Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 1. Amish pedigrees with recessively inherited exertion-associated SUDY. Shown are 2 unrelated Amish pedigrees (pedigree 1 and pedigree 2) (A) with autopsy-negative sudden unexplained deaths or cardiac arrests. Open symbols (circles, women and girls; squares, men and boys) represent unaf- fected individuals. Black symbols represent affected family members. The age (in years) at sudden death is provided below the symbol representing sex. The yellow circles represent those family members whose iPSC-CMs were available for study. The red circle indicates the sudden death victim whose heart tissue was available for study. (B) A representative Sanger sequencing chromatogram from one of the RYR2-duplicated (RYR2 Dup) iPSC clones hosting the homozygous duplication and a graphical representation of the biallelic tandem 344,085 base pair (bp) duplication involving approximately 26,000 bp of intergenic sequence, RYR2’s 5′ UTR/promoter region, and exons 1–4 of RYR2. (C) Bar graph illustrating the calculated copy number of RYR2 alleles in genomic DNA derived from patients known to be negative (WT, 2 copies), heterozygous (3 copies), or homozygous (4 copies) for the RYR2 duplication as well as confirmation of genotype in each control and mutant iPSC clone.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Sequencing, Clone Assay, Derivative Assay, Control, Mutagenesis

Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 2. Reduced RyR2 mRNA and protein in a family member with sudden death. Shown is (A) real-time quantitative PCR (RT-qPCR) of RYR2 mRNA transcript normalized by cardiac troponin (cTnT) for 2 control donor heart tissue samples (control 1, a 42-year-old woman; and control 2, a 39-year-old man) and a heart tissue sample for a family member, a 12-year-old girl with sudden unexplained death in the young (SUDY) who was homozygous for the RYR2 duplication iPSC-CMs. Two independent RT-qPCR experiments with 6 technical replicates each (N = 12) and (B) representa- tive Western blots with RyR2 and cardiac α-actinin antibodies from the family member with SUDY and 2 unrelated control donor heart tissue samples (3 independent Western blots per sample). Shown are immunofluorescence (IF) images of a section of heart tissue collected from a relative with SUDY (pedigree 1, Figure 1) who died suddenly during exertion and a healthy 42-year-old female heart donor. (C) The individual IF images of RyR2 (red) and the cardiac marker cTnT (green) and the merged image along with DAPI staining for both the control and SUDY victim. (D) The individual IF images of the SR marker proteins calreticulin (green) and calsequestrin-2 (CASQ2, green) and the cardiac marker α-actinin (red) and the merged image along with DAPI staining for both the control and SUDY victim. Data are presented as mean ± SEM.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Control, Western Blot, Immunofluorescence, Marker, Staining

Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 3. Fluo-4–measured calcium transient comparison. Shown are (A) screenshots of representative iPSC-CMs imaged and corresponding regions of interest used for calcium handling assessment and (B) representative raw tracings from unrelated WT (WT1) control iPSC-CMs and both patient human iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1). Also shown are summary data bar graphs of (C) Fluo-4–measured calcium transient amplitude, normalized by (F – F0)/F0, (D) calcium transient decay 50% (τ), and (E) calcium transient time-to-peak values for (WT1 and WT2) control iPSC-CMs and both patient iPSC-CM lines (RYR2 Dup 1 clone 1 and clone 2 and RYR2 Dup 2 clone 1 and clone 2). Data are presented as mean ± standard deviation. n = 7 to 24 per group (Table 1).

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Comparison, Control, Standard Deviation

Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 4. Reduced Ca2+ response in RYR2 duplication iPSC-CMs to ISO and to caffeine compared with control iPSC-CMs. Representative Fluo-4–mea- sured calcium transient before (blue trace) and after 100 nM ISO (red trace) are shown for (A) WT (WT1) control iPSC-CMs and (B) the homozygous RYR2 duplication iPSC-CMs for patient 1. (C) The average calcium transient amplitude summary data at baseline and after 100 nM ISO treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Representative Fluo-4–measured calcium transients before and after 10 mM caffeine are shown for (D) WT1 control iPSC-CMs (blue trace) and the homozygous RYR2 duplication iPSC-CMs for patient 1 (red trace). (E) The average calcium transient amplitude summary data at baseline (BL) and after 10 mM caffeine (Caff) treatment for the WT1 and WT2 controls and both patient iPSC-CMs (2 clones each). Data are presented as mean ± SEM (Table 1). A 2-tailed Student’s t test was performed to determine statistical significance between 2 groups. P < 0.05 was considered to be significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Control, Clone Assay

Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 5. Action potential recordings by patch-clamp showing DAD events in RYR2 duplication iPSC-CMs. Represen- tative action potential traces from (A) WT (WT1) control iPSC-CMs (n = 10) and (B) RYR2 Dup 1-c2 mutant iPSC-CMs under baseline conditions (n = 10) and (C) RYR2 Dup 1-c2 mutant (n = 8) and (D) RYR2 Dup 2-c2 mutant (n = 5) iPSC-CMs following ISO (100 nM) treatment. DAD events are indicated by the arrow.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Patch Clamp, Control, Mutagenesis

Journal: JCI insight

Article Title: Molecular characterization of the calcium release channel deficiency syndrome.

doi: 10.1172/jci.insight.135952

Figure Lengend Snippet: Figure 6. Field potential recording–based arrhythmic activity measurement. (A) Representative field potential (FP) recordings from WT (WT1) and the homozygous RYR2 duplication iPSC-CMs for both patients (RYR2 Dup 1 and RYR2 Dup 2) at baseline (top) and following ISO (100 nM) treatment (bottom). (B) A bar graph summary showing the erratic beating frequency (i.e., arrhythmic events) present at baseline and following ISO treatment in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs for both patients. WT1-iPSC-CM baseline (n = 158, SEM = 1.25), WT-iPSC-CM ISO (n = 160, SEM = 1.5), RYR2 Dup 1-c1-iPSC-CM baseline (n = 165, SEM = 1.9), RYR2 Dup 1-c1-iPSC-CM ISO (n = 419, SEM = 1.7), RYR2 Dup 2-c1-iPSC-CM baseline (n = 129, SEM = 2.9), RYR2 Dup 2-c1-iPSC-CM ISO (n = 100, SEM = 3.8). (C) Representative FP recordings from WT1 control and RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) treatment alone, and following ISO with nadolol (10 μM). (D) A bar graph summary of the erratic beating frequency (i.e., arrhythmic events) present in WT1 iPSC-CMs compared with RYR2 duplication iPSC-CMs from patient 2 (RYR2 Dup 2 clone 1) at baseline, following ISO (100 nM) and in response to pharmacotherapies (nadolol at 10 μM, propranolol at 1 μM, and flecainide at 6 μM). Data are shown as number of experiments, where each experiment includes data acquired from 250–500 electrode recordings each. WT1-iPSC-CM baseline (n = 4, SEM = 1.5), ISO (n = 12, SEM = 0.4), ISO + nadolol (n = 12, SEM = 0.20), ISO + propranolol (n = 12, SEM = 0.20), and ISO + flecainide (n = 12, SEM = 1.7). RYR2 Dup 2-c1-iPSC-CM baseline (n = 4, SEM = 3.9), ISO (n = 12, SEM = 1.5), ISO + nadolol (n = 12, SEM = 1.1), ISO + propranolol (n = 12, SEM = 0.72), and ISO + flecainide (n = 12, SEM = 1.2). Data are present- ed as mean ± SEM. The symbol *** represents P < 0.0001. A 1-way ANOVA with Tukey’s test was performed to determine statistical significance between multiple groups. P < 0.05 was considered significant.

Article Snippet: Two human RYR2 siRNAs were purchased from OriGene Technologies, Inc. (catalog SR304208, GGACUAUAACAGGGCAAAGUGG, CCGAUACAACGAAGUCAUGCAA) and 1 scramble RNA (catalog SR30004).

Techniques: Activity Assay, Control