|
Thermo Fisher
gene exp rpia hs01107136 m1 Gene Exp Rpia Hs01107136 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp rpia hs01107136 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp rpia hs01107136 m1 - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
|
Proteintech
rpia ![]() Rpia, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rpia/product/Proteintech Average 93 stars, based on 1 article reviews
rpia - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp rpia mm00485790 m1 ![]() Gene Exp Rpia Mm00485790 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp rpia mm00485790 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp rpia mm00485790 m1 - by Bioz Stars,
2026-03
85/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rpia ![]() Rpia, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rpia/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rpia - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Aviva Systems
escherichia coli ![]() Escherichia Coli, supplied by Aviva Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/escherichia coli/product/Aviva Systems Average 91 stars, based on 1 article reviews
escherichia coli - by Bioz Stars,
2026-03
91/100 stars
|
Buy from Supplier |
|
Moravek Biochemicals
3 h]pa ![]() 3 H]Pa, supplied by Moravek Biochemicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3 h]pa/product/Moravek Biochemicals Average 90 stars, based on 1 article reviews
3 h]pa - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Boehringer Mannheim
s -pia ![]() S Pia, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/s -pia/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
s -pia - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Amersham Life Sciences Inc
3h]r-pia ![]() 3h]R Pia, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3h]r-pia/product/Amersham Life Sciences Inc Average 90 stars, based on 1 article reviews
3h]r-pia - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Amersham Pharmacia Biotech Ltd
3h]n6-[(r)-phenylisopropyl]adenosine ![]() 3h]N6 [(R) Phenylisopropyl]Adenosine, supplied by Amersham Pharmacia Biotech Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3h]n6-[(r)-phenylisopropyl]adenosine/product/Amersham Pharmacia Biotech Ltd Average 90 stars, based on 1 article reviews
3h]n6-[(r)-phenylisopropyl]adenosine - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Boehringer Mannheim
r -phenylisopropyladenosine ( r -pia) ![]() R Phenylisopropyladenosine ( R Pia), supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r -phenylisopropyladenosine ( r -pia)/product/Boehringer Mannheim Average 90 stars, based on 1 article reviews
r -phenylisopropyladenosine ( r -pia) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
flag-rpia-r ttgctgaattcttatcacttatcgtcgtcatccttgtaatc ![]() Flag Rpia R Ttgctgaattcttatcacttatcgtcgtcatccttgtaatc, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flag-rpia-r ttgctgaattcttatcacttatcgtcgtcatccttgtaatc/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
flag-rpia-r ttgctgaattcttatcacttatcgtcgtcatccttgtaatc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Bioneer Corporation
rpia-s75a-f gatctcaacgaagtcgacgcccttggcatctacgttgatgg ![]() Rpia S75a F Gatctcaacgaagtcgacgcccttggcatctacgttgatgg, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rpia-s75a-f gatctcaacgaagtcgacgcccttggcatctacgttgatgg/product/Bioneer Corporation Average 90 stars, based on 1 article reviews
rpia-s75a-f gatctcaacgaagtcgacgcccttggcatctacgttgatgg - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell Death Discovery
Article Title: MDMX reprograms glycolysis of hepatocellular carcinoma via 14-3-3γ/FOXO1
doi: 10.1038/s41420-025-02804-2
Figure Lengend Snippet: A In Huh7 cells with overexpression of MDMX, mRNA level of RPIA, PKM, HK2, PCK1, AQP9, and G6PC were detected by q-PCR. B In Huh7 cells with overexpression or knockdown of MDMX, the protein level of PCK1 and RPIA were measured by Western blot. C In Huh7 cells with overexpression of MDMX, mRNA level of FOXO1 was detected by q-PCR. D In Huh7 cells with overexpression or knockdown of MDMX, the protein level of FOXO1 were measured by Western blot. E ChIP-qPCR was conducted to analyze the combination of FOXO1 and the promoter of PCK1 in Huh7 cells with MDMX overexpression. F TCGA analysis of FOXO1 expression level in HCC tissues ( n = 50) compared with adjacent tissues ( n = 374) and the relationship to patient’s overall survival. G , H Immunohistochemical analysis of FOXO1 expression conducted on tumor samples from 48 patients with HCC alongside corresponding normal liver tissues. I CCK-8 and colony formation assay were conducted to study the effect of FOXO1 on cell growth. * P < 0.05, ** P < 0.01, *** P < 0.001. A – D , F , and H , I T -test was used for statistical analysis.
Article Snippet: Sections were then incubated with following primary antibody at 4 °C overnight: PCK1 (1:300, 16754-1-AP, Proteintech, China),
Techniques: Over Expression, Knockdown, Western Blot, ChIP-qPCR, Expressing, Immunohistochemical staining, CCK-8 Assay, Colony Assay
Journal: Cell Death Discovery
Article Title: MDMX reprograms glycolysis of hepatocellular carcinoma via 14-3-3γ/FOXO1
doi: 10.1038/s41420-025-02804-2
Figure Lengend Snippet: A Correlation analysis of MDMX and FOXO1 expression using immunohistochemical scoring ( n = 48). B , C mRNA and protein expression levels of PCK1 and RPIA after FOXO1 overexpression in Huh7 cells. D Glucose uptake, ATP levels, and lactate production were examined after FOXO1 overexpression in Huh7 cells. E Immunofluorescence images showed FOXO1 downregulation after MDMX overexpression. F Protein level of FOXO1 was measured by Western blot in Huh7 cells with overexpression of MDMX treated with 10 µM CHX. * P < 0.05, ** P < 0.01, *** P < 0.001. B–D , F T -test was used for statistical analysis.
Article Snippet: Sections were then incubated with following primary antibody at 4 °C overnight: PCK1 (1:300, 16754-1-AP, Proteintech, China),
Techniques: Expressing, Immunohistochemical staining, Over Expression, Immunofluorescence, Western Blot
Journal: Cell Death Discovery
Article Title: MDMX reprograms glycolysis of hepatocellular carcinoma via 14-3-3γ/FOXO1
doi: 10.1038/s41420-025-02804-2
Figure Lengend Snippet: A Colony formation and cell proliferation assays were conducted in Huh7 cells with MDMX knockdown and AS1842856 treatment. B , D Western blot showed the protein level of MDMX, FOXO1, PCK1, and RPIA after MDMX knockdown and treated with AS1842856 in Huh7 and Hep3B cells. C , E The level of glucose consumption, ATP level, and lactate production after MDMX knockdown and treated with AS1842856 in Huh7 and Hep3B cells. F , G Colony formation and cell proliferation assays were conducted in Huh7 cells with MDMX overexpression and 2-DG treatment. H Huh7 cells overexpressing MDMX were cultured with different glucose concentration medium (25, 12.5, 5 mM), colony formation ability was measured after 10 days cultural. * P < 0.05, ** P < 0.01, *** P < 0.001. A – G One-way ANOVA and H T -test were used for statistical analysis.
Article Snippet: Sections were then incubated with following primary antibody at 4 °C overnight: PCK1 (1:300, 16754-1-AP, Proteintech, China),
Techniques: Knockdown, Western Blot, Over Expression, Cell Culture, Concentration Assay
Journal: Cell Death Discovery
Article Title: MDMX reprograms glycolysis of hepatocellular carcinoma via 14-3-3γ/FOXO1
doi: 10.1038/s41420-025-02804-2
Figure Lengend Snippet: A Western blot showed the expression levels of FOXO1, PCK1, and RPIA in liver tissues from tissue specific expressing MDMX mice. B The levels of glucose uptake, ATP, and lactate production in the liver tissues were measured. C Immunohistochemistry showed the expression levels of FOXO1, PCK1, and RPIA in liver tissues from tissue specific expressing MDMX mice. D Mechanism diagram of how MDMX promotes the occurrence and development of liver cancer by promoting glycolysis via 14-3-3γ/FOXO1. * P < 0.05, ** P < 0.01. B T -test was used for statistical analysis.
Article Snippet: Sections were then incubated with following primary antibody at 4 °C overnight: PCK1 (1:300, 16754-1-AP, Proteintech, China),
Techniques: Western Blot, Expressing, Immunohistochemistry