Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 3. Fn facilitates anti-PD-1 efficacy by systematically activating CD8+ TILs in germ-free immunohumanized mice bearing subcutane- ous MSS CRC xenografts and SPF mice bearing orthotopic MSS CRC allografts (A) Model design for germ-free, CD34+-humanized mice bearing subcutaneous HT29 xenografts and experimental groups (n = 6/group). Mice received Fn, Streptococcus mutans UA159 (UA159), or PBS by gavage 3 times a week. Related results can be found in B–F. (B) Engraftment of human immune cells in CD34+-humanized mice were evaluated 14 weeks post implantation (n = 6/group). (C) Representative tumor morphology, weight, and volume (n = 6/group). Red circles indicate the location of subcutaneous tumors. (D) Ki-67, PCNA, and TUNEL staining of HT29 xenografts (n = 6/group). Tumor tissues were stained using anti-Ki-67, anti-PCNA, or TUNEL kit. For Ki-67 and PCNA IHC staining, blue: hematoxylin+ cells, brown: Ki-67+ or PCNA+ cells. For TUNEL staining, green: methyl green+ cells, brown: apoptotic cells. (E) CD8 and PD-1 co-immunofluorescence staining (n = 4/group) and PD-1 IHC in HT29 xenografts (n = 6/group). Tumor tissues were stained using DAPI, Alexa Fluor 647 anti-human CD8, anti-mouse PD-1, and Alexa Fluor 488 anti-Rabbit IgG H&L antibodies for immunofluorescence staining, and anti-PD-1 for IHC. For immunofluorescence staining, red: CD8+ cells, green: PD-1+ cells, blue: DAPI+ cells, yellow: PD-1+ CD8+ cells. For PD-1 IHC staining, blue: hematoxylin+ cells, brown: PD-1+ cells. (F) Flow cytometry analyses of infiltration of CD8+ T cells in HT29 xenografts, and PD-1, IFN-g, TNF-a, and GZMB expression in CD8+ TILs (n = 6/group). (G) Model design for SPF BALB/c mice bearing orthotopic CT26 allografts and experimental groups. Mice were gavaged with Fn conditioned medium (CM), UA159 CM (UACM), or broth Ctrl daily, with anti-PD-1 mAb (aPD-1) or IgG twice a week (n = 8–12/group). Red circles indicate the location of orthotopic tumors. Related results can be found in (H) and (I). (H) Representative tumor morphology, weight, and volume of CT26 allografts (n = 8–12/group).

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: TUNEL Assay, Staining, Immunohistochemistry, Flow Cytometry, Expressing

Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 4. Fn decreases PD-1 expression in CD8+ T cell through its small-molecule metabolites (A) Effects of Fn CM fractions on decreasing PD-1 expression in CD8+ T cell after co-culture for 18 h, as determined by flow cytometry (n = 6/group). Fn CM PK: Fn CM treated with proteinase K; >100 kDa: Fn CM > 100 kDa fraction; 10–100 kDa: Fn CM 10–100 kDa fraction; 3–10 kDa: Fn CM 3–10 kDa fraction; <3 kDa: Fn CM < 3 kDa fraction. (B) Workflow to define candidate metabolites from Fn culture medium that suppress PD-1 expression in CD8+ T and promote CD8+ T cell activation in vitro. (C) Orthogonal partial least squares discriminant analysis (OPLS-DA) score plot based on non-targeted metabolomic analysis of Fn CM < 3 kDa vs. control (left) and Fn gavage vs. PBS gavage germ-free mouse feces (right) (n = 6/group). (D) Venn diagram of enriched metabolites in Fn CM < 3 kDa vs. control CM, and Fn gavage vs. PBS gavage in germ-free mouse feces, and metabolomic heatmap of metabolites enriched after Fn gavage vs. PBS gavage germ-free mouse feces as determined by untargeted metabolomics (n = 6/group). (E) Targeted metabolomic analysis of short-chain fatty acids (SFCAs) in Fn- and PBS-gavaged germ-free mouse feces (left). Butyric acid quantification in CM and feces from germ-free mice (right) (n = 6/group). (F) Effect of sodium butyrate (NaB) on the expression of PD-1 and GZMB in splenic CD8+ T cells from tumor-bearing mice (n = 6/group).

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: Expressing, Co-Culture Assay, Cytometry, Activation Assay, In Vitro, Control

Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 5. Fn boosts response to anti-PD-1 therapy through its metabolite butyric acid (A) Workflow for the construction of FN0271 mutant Fn strain deficient in butyric acid biosynthesis. PCR products of FN0271 were analyzed by agarose gel electrophoresis to confirm the insertion mutant of Fn (left). GC-MS was conducted to detect butyric acid levels in Fn CM and FN0271 mutant (Mut) Fn CM (right). (B) Effect of Fn CM, Mut Fn CM, and NaB on PD-1 and GZMB expression in splenic CD8+ T cells (n = 6/group). (C) Evaluation of T cell proliferation by carboxyfluorescein succinimidyl ester (CFSE) assay and flow cytometry (n = 6/group). (D) Workflow to assess Fn CM and Mut Fn CM on anti-PD-1 mAb efficacy in vitro using CD8+ TILs from CT26 tumor-bearing mice. (E) Effect of Fn CM and Mut Fn CM in combination with anti-PD-1 mAb (aPD-1) on PD-1, GZMB, and IFN-g expression in CD8+ TILs (n = 6/group). All results are presented as mean ± SD. Each data point in bar plots represents one subject. Statistical significance was determined by one-way ANOVA. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S6.

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: Mutagenesis, Agarose Gel Electrophoresis, Gas Chromatography-Mass Spectrometry, Expressing, CFSE Assay, Cytometry, In Vitro

Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 6. Fn boosts anti-PD-1 mAb tumor-killing effects through its metabolite butyric acid in autologous co-culture system of PBMCs with tumor organoids from patients with MSS CRC (A) Schematic diagram for the evaluation of Fn CM and metabolites on anti-PD-1 therapy-mediated killing of CRC organoids with autologous peripheral blood mononuclear cell (PBMC)-derived CD8+ T cells. (B) Representative images of anti-PD-1 (aPD-1) therapy combined with Fn CM, FN0271 Mut Fn CM, or NaB on tumor killing efficiency. MSS CRC organoids (red) were labeled with CellTrace Far Red and apoptotic cells were labeled with green caspase-3/7 probe (n = 6/group). Black circle: organoid, small dot: T cell, red: CellTrace far red+ cells, green: caspase-3/7+ cells. (C) Apoptosis in CRC organoids, as determined by flow cytometry (n = 6/group). (D) Flow cytometry of PD-1, GZMB, and IFN-g in autologous CD8+ T cells (n = 3/group). All results are presented as mean ± SD. Each data point in bar plots represents one subject. Statistical significance was determined by one-way ANOVA. *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. See also Figure S7 and Table S2.

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: Co-Culture Assay, Derivative Assay, Labeling, Cytometry, Flow Cytometry

Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 7. Fn-derived butyrate facilitates anti-PD-1 therapy in MSS CRC in a CD8+ T cell-dependent manner (A) CT26 subcutaneous allografts tumor-bearing BALB/c mice received NaB in drinking water, together with anti-PD-1 mAb (aPD-1), anti-CD8a mAb, or IgG twice a week (n = 6–10/group). Related results can be found in B–H. (B) Representative tumor gross morphology, tumor weight, and tumor volume. NaB potentiated with anti-PD-1 to suppress tumor growth, an effect abolished by the depletion of CD8+ T cells by anti-CD8a (n = 6–10/group). Red circles indicate the location of subcutaneous tumors. (C) Tumoral butyrate among different groups (n = 6/group). (D) TUNEL, (E) Ki-67, and PCNA IHC in CT26 allografts to analyze cell apoptosis and proliferation (n = 6/group). Tumor tissues were stained using anti-Ki-67, anti- PCNA, or TUNEL kit. For TUNEL staining, green: methyl green+ cells, brown: apoptotic cells. For Ki-67 and PCNA IHC staining, blue: hematoxylin+ cells, brown: Ki-67+ or PCNA+ cells. (F) Infiltration of CD8+ TILs in CT26 allografts, as determined by flow cytometry and (G) IHC (n = 6/group). Tumor tissues were stained using anti-CD8. Blue: hematoxylin+ cells, brown: CD8+ cells.

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: Derivative Assay, TUNEL Assay, Staining, Immunohistochemistry, Cytometry

Journal: Cancer cell

Article Title: Fusobacterium nucleatum facilitates anti-PD-1 therapy in microsatellite stable colorectal cancer.

doi: 10.1016/j.ccell.2024.08.019

Figure Lengend Snippet: Figure 8. Fn metabolite butyric acid regulates CD8+ T cell through an epigenetic mechanism leading to upregulation of TBX21 (T-bet) (A) CD8+ T cells treated with Fn CM, FN0271 Mut Fn CM, and control CM were analyzed by RNA sequencing. Principal component analysis (PCA) and heatmap analysis of differentially expressed genes, and validation by qPCR (n = 3/group). qPCR data were normalized using Actb as an internal control.

Article Snippet: For CD8+ T cell depletion experiment, 200 mg of InVivoMAb anti-mouse CD8a (BE0004-1, clone: 53-6.7, Bio X Cell, USA) or isotype control IgG (BE0089, clone: 2A3, Bio X Cell, USA) was injected intraperitoneally twice a week.

Techniques: Control, RNA Sequencing, Biomarker Discovery

Journal: Cell Reports

Article Title: The protease SPRTN and SUMOylation coordinate DNA-protein crosslink repair to prevent genome instability

doi: 10.1016/j.celrep.2021.110080

Figure Lengend Snippet:

Article Snippet: Rabbit anti-53BP1 , Santa Cruz Biotechnology , Cat#sc-22760; RRID: AB_2256326.

Techniques: Virus, Subcloning, Recombinant, Staining, Picogreen Assay, Proliferation Assay, Flow Cytometry, DNA Extraction, Sequencing, Luciferase, Software, Transfection, Modification, Magnetic Beads, Membrane

Journal: eLife

Article Title: Conserved and unique features of terminal telomeric sequences in ALT-positive cancer cells

doi: 10.7554/eLife.106657

Figure Lengend Snippet: ( A – C ) Number of telomeric reads containing at least four consecutive telomeric repeats corresponding to the G-rich (green) and C-rich (red) strands in the ALT-positive G292, SAOS2, and U2OS cell lines. Telomeric reads are normalized to the total number of reads identified by END-seq and are represented as reads per million (RPM). ( D ) Sequence logo representing the conservation at chromosome ends. A sequence logo representing the conservation (bits) of the last 6 nucleotides at the 5′ end of chromosomes in ALT cells. Fraction of reads with CCAATC as 5′ end is displayed. ( E ) Cells expressing either a nontargeting shRNA (shScr) or a shRNA targeting POT1 (shPOT1-1) were stained for 53BP1 (red) and telomeric DNA ( TTAGGG , green). The scale bar represents 10 μm. ( F ) Quantification of the data shown in ( E ). Graphs indicated the percentage of cells that have at least five telomere dysfunctional foci (TIF) with 53BP1 co-localizing at telomeres. ( G ) Percentage of telomeric reads that have the indicated sequence as a 5′ sequence that have as a 5′ end. The following sequences ( CCCAAT -5′, TCCCAA -5′, and ATCCCA -5′) are grouped and labeled as ‘Rest’. Cells expressing either a nontargeting shRNA (shScr) or a shRNA targeting POT1 (shPOT1-1 and shPOT1-2) were harvested 3 days post induction and analyzed by END-seq. Kullback–Leibler divergence (KL divergence) analysis was used to compare the distributions of the individual conditions. KL divergence between 0.25 and 0.375 is represented by two dots (●●), KL divergence greater than 0.375 is represented by three dots (●●●).

Article Snippet: Primary antibodies used in this study were TRF2 (NB110-57130, Novus Biologicals, rabbit), RPA32/RPA2 (2208, Cell Signaling, rat), Myc (2276, Cell Signaling, mouse), and 53BP1 (NB100-304, Novus Biologicals, rabbit).

Techniques: Sequencing, Expressing, shRNA, Staining, Labeling

Journal: eLife

Article Title: A TOPBP1 allele causing male infertility uncouples XY silencing dynamics from sex body formation

doi: 10.7554/eLife.90887

Figure Lengend Snippet:

Article Snippet: Antibody , Anti-BRCA1 (rabbit polyclonal) , Proteintech , 22362-1-AP , Western blot 1:1000.

Techniques: Sequencing, Mutagenesis, Western Blot, Purification, Injection, In Situ, Software

Journal: eLife

Article Title: DNA damage induces nuclear actin filament assembly by Formin-2 and Spire-1/2 that promotes efficient DNA repair

doi: 10.7554/eLife.07735

Figure Lengend Snippet: ( A ) Scatter plot comparing the number of 53BP1-mTagBFP2 foci per cell and 53BP1-mTagBFP2 expression level following treatment with 0.01% MMS for 120′. N = 354 cells. ( B ) Localization of Utr230-EN after 0.01% MMS treatment following transient siRNA knockdown of exportin-6 (XPO6) or IPO9. ( C ) Quantification of elongated nuclear filament formation after increasing doses of MMS in IPO9, XPO6, and control siRNA knockdown lines. N = 126–150 cells. ( D ) Quantification of DSBs per cell detected by 53BP1 antibody after increasing doses of MMS in IPO9, XPO6, and control knockdown cell lines. N = 126–150 cells. Asterisks indicate p-values < 10E-2 (*) or 10E-3 (**). DOI: http://dx.doi.org/10.7554/eLife.07735.007

Article Snippet: 53BP1 fragment was subcloned from Addgene plasmid #19835 ( ) and was provided by Beth Cimini. mCherry-FMN2 was provided by Sonia Rocha and includes the following N-terminal insertion in comparison to the NCBI human FMN2 reference sequence (accession number NP_064450.3): AGATCTCATTCGATTCGCACGGTGGAGATTAAAGTCCCCGAGATAGAGGAAACGTTTTTCGCGCCCAGGTTCAGCGAGGAGCCGCGCGGGGGCAGAGGGGGCGGCGGCGGCGGGCGGGGAGCCAGGCCCGAGCTGCGTTCTGCGCAGCCATTGGTGGGCGCCGCACTCTGCACTGAGCATGTTCGCGCCCCGCCGGCCCCTAGCCGCAGCCGCAGCCGCAGCGACGGCAGCCACGGGAGCCGCCGCGCATTATGCAAAGCGGCGGCAGATGCGAGCGGGGCCAGCCGGGCGCGCGTCGGCCTCCCCTCCCAGCGGCTCCCCCCGCCGCCGCCTGACTCTCCCGGGAGACTCCCTAGGCCCGGGATTGCACC. roGFP2 was a gift from Philip Merksamer and Ferroz Papa.

Techniques: Expressing, Knockdown, Control

Journal: eLife

Article Title: DNA damage induces nuclear actin filament assembly by Formin-2 and Spire-1/2 that promotes efficient DNA repair

doi: 10.7554/eLife.07735

Figure Lengend Snippet: ( A ) Double-strand break (DSB) sites detected by 53BP1 immunofluorescence after 30′, 60′, 90′, and 120′ incubations in 0.01% MMS. ( B ) Average number of DSB foci detected by 53BP1 immunofluorescence per cell after stable shRNA knockdown of the nuclear actin import factors, importin-9 (IPO9) or cofilin, after 0.01% MMS incubation. N = 125–172 cells per condition. ( C ) Average number of DSB foci detected by gamma H2AX immunofluorescence per cell after stable shRNA IPO9 knockdown following 0.01% MMS incubation. N = 182–241 cells per condition. ( D ) Partial rescue of control DSB foci levels after IPO9 knockdown by overexpression of wild-type actin-NLS-P2A-mCherry but not non-polymerizing R62D mutant of actin-NLS-P2A-mCherry. N = 118–150 cells per condition. ( E ) Full rescue of non-Target control DSB foci levels after IPO9 knockdown by overexpression of wild-type actin-NLS-P2A-mCherry but not non-polymerizing R62D mutant of actin-NLS-P2A-mCherry. N = 262–291 cells per condition. ( F ) Comparison of the distributions of long (>1 micron) nuclear filaments per cell and 53BP1 foci counts. N = 206 cells. ( G ) Co-localization assays between Utr230-EN and DSBs after 120′ incubation in 0.01% MMS. Asterisks indicate p-values < 10E-2 (*), 10E-3 (**), or 10E-4 (***) for all panels. DOI: http://dx.doi.org/10.7554/eLife.07735.006

Article Snippet: 53BP1 fragment was subcloned from Addgene plasmid #19835 ( ) and was provided by Beth Cimini. mCherry-FMN2 was provided by Sonia Rocha and includes the following N-terminal insertion in comparison to the NCBI human FMN2 reference sequence (accession number NP_064450.3): AGATCTCATTCGATTCGCACGGTGGAGATTAAAGTCCCCGAGATAGAGGAAACGTTTTTCGCGCCCAGGTTCAGCGAGGAGCCGCGCGGGGGCAGAGGGGGCGGCGGCGGCGGGCGGGGAGCCAGGCCCGAGCTGCGTTCTGCGCAGCCATTGGTGGGCGCCGCACTCTGCACTGAGCATGTTCGCGCCCCGCCGGCCCCTAGCCGCAGCCGCAGCCGCAGCGACGGCAGCCACGGGAGCCGCCGCGCATTATGCAAAGCGGCGGCAGATGCGAGCGGGGCCAGCCGGGCGCGCGTCGGCCTCCCCTCCCAGCGGCTCCCCCCGCCGCCGCCTGACTCTCCCGGGAGACTCCCTAGGCCCGGGATTGCACC. roGFP2 was a gift from Philip Merksamer and Ferroz Papa.

Techniques: Immunofluorescence, shRNA, Knockdown, Incubation, Control, Over Expression, Mutagenesis, Comparison