Journal: The Journal of Biological Chemistry

Article Title: A Novel Putrescine Exporter SapBCDF of Escherichia coli *

doi: 10.1074/jbc.M116.762450

Figure Lengend Snippet: Strains, plasmids, and oligonucleotides used in this study

Article Snippet: The amplified fragment was cloned into pACYC184 digested by HindIII and SphI, and the cloned region was sequenced to confirm there was no mutation. table ft1 table-wrap mode="anchored" t5 TABLE 1 caption a7 Strain, plasmid, or oligonucleotide Characteristic or sequence Source or Ref. Strain BW25113 rrnB3 Δ lacZ4787 hsdR514 Δ( araBAD ) 567 Δ( rhaBAD ) 568 rph -1 22 , 46 MG1655 F − prototrophic Laboratory stock SK614 MG1655 but Δ puuP :: kan + FRT This study SK623 MG1655 but Δ puuP ::FRT This study SK626 MG1655 but Δ puuP ::FRT Δ sapBCDF :: kan + FRT This study SK627 pACYC184/SK623 This study SK628 pACYC184/SK626 This study SK634 pSK607/ SK626 This study YS40 MG1655 but Δ sapBCDF :: kan + FRT This study YS111 pACYC184/MG1655 This study YS112 pACYC184/YS40 This study YS113 pSK607/YS40 This study YS226 MG1655 but Δ puuP ::FRT Δ speB ::FRT Δ speC ::FRT This study YS227 MG1655 but Δ puuP ::FRT Δ speB ::FRT Δ speC ::FRT Δ sapBCDF ::FRT This study YS233 pACYC184/YS226 This study YS234 pACYC184/YS227 This study YS235 pSK607/YS227 This study Plasmid pACYC184 p15A replicon cat + tet + New England Biolabs pCP20 oriR101 bla + cat + c I 857 λPR 42 pKD3 oriR γ bla + FRT- cat + -FRT 42 pKD13 oriR γ bla + FRT- cat + -FRT 42 pSK607 p15A replicon cat + sapB + C + D + F + This study Oligonucleotide TTT_HindIII_sapBCDF_start_side TTTAAGCTTTGGGTGCCCACACGTTCGCA This study AAA_SphI_sapBCDF_term_side AAAGCATGCTTAGCGATCTTTACGCCACG This study Open in a separate window Strains, plasmids, and oligonucleotides used in this study Media and Growth Conditions M9 + tryptone medium (M9 minimal medium, except that 1% Bacto-tryptone was used instead of 0.2% glucose) ( 36 ) was employed for the bactericidal assay ( 43 ) and for analysis of putrescine concentration of the culture supernatant of strains with a deletion of puuP encoding a putrescine importer previously described ( 16 ).

Techniques: Plasmid Preparation, Sequencing