|
Sino Biological
rrm2 flag Rrm2 Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/10__1158_slash_0008___5472__can___25___3237-52-0-15?v=Sino+Biological Average 94 stars, based on 1 article reviews
rrm2 flag - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
rrm2 truclone rrm2 nm 001165931 human cdna ![]() Rrm2 Truclone Rrm2 Nm 001165931 Human Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc03546076-46-10-20?v=OriGene Average 90 stars, based on 1 article reviews
rrm2 truclone rrm2 nm 001165931 human cdna - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Novus Biologicals
a431 bd biosciences rrm2 1e1 m igg1 ![]() A431 Bd Biosciences Rrm2 1e1 M Igg1, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pm22009766-52-289-303?v=Novus+Biologicals Average 90 stars, based on 1 article reviews
a431 bd biosciences rrm2 1e1 m igg1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Proteintech
rabbit antirrm2 ![]() Rabbit Antirrm2, supplied by Proteintech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc09170012__pnas__2115638119__sapp-62-106-107?v=Proteintech Average 94 stars, based on 1 article reviews
rabbit antirrm2 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
rrm2 gfp ![]() Rrm2 Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc05650473-9-4-6?v=OriGene Average 90 stars, based on 1 article reviews
rrm2 gfp - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti rrm2 ![]() Anti Rrm2, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc06744422-225-0-4?v=Novus+Biologicals Average 93 stars, based on 1 article reviews
anti rrm2 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
novus biologicals
nbp1-31661 ![]() Nbp1 31661, supplied by novus biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc12166406-4-0-4?v=novus+biologicals Average 93 stars, based on 1 article reviews
nbp1-31661 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Novus Biologicals
mouse monoclonal anti rrm2 antibody ![]() Mouse Monoclonal Anti Rrm2 Antibody, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pm25695839-54-53-59?v=Novus+Biologicals Average 90 stars, based on 1 article reviews
mouse monoclonal anti rrm2 antibody - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
human rrm2 reverse ![]() Human Rrm2 Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc08391410-89-8-14?v=OriGene Average 94 stars, based on 1 article reviews
human rrm2 reverse - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
OriGene
rrm2 sh1 knockdown plasmids ![]() Rrm2 Sh1 Knockdown Plasmids, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc07720568-60-3-10?v=OriGene Average 90 stars, based on 1 article reviews
rrm2 sh1 knockdown plasmids - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
rrm2 ![]() Rrm2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc09381635-33-5-7?v=OriGene Average 90 stars, based on 1 article reviews
rrm2 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp rrm2 mm00485881 g1 ![]() Gene Exp Rrm2 Mm00485881 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/rrm2/pmc02775940-322-11-8?v=Thermo+Fisher Average 87 stars, based on 1 article reviews
gene exp rrm2 mm00485881 g1 - by Bioz Stars,
2026-07
87/100 stars
|
Buy from Supplier |
Image Search Results
Journal: PLoS ONE
Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein
doi: 10.1371/journal.pone.0053436
Figure Lengend Snippet: A, RRM2 mRNA expression in pancreatic cancer cell lines relative to expression identified in HPDE. Columns, mean of triplicate; bars, SD. n = 3. B, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDa) in whole cell lysates of HPDE and pancreatic cancer cell lines. C, Expression of let- 7 family members in pancreatic cancer cell lines relative to expression in HPDE. Columns , mean of triplicate; bars , SD. n = 3; * P <0.05. D, RRM2 is a direct target of let-7 . 293TA and MIA PaCa-2 cells were virally infected for expression of precursors of let-7a-1 , let-7a-2 , let-7a-3 , let-7b , and miR-214 ( negative control ) and subsequently transfected with a RRM2 3′ UTR luciferase reporter construct. Luciferase activities measured 36 h after transfection (normalized relative to renilla activity) were plotted. Columns , mean of triplicate; bars , SD. n = 3. * p <0.05, ** p <0.01.
Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from
Techniques: Expressing, Western Blot, Infection, Negative Control, Transfection, Luciferase, Construct, Activity Assay
Journal: PLoS ONE
Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein
doi: 10.1371/journal.pone.0053436
Figure Lengend Snippet: A , Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) in whole cell lysates of MIA PaCa-2 overexpressing precursors of let-7 family members. Ratios of RRM2 to β-actin band intensities (normalized to control) from three experiments are indicated ( top ). Asterisks indicate significant reductions ( p <0.05) in RRM2 levels compared with control. B , Immunocytochemical detection of RRM2 in exponentially growing MIA PaCa-2 overexpressing pre- let-7 family members. Original magnification, x20. C , MIA PaCa-2 cells stably overexpressing pre- let-7 family members ( red ) or vector alone ( blue ) were treated with gemcitabine (0.1 nM to 100 µM), and percent inhibition of cellular proliferation was measured using an MTT assay. Points , mean of triplicate; bars , SE. n = 3. Gemcitabine IC 50 estimations indicated ( parentheses ).
Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from
Techniques: Western Blot, Control, Stable Transfection, Plasmid Preparation, Inhibition, MTT Assay
Journal: PLoS ONE
Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein
doi: 10.1371/journal.pone.0053436
Figure Lengend Snippet: A, Western blotting analysis of hENT1 (∼50–55 kDa), hENT2 (50 kDa), hCNT1 (72 kDa), hCNT3 (77 kDa), CDA (55 kDa), dCK (30 kDa), RRM1 (94 kDa), RRM2 (45 kDa), and β-actin (45 kDA) levels in whole cell lysates of Capan-1 and Capan-1-GR cells. B , RRM2 protein increased in a gemcitabine dose-dependent fashion in Capan-1-GR cells. C, Western blotting analysis of RRM2 (∼45 kDa) and β-actin (45 kDA) levels in cells with acquired gemcitabine resistance. Ratios of RRM2 to β-actin band intensities (normalized to untreated cells) from three experiments are indicated ( top ). Asterisk indicates significantly higher RRM2 expression in gemcitabine-resistant cells ( p <0.05) compared with untreated cells. D and E, Relative expression of precursor and mature let-7a in Capan-1 ( D ) and L3.6pl ( E ) cells induced to acquire gemcitabine resistance. Columns, mean of triplicate; bars, SD. n = 3. F , Differential miRNA expression in Capan-1-GR compared with Capan-1. Putative RRM2-modulating miRNAs and their extent of reduction in Capan-1-GR cells are shown ( right ).
Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from
Techniques: Western Blot, Expressing
Journal: PLoS ONE
Article Title: Differential Processing of let-7 a Precursors Influences RRM2 Expression and Chemosensitivity in Pancreatic Cancer: Role of LIN-28 and SET Oncoprotein
doi: 10.1371/journal.pone.0053436
Figure Lengend Snippet: A and B, Relative expression of primary let-7a transcripts ( A ) and mature let-7a ( B ) in 2 normal pancreatic tissues and 10 PDAC samples representing various tumor stages. C , Ratios of mature to precursor let-7a transcripts calculated from data points in A and B . D, Western blotting analysis of RRM2 (45 kDa) in total lysates (50 µg) of 6 matched normal-PDAC pairs. Ratios of RRM2 band intensities in PDACs compared to matched normal tissues indicated ( top ). Asterisk indicates significantly higher RRM2 expression in PDAC tissues ( p <0.05) compared with matched normal tissues. E and F, Relative expression of primary let-7a transcripts ( E ) and mature let-7a ( F ) in matched normal-PDAC pairs. G , Ratios of mature to precursor let-7a transcripts calculated from data points in E and F . Asterisk indicates significantly lower mature to precursor let-7a ratio in PDAC tissues ( p <0.05) compared with matched normal tissues.
Article Snippet: RRM2 cDNA without the 3′ UTR region was constructed from
Techniques: Expressing, Western Blot
Journal: Cancer
Article Title: Molecular classification of nonsmall cell lung cancer using a 4-protein quantitative assay.
doi: 10.1002/cncr.26450
Figure Lengend Snippet: Figure 1. Antibody validation process. The dynamic range of CK13 (A), CK5 (B), epidermal growth factor receptor (EGFR) (C), and transcription factor 1 (TTF1) (D) expression by Western Blot (WB) in cell lines controls was consistent with AQUA analysis. Immunofluorescence for A431 and HCC193 shown; quantitative immunofluorescence (AQUA) scores displayed in insets.
Article Snippet: Cytokeratin 5 NCL-L-CK5/m 5.2 lg/mL 1 hour RT A431 Novocastra, Newcastle, UK Cytokeratin 13 DE-K13/m IgG2a, kappa 57 lg/mL ON 4 C A431 Dako, Carpinteria, CA Cytokeratin 14 LL002/m IgG3 0.2 lg/mL ON 4 C A431 Thermo Fisher, Fremont, CA Cytokeratin 17 2D10/m IgG1 0.1 lg/mL ON 4 C A431 Abnova, Walnut, CA EGFR 31G7/m IgG1 3 lg/mL ON 4 C EGFR transfected CHO, A431 Zymed/Invitrogen, Carlsbad, CA HER2 r polyclonal 25 lg/mL ON 4 C HER2 transfected CHO Dako, Carpinteria, CA HER3 r polyclonal 0.2 lg/mL ON 4 C HER3 transfected BaF3 Santa Cruz, Santa Cruz, CA HER4 SPM338/m IgG2b 0.4 lg/mL ON 4 C HER4 transfected CHO Santa Cruz, Santa Cruz, CA AKT1 2H10/m 1/200a ON 4 C A431 Cell Signaling, Danvers, MA ERK m polyclonal 1/100a ON 4 C A431 Cell Signaling, Danvers, MA DUSP6 3G2/m IgG1, kappa 0.3 lg/mL ON 4 C Pancreatic carcinoma Novus Biologicals, Littleton, CO STAT1 42H3/r IgG 1/750a ON 4 C Colon carcinoma Cell Signaling, Danvers, MA STAT2 Y141/r IgG 1/200a ON 4 C Breast carcinoma Novus Biologicals, Littleton, CO STAT3 124H6/m 1/500a ON 4 C H1650, HCC2279 Cell Signaling, Danvers, MA mTOR 7C10/r 1/1000a ON 4 C Breast carcinoma, A431, H1299 Cell Signaling, Danvers, MA pS6K 1A5/m 1/200a ON 4 C H1299 Cell Signaling, Danvers, MA pS6 91B2/r IgG 1/400a ON 4 C Colon carcinoma, HCC193 Cell Signaling, Danvers, MA TTF1 8G7G3/m IgG1, kappa 20 lg/mL ON 4 C H2126 Dako, Carpinteria, CA E2F4 SPM179/m IgG1, kappa 2 lg/mL ON 4 C Tonsil Novus Biologicals, Littleton, CO BCL2 124/m IgG1, kappa 2.6 lg/mL ON 4 C Lymphocytes Dako, Carpinteria, CA CC3 5A1/r 1/500* ON 4 C Pancreatic carcinoma Cell Signaling, Danvers, MA MENA 21/m IgA 1 lg/mL ON 4 C
Techniques: Biomarker Discovery, Expressing, Western Blot, Immunofluorescence
Journal: Cancers
Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
doi: 10.3390/cancers13164200
Figure Lengend Snippet: MTT viability assay for different dosages of the drug combination cisplatin and gemcitabine after 24 h of incubation for NCI-H295R ( A ) and MUC-1 ( B ) cell lines. Pictures from NCI-H295R ( C ) and MUC-1 ( D ) clonogenic assays for different concentrations of gemcitabine (left) and cisplatin (right) treatment after 24 h incubation. Real-time PCR analysis of RRM1 for NCI-H295R ( E ) and MUC-1 ( F ), as well as RRM2 ( G , H ) and RRM2B ( I , K ). dATP levels for NCI-H295R ( J ) and MUC-1 ( L ) upon different treatments. Quantification of RRM2 protein levels for NCI-H295R ( M ) and MUC-1 ( O ) and RRM2 immunofluorescence (40x) for NCI-H295R ( N ) and MUC-1 ( P ). A representative Western blot used for RRM2 protein expression quantification in NCI-H295R ( Q ) and MUC-1 ( R ) cells. Stars represent significance vs. nontreated for both treatments (*, p < 0.05; **, p < 0.01; ***, p < 0.001).
Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG;
Techniques: MTT Viability Assay, Incubation, Real-time Polymerase Chain Reaction, Immunofluorescence, Western Blot, Expressing
Journal: Cancers
Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
doi: 10.3390/cancers13164200
Figure Lengend Snippet: Relative RRM1 and RRM2 gene expression in normal adrenal (NA), adrenocortical adenoma (ACA), and adrenocortical carcinoma (ACC) samples of an available series form the literature ( A , B ) and of our cohort ( C , D ). Kaplan–Meier survival curves for patients with ACC from our cohort according to low or high expression levels of RRM1 ( E ) or RRM2 ( F ). Correlation between the tumor size and the RRM2 expression levels ( G ).
Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG;
Techniques: Gene Expression, Expressing
Journal: Cancers
Article Title: Novel Insights into the Molecular Regulation of Ribonucleotide Reductase in Adrenocortical Carcinoma Treatment
doi: 10.3390/cancers13164200
Figure Lengend Snippet: Real-time PCR analysis of RRM2 ( A , D ) gene expression and number of surviving cells ( B , E ) under RRM2 siRNA knockdown for NCI-H295R and MUC-1, respectively. RRM2 gene expression upon etoposide and doxorubicin treatment for NCI-H295R and MUC-1 ( C , F ). Quantification of Western blots for p-Chk1 ( G ), p-Chk2 ( H ), and p-H2AX ( I ) for no treatment, gemcitabine, cisplatin, and combination of both (gemcitabine and cisplatin) 24 h after treatment. Schematic illustration of the related DNA damage–repair pathway, including relevant therapeutic inhibitors ( J ). Stars represent significance vs. nontreated (*, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p < 0.0001); ns, non-significant.
Article Snippet: The primers used were human RRM2 forward: CTGGCTCAAGAAACGAGGACTG;
Techniques: Real-time Polymerase Chain Reaction, Gene Expression, Knockdown, Western Blot
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: RRM2 is highly expressed in liver cancer. a The 180 ferroptosis-related factors that were downregulated were identified by TMT, RNA-seq and DNase-seq. b RRM2 was identified as the most significantly upregulated secretory or membrane-bound protein in liver cancer via data mining using the TCGA database. c Scatter plot for serum RRM2 in healthy individuals and patients with hepatitis A, hepatitis B, hepatitis C, lung cancer, gastric cancer, breast cancer, colorectal cancer or liver cancer. d RRM2 expression in the sera from healthy individuals and liver cancer patients, as was evaluated by immunoblotting. e TMA of RRM2 in liver cancer and normal liver tissues. Representative IHC images of TMA stained with anti-RRM2 antibodies are shown. Data were analyzed using a chi-square test. f The UALCAN database was used to analyze alterations in RRM2 expression between liver cancer (n = 371) and normal liver (n = 50) tissues. g Kaplan–Meier survival plots of RRM2 were obtained from the KM plotter database. h RRM2 was highly expressed in SMMC-7721 and HepG2 cell. RRM2 expression was measured by immunoblotting with anti-RRM2 antibodies in established hepatocyte (HL-7702) and liver cancer cell lines, as indicated. The IB data are representative images from three biological replicates. **P < 0.01 indicates statistical significance. Data in c were analyzed using a one-way ANOVA test. Data in e were analyzed using a chi-square test. Data in f were analyzed using Student’s t test. Data in g were analyzed using log rank analysis
Article Snippet: RRM2 overexpression and
Techniques: RNA Sequencing, Membrane, Expressing, Western Blot, Staining
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: RRM2 suppresses ferroptosis in liver cancer cells. a , b RRM2 protein ( a ) and mRNA levels ( b ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as analyzed by immunoblotting and qPCR, respectively. c – e Cell viability ( c ), cell death ( d ) and 4-HNE levels ( e ) were measured in HepG2 and SMMC-7721 cells with ectopically expressed or knocked down RRM2 before further treatment with Fer-1, ZVAD-FMK, Nec-1 or ectopically expressed RRM2. Cell viability was measured using a CellTiter-Glo luminescent cell viability assay, cell death was measured by staining with SYTOX Green followed by flow cytometry, and 4-HNE was measured by a kit from Abcam. f , g Cell death ( f ) and 4-HNE levels ( g ) were measured in HepG2 and SMMC-7721 cells treated with erastin (10 μM, 24 h) in the presence or absence of Fer-1 (1 μM, 24 h). The cells were also cultured with or without RRM2 T33E transfection, as indicated. h – j The levels of GSH ( h ), labile iron ( i ) and membrane-anchored phospholipids ( j ) in HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown were analyzed. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from b − j were analyzed using a one-way ANOVA test
Article Snippet: RRM2 overexpression and
Techniques: Over Expression, Knockdown, Western Blot, Cell Viability Assay, Staining, Flow Cytometry, Cell Culture, Transfection, Membrane
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: RRM2 upregulates GSH by sustaining GSS. a The ferroptosis-related metabolic axis from glucose to GSH. b – g The levels of glycine ( b ), glutamate ( c ), cysteine ( d ), cystathionine ( e ), serine ( f ) and glucose ( g ) were measured in HepG2 and SMMC-7721 cells with or without ectopically expression or knocked down of RRM2. h , i mRNA levels of CBS , CTH , SHMT2 , GSS and GPX4 were analyzed by qPCR in HepG2 ( h ) and SMMC-7721 cells ( i ) administered the indicated treatment. j , k Protein levels of CBS, CTH, SHMT2, GSS and GPX4 were analyzed by immunoblotting in HepG2 and SMMC-7721 cells ( j ). The level of RRM2 was normalized to that of GAPDH, and the normalized level of RRM2 in the untreated group was arbitrarily set to 100% ( k ). ( l ) GSH levels were measured in WT and GSS −/− HepG2 and SMMC-7721 cells with or without RRM2 overexpression or knockdown, as indicated. The data are shown as the mean ± SD from three biological replicates. **P < 0.01 indicates statistical significance. Data from b − i and k − l were analyzed using one-way ANOVA
Article Snippet: RRM2 overexpression and
Techniques: Expressing, Western Blot, Over Expression, Knockdown
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: Phosphorylation of RRM2 at T33 protects GSS from proteasome degradation. a pRRM2 and RRM2 were measured by immunoblotting using anti-RRM2 antibodies following electrophoresis in gels containing Phos-tag™, while GSS was measured by immunoblotting using anti-GSS antibodies following electrophoresis in conventional gels. HepG2 and SMMC-7721 cells were cultured in the presence or absence of erastin (10 μM) for 24 h. Relative pRRM2/RRM2 ratios between groups were also calculated and graphed. b RRM2 was phosphorylated at T33. pRRM2 and RRM2 levels were measured by immunoblotting with anti-Myc antibodies following electrophoresis in Phos-tag™-containing gels of HepG2 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. c RRM2 and GSS were measured by immunoblotting in RRM2 −/− HepG2 and SMMC-7721 cells ectopically expressing RRM2 WT , RRM2 T33A or RRM2 T33E before and after treatment with erastin (10 μM) for 24 h. d RRM2 and GSS were degraded by proteasomes. RRM2 and GSS were measured by immunoblotting in HepG2 cells with the indicated treatments. Erastin and MG132 were treated at concentrations of 10 μM and 8 μM, respectively, for 24 h. e Colocalization of GSS (upper) or RRM2 (lower) with PSMB5 in HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h). Scale bar, 20 μm. f Association of RRM2, GSS and PSMB5 in proteasomes isolated from HepG2 cells cultured in the presence or absence of erastin (10 μM, 24 h) in the presence of MG132 (8 μM, 24 h). Samples from affinity or control beads were analyzed in parallel. g Erastin (10 μM, 24 h) chase of GSS and RRM2 in RRM2 −/− HepG2 and SMMC-7721 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The levels of GSS were also normalized to those of GAPDH, and the normalized level of GSS in the 0 h group was arbitrarily set to 100%. The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. Data from a were analyzed using a one-way ANOVA test. Data from e were analyzed using Student’s t test
Article Snippet: RRM2 overexpression and
Techniques: Phospho-proteomics, Western Blot, Electrophoresis, Cell Culture, Expressing, Isolation, Control
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: Dephosphorylation of RRM2 stimulates RRM2 binding with GSS to promote their corecruitment to the proteasome and subsequent activation of ferroptosis. a , b Reciprocal IP experiments of RRM2 and GSS in RRM2 −/− HepG2 cells reconstituted with RRM2 WT , RRM2 T33A or RRM2 T33E . The amount of proteins in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. c , d Reciprocal IP experiments for RRM2 and GSS in HepG2 cells with or without NU6102 (20 μM, 24 h) and SB203580 (10 μM, 24 h) treatment. The amount of protein in the immunoprecipitates was normalized to that in whole-cell lysates (Input), and was graphed in the lower panel. e Proximal protein ligation between endogenous GSS and the indicated exogenous RRM2-Myc, as measured by PLA in HepG2 cells expressing RRM2 WT , RRM2 T33A or RRM2 T33E . Scale bar, 20 μm. The PLA signals were also calculated and graphed, and the data from the “Empty” group were arbitrarily set to 1. f RRM2 WT , RRM2 T33A or RRM2 T33E was expressed in reconstituted RRM2 −/− HepG2 cells. Immunoprecipitations were acquired with anti-PSMB5 antibodies and further analyzed by immunoblotting using anti-RRM2 and anti-GSS antibodies. GSS and RRM2 enrichment in the immunoprecipitates was calculated as the normalization to the levels in whole-cell lysates (input). g – i GSH ( g ), cell death ( h ) and 4-HNE ( i ) were measured in HepG2 and SMMC-7721 cells with or without RRM2 knockdown before they were further treated with Fer-1 (1 μM, 24 h), ZVAD-FMK (20 μM, 24 h), Nec-1 (20 μM, 24 h), or ectopically expressed GSS, RRM2 T33A or RRM2 WT in the presence or absence of NU6102 (20 μM, 24 h). The data are shown as the mean ± SD from three biological replicates (including IB). *P < 0.05, **P < 0.01 indicates statistical significance. The data from a – d and f – i were analyzed using one-way ANOVA
Article Snippet: RRM2 overexpression and
Techniques: De-Phosphorylation Assay, Binding Assay, Activation Assay, Ligation, Expressing, Western Blot, Knockdown
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: Relationship among serum RRM2, serum AFP and the parameters of liver function in liver cancer patients. The relationships between serum RRM2 levels and serum AFP ( a ), CEA ( b ), ALT( c ), AST ( d ), ALP ( e ), γ-GT ( f ), ALB ( g ), and total bilirubin ( h ) in liver cancer patients are shown. Data from 185 liver cancer patients (from three biological replicates) were used to analyze the relationship using Spearman's rank correlation coefficient
Article Snippet: RRM2 overexpression and
Techniques:
Journal: Cancer Cell International
Article Title: RRM2 protects against ferroptosis and is a tumor biomarker for liver cancer
doi: 10.1186/s12935-020-01689-8
Figure Lengend Snippet: Diagnostic value of serum RRM2 in predicting liver cancer. a ROC curves for serum RRM2, AFP, and the combination of serum RRM2 and AFP for the discriminating patients with liver cancer from healthy individuals. The AUC value represents the combined effects of the sensitivity and specificity of single or combined biomarkers in the diagnosis of patients with liver cancer. All the data were obtained from three biological replicates. b Serum RRM2 is positively associated with tumor stage in liver cancer patients. The first quartile of serum RRM2 levels in liver cancer patients was no more than 300 pg/ml, the second quartile was from 300 to 1200 pg/ml, and the bottom quartile was more than 1200 pg/ml. Liver cancer patients were divided into three groups according to these quartiles. All the data were from three biological replicates. The associations between tumor stage and serum RRM2 in liver cancer patients were analyzed using the χ 2 test. c Correlation between intracellular RRM2 and RRM2 in culture medium from liver cancer cell lines as analyzed by Spearman rank-correlation analysis. d RRM2 expression across multiple cancer types from the UALCAN database. TPM, transcriptions per million. e The model of the study. Under homeostasis, RRM2 is phosphorylated at the T33 site (can be dephosphorylated by NU6102) to sustain GSS and GSH levels and suppress potential ferroptosis. In the ferroptotic state, RRM2 is dephosphorylated and has increased affinity GSS, leading to the subsequent proteasomal degradation of both proteins. With such an effect, GSH eventually declines to facilitate ferroptosis. The data from a-c are shown from three biological replicates. Analysis of the receiver operator characteristics (ROC) and calculation of the area under the curve (AUC) was performed to find the diagnostic values of RRM2, AFP and the combination of RRM2 and AFP for the prediction of liver cancer. **P < 0.01 indicates statistical significance. Data from b were analyzed using the χ 2 test. Data from c were analyzed by Spearman rank-correlation analysis. Data in d were analyzed using Student’s t test
Article Snippet: RRM2 overexpression and
Techniques: Diagnostic Assay, Biomarker Discovery, Expressing
Journal: Acta Neuropathologica
Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS
doi: 10.1007/s00401-022-02471-y
Figure Lengend Snippet: HNRNPK dysfunction induces RRM2 deficiency and nuclear translocation. a , b Volcano plots showing differentially expressed genes in 30 hpf C9 repeat RNA (91S + GFP) zebrafish embryos compared to GFP control embryos ( a ) and 91S + HNRNPK- compared to 91S + GFP-injected embryos ( b ). Significant ( P < 0.0001) up- or down-regulated genes with a logFC > 1 or < − 1 and a logFC > 0.5 or < − 0.5 are indicated in red and blue respectively. Turquoise dots represent all non-significant differentially expressed genes. RRM2 transcripts are downregulated in C9 repeat RNA zebrafish embryos ( a ) and are upregulated upon overexpression of HNRNPK ( b ). c Bar graph showing the relative RRM2 fold change ( N = 2 biological replicates). d , e Effect of RRM2 mRNA injection (0.314 µM) on the 91S repeat RNA-induced axonopathy on axonal length ( d ) and abnormal branching ( e ) ( N = 4 experiments). Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test;**** P < 0.0001. P values are indicated for comparison of abnormal branching. f Western blot detecting RRM2 protein levels in post-mortem motor cortex of non-neurodegenerative controls and C9 ALS/FTD . Total protein was used to normalize data. g Relative quantification of RRM2 protein levels in 5 non-neurodegenerative controls and 7 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01. ( h , i ) Immunohistochemical detection of RRM2 in motor cortex of a representative non-neurodegenerative control ( h ) and a C9orf72 ALS ( i ) case. Arrowheads indicate nuclei of neuronal cells stained negative ( h ) or positive ( i ) for RRM2. Scale bar = 50 µm. j , k Percentage of cells containing nuclei that stain positive ( j ) and negative ( k ) for RRM2 in motor cortex of 5 non-neurodegenerative controls and 5 C9 patients. Data represent mean ± SEM. Statistical significance was evaluated with unpaired t test; ** P < 0.01
Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and
Techniques: Translocation Assay, Control, Injection, Over Expression, Comparison, Western Blot, Quantitative Proteomics, Immunohistochemical staining, Staining
Journal: Acta Neuropathologica
Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS
doi: 10.1007/s00401-022-02471-y
Figure Lengend Snippet: HNRNPK and RRM2 are implicated in the DNA damage response in C9 RNA toxicity. a Western blot detecting HNRNPK and RRM2 levels. The upper panel shows the confirmation of reduced HNRNPK protein levels in HeLa cells transfected with HNRNPK siRNA and treated with DMSO or 10 µM CPT. In the middle panel, RRM2 protein levels in untransfected, control siRNA (siCtrl)- and HNRNPK siRNA (siHNRNPK)-transfected cells are presented. Total protein staining was used as loading control (lower panel). b , c Quantification of HNRNPK ( b ) and RRM2 ( c ) protein levels in untransfected CPT-treated cells, or in cells transfected with siCtrl or siHNRNPK ( N = 4–5 experiments). d – g Quantification of HNRNPK ( d, f ) and RRM2 levels ( e , g ) in siCtrl- ( d , e ) or siHNRNPK-transfected cells ( f , g ) treated with DMSO or CPT ( N = 5 experiments). h Western blot detecting reduced RRM2 levels in siHNRNPK-transfected cells compared to cells transfected with siCtrl and collected 4 h post-treatment (upper panel). No difference is observed between DMSO- and CPT-treated cells. Total protein staining was used as loading control (lower panel). i Quantification of RRM2 protein levels ( N = 6 experiments). j , k Immunostaining of RRM2 in siCtrl- ( j ) and siHNRNPK-transfected cells ( k ). l Quantification of nuclear and cytoplasmic RRM2 protein levels measured as mean fluorescence intensity ratio ( N = 3 experiments, 2 technical replicates). Each data point represents the average N/C ratio per replicate. In total, 10 images were analyzed per experiment and per condition. Scale bar = 50 µm. m , n Immunostaining of γH2AX foci in siCtrl- ( m ) and siHNRNPK-transfected ( n ) HeLa cells. Scale bar = 50 µm. o Quantification of the average number of γH2AX foci per cell ( N = 3 experiments). p – s Immunostaining of γH2AX foci in GFP ( p ), 91S + GFP ( q ), 91S + HNRNPK ( r ) and 91S + RRM2 ( s ) RNA-injected 30 hpf zebrafish embryos. Dotted lines indicate the borders of the spinal cord. Scale bar = 50 µm. t Quantification of the fold change of γH2AX positive nuclei in the spinal cord of zebrafish embryos ( N = 3 experiments). b – g , i , l , o , t Data represent mean ± SEM. Statistical significance was evaluated with one-way ANOVA and Tukey’s multiple comparison test ( b , c , t ), unpaired t test ( d – g , l ) or Kruskal–Wallis test and Dunn’s multiple comparison test ( i , o ); * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001
Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and
Techniques: Western Blot, Transfection, Control, Staining, Immunostaining, Fluorescence, Injection, Comparison
Journal: Acta Neuropathologica
Article Title: HNRNPK alleviates RNA toxicity by counteracting DNA damage in C9orf72 ALS
doi: 10.1007/s00401-022-02471-y
Figure Lengend Snippet: Schematic model linking mechanistic insights of HNRNPK and RRM2 in C9orf72 ALS. In the left panel, event of naturally occurring DNA damage (1) in a healthy neuron with consequential RRM2 activation and nuclear translocation (2). HNRNPK is a transcriptional regulator of RRM2 (3), essential for DNA repair in the DNA damage response (4). In the right panel, a neuron affected in C9 ALS/FTD is characterized by DPRs and RNA foci, consisting of C9orf72 repeat RNA and sequestered RNA-binding proteins, including HNRNPK (1a). Next to sequestration, HNRNPK is mislocalized to the cytoplasm (1b), resulting in a loss-of-function of HNRNPK, and directly or indirectly increasing DNA damage, which activates RRM2 (3). Loss-of-function achieves transcriptional dysregulation of downstream effectors of HNRNPK, including RRM2 (4). Activated, though depleted RRM2 results in a disrupted DNA damage response, impeding DNA repair (5). Scheme created with BioRender.com
Article Snippet: FLAG-tagged HNRNPK (RC201843, Origene) and
Techniques: Activation Assay, Translocation Assay, RNA Binding Assay