Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot, Infection, Negative Control, Transfection, Luciferase, Construct, Activity Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Control, Stable Transfection, Plasmid Preparation, Inhibition, MTT Assay

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Western Blot, Expressing

Journal: PLoS ONE

Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein

doi: 10.1371/journal.pone.0053436

Figure Lengend Snippet: A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.

Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from RRM2 truclone (RRM2 (NM_001165931) Human cDNA Clone; Product ID: SC326997; Origene, MD) using PCR-based methods.

Techniques: Expressing, Western Blot

Journal: Cancer

Article Title: Molecular classification of nonsmall cell lung cancer using a 4-protein quantitative assay.

doi: 10.1002/cncr.26450

Figure Lengend Snippet: Figure 1. Antibody validation process. The dynamic range of CK13 (A), CK5 (B), epidermal growth factor receptor (EGFR) (C), and transcription factor 1 (TTF1) (D) expression by Western Blot (WB) in cell lines controls was consistent with AQUA analysis. Immunofluorescence for A431 and HCC193 shown; quantitative immunofluorescence (AQUA) scores displayed in insets.

Article Snippet: Cytokeratin 5 NCL-L-CK5/m 5.2 lg/mL 1 hour RT A431 Novocastra, Newcastle, UK Cytokeratin 13 DE-K13/m IgG2a, kappa 57 lg/mL ON 4 C A431 Dako, Carpinteria, CA Cytokeratin 14 LL002/m IgG3 0.2 lg/mL ON 4 C A431 Thermo Fisher, Fremont, CA Cytokeratin 17 2D10/m IgG1 0.1 lg/mL ON 4 C A431 Abnova, Walnut, CA EGFR 31G7/m IgG1 3 lg/mL ON 4 C EGFR transfected CHO, A431 Zymed/Invitrogen, Carlsbad, CA HER2 r polyclonal 25 lg/mL ON 4 C HER2 transfected CHO Dako, Carpinteria, CA HER3 r polyclonal 0.2 lg/mL ON 4 C HER3 transfected BaF3 Santa Cruz, Santa Cruz, CA HER4 SPM338/m IgG2b 0.4 lg/mL ON 4 C HER4 transfected CHO Santa Cruz, Santa Cruz, CA AKT1 2H10/m 1/200a ON 4 C A431 Cell Signaling, Danvers, MA ERK m polyclonal 1/100a ON 4 C A431 Cell Signaling, Danvers, MA DUSP6 3G2/m IgG1, kappa 0.3 lg/mL ON 4 C Pancreatic carcinoma Novus Biologicals, Littleton, CO STAT1 42H3/r IgG 1/750a ON 4 C Colon carcinoma Cell Signaling, Danvers, MA STAT2 Y141/r IgG 1/200a ON 4 C Breast carcinoma Novus Biologicals, Littleton, CO STAT3 124H6/m 1/500a ON 4 C H1650, HCC2279 Cell Signaling, Danvers, MA mTOR 7C10/r 1/1000a ON 4 C Breast carcinoma, A431, H1299 Cell Signaling, Danvers, MA pS6K 1A5/m 1/200a ON 4 C H1299 Cell Signaling, Danvers, MA pS6 91B2/r IgG 1/400a ON 4 C Colon carcinoma, HCC193 Cell Signaling, Danvers, MA TTF1 8G7G3/m IgG1, kappa 20 lg/mL ON 4 C H2126 Dako, Carpinteria, CA E2F4 SPM179/m IgG1, kappa 2 lg/mL ON 4 C Tonsil Novus Biologicals, Littleton, CO BCL2 124/m IgG1, kappa 2.6 lg/mL ON 4 C Lymphocytes Dako, Carpinteria, CA CC3 5A1/r 1/500* ON 4 C Pancreatic carcinoma Cell Signaling, Danvers, MA MENA 21/m IgA 1 lg/mL ON 4 C A431 BD Biosciences RRM2 1E1/m IgG1, kappa 0.05 lg/mL ON 4 C Pancreatic carcinoma Novus Biologicals, Littleton, CO PTEN 6H2.1/m IgG2b, kappa 0.96 lg/mL ON 4 C H1666 Dako, Carpinteria, CA Abbreviations: M, mouse; ON, overnight; r, rabbit; RT, room temperature. a Antibody concentration not provided by the manufacturer.

Techniques: Biomarker Discovery, Expressing, Western Blot, Immunofluorescence

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Gene Expression, Expressing

Journal: Cancers

Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment

doi: 10.3390/cancers13164200

Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.

Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG; human RRM2 reverse: CTCTCCTCCGATGGTTTGTGTAC (#HP203086 premixed, Origene, Rockville, MD, USA); human RRM2b forward: ACTTCATCTCTCACATCTTAGCCT; human RRM2b reverse: AAACAGCGAGCCTCTGGAACCT (#HP211794 premixed, Origene); human RRM1 premixed, purchased from Realtimeprimers (#VHPS-8020, Elkins Park, PA, USA).

Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: HNRNPK dysfunction induces RRM2 deficiency and nuclear translocation. a , b Volcano plots showing differentially expressed genes in 30 hpf C9 repeat RNA (91S + GFP) zebrafish embryos compared to GFP control embryos ( a ) and 91S + HNRNPK- compared to 91S + GFP-injected embryos ( b ). Significant ( P < 0.0001) up- or down-regulated genes with a logFC > 1 or < − 1 and a logFC > 0.5 or < − 0.5 are indicated in red and blue respectively. Turquoise dots represent all non-significant differentially expressed genes. RRM2 transcripts are downregulated in C9 repeat RNA zebrafish embryos ( a ) and are upregulated upon overexpression of HNRNPK ( b ). c Bar graph showing the relative RRM2 fold change ( N = 2 biological replicates). d , e Effect of RRM2 mRNA injection (0.314 µM) on the 91S repeat RNA-induced axonopathy on axonal length ( d ) and abnormal branching ( e ) ( N = 4 experiments). Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test;**** P < 0.0001. P values are indicated for comparison of abnormal branching. f Western blot detecting RRM2 protein levels in post-mortem motor cortex of non-neurodegenerative controls and C9 ALS/FTD . Total protein was used to normalize data. g Relative quantification of RRM2 protein levels in 5 non-neurodegenerative controls and 7 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01. ( h , i ) Immunohistochemical detection of RRM2 in motor cortex of a representative non-neurodegenerative control ( h ) and a C9orf72 ALS ( i ) case. Arrowheads indicate nuclei of neuronal cells stained negative ( h ) or positive ( i ) for RRM2. Scale bar = 50 µm. j , k Percentage of cells containing nuclei that stain positive ( j ) and negative ( k ) for RRM2 in motor cortex of 5 non-neurodegenerative controls and 5 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Translocation Assay, Control, Injection, Over Expression, Comparison, Western Blot, Quantitative Proteomics, Immunohistochemical staining, Staining

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: HNRNPK and RRM2 are implicated in the DNA damage response in C9 RNA toxicity. a Western blot detecting HNRNPK and RRM2 levels. The upper panel shows the confirmation of reduced HNRNPK protein levels in HeLa cells transfected with HNRNPK siRNA and treated with DMSO or 10 µM CPT. In the middle panel, RRM2 protein levels in untransfected, control siRNA (siCtrl)- and HNRNPK siRNA (siHNRNPK)-transfected cells are presented. Total protein staining was used as loading control (lower panel). b , c Quantification of HNRNPK ( b ) and RRM2 ( c ) protein levels in untransfected CPT-treated cells, or in cells transfected with siCtrl or siHNRNPK ( N = 4–5 experiments). d – g Quantification of HNRNPK ( d, f ) and RRM2 levels ( e , g ) in siCtrl- ( d , e ) or siHNRNPK-transfected cells ( f , g ) treated with DMSO or CPT ( N = 5 experiments). h Western blot detecting reduced RRM2 levels in siHNRNPK-transfected cells compared to cells transfected with siCtrl and collected 4 h post-treatment (upper panel). No difference is observed between DMSO- and CPT-treated cells. Total protein staining was used as loading control (lower panel). i Quantification of RRM2 protein levels ( N = 6 experiments). j , k Immunostaining of RRM2 in siCtrl- ( j ) and siHNRNPK-transfected cells ( k ). l Quantification of nuclear and cytoplasmic RRM2 protein levels measured as mean fluorescence intensity ratio ( N = 3 experiments, 2 technical replicates). Each data point represents the average N/C ratio per replicate. In total, 10 images were analyzed per experiment and per condition. Scale bar = 50 µm. m , n Immunostaining of γH2AX foci in siCtrl- ( m ) and siHNRNPK-transfected ( n ) HeLa cells. Scale bar = 50 µm. o Quantification of the average number of γH2AX foci per cell ( N = 3 experiments). p – s Immunostaining of γH2AX foci in GFP ( p ), 91S + GFP ( q ), 91S + HNRNPK ( r ) and 91S + RRM2 ( s ) RNA-injected 30 hpf zebrafish embryos. Dotted lines indicate the borders of the spinal cord. Scale bar = 50 µm. t Quantification of the fold change of γH2AX positive nuclei in the spinal cord of zebrafish embryos ( N = 3 experiments). b – g , i , l , o , t Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test ( b , c , t ), unpaired t test ( d – g , l ) or Kruskal–Wallis test and Dunn’s multiple comparison test ( i , o ); * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Western Blot, Transfection, Control, Staining, Immunostaining, Fluorescence, Injection, Comparison

Journal: Acta Neuropathologica

Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS

doi: 10.1007/s00401-022-02471-y

Figure Lengend Snippet: Schematic model linking mechanistic insights of HNRNPK and RRM2 in C9orf72 ALS. In the left panel, event of naturally occurring DNA damage (1) in a healthy neuron with consequential RRM2 activation and nuclear translocation (2). HNRNPK is a transcriptional regulator of RRM2 (3), essential for DNA repair in the DNA damage response (4). In the right panel, a neuron affected in C9 ALS/FTD is characterized by DPRs and RNA foci, consisting of C9orf72 repeat RNA and sequestered RNA-binding proteins, including HNRNPK (1a). Next to sequestration, HNRNPK is mislocalized to the cytoplasm (1b), resulting in a loss-of-function of HNRNPK, and directly or indirectly increasing DNA damage, which activates RRM2 (3). Loss-of-function achieves transcriptional dysregulation of downstream effectors of HNRNPK, including RRM2 (4). Activated, though depleted RRM2 results in a disrupted DNA damage response, impeding DNA repair (5). Scheme created with BioRender.com

Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and RRM2 (RC228362, Origene) plasmid constructs were digested with Age I. HNRNPK deletion constructs were synthesized by Genscript (Piscataway, USA) in a pUC57 vector and subcloned in a pCMV6-Entry vector (PS100001, Origene).

Techniques: Activation Assay, Translocation Assay, RNA Binding Assay