifier or catalog number Anti-Galectin-3 Biolegend M3/38 Anti-GAPDH Millipore MAB374 Anti-GFP Santa Cruz Biotechnology SC8334 Anti-GM130 BD Biosciences BD610823 Anti-GPX4 Abcam ab125066 Anti-Iba1 WAKO 019-19741 Anti-Iba1 (for iMG staining) Abcam ab5076 Anti-Lamp1 Sigma-Aldrich MABC39 Anti-MPO R&D Systems AF3667 Anti-myc-tag Cell Signaling 2278S Anti-P2RY12 Genetex GTX54796 Anti-PARP Cell Signaling CS9542 Anti-Rab7 Cell Signaling CS95746 Anti-p-RIP1 Cell Signaling CS83613 Anti-RIP1 Cell Signaling CS3493 Anti-p-RIP3 Abcam ab222320 Anti-RIP3 Abcam ab62344 Anti-p-STAT3 Cell Signaling CS9145 Anti-STAT3 Cell Signaling CS9145 Anti-Rab11 BD Biosciences BD610657 Anti-SorLA C-term, produced in rabbit Schmidt et al, 2007 NA Anti-SorLA BD Transduction Laboratories 611861 Anti-SorLA EMD Millipore MABN1793 Anti-SorLA, produced in goat Schmidt et al, 2016 NA Anti-Tmem119 Synaptic Systems 400002 Anti-TNFα Cell Signaling CS11948S Anti-TRFR Abcam ab269513 Anti-Vti1b BD Biosciences BD611404 Oligonucleotides and other
Techniques: Expressing, Functional Assay