Journal: Cell reports. Medicine

Article Title: A High-Content Screen for Mucin-1-Reducing Compounds Identifies Fostamatinib as a Candidate for Rapid Repurposing for Acute Lung Injury.

doi: 10.1016/j.xcrm.2020.100137

Figure Lengend Snippet: Figure 4. In Vivo, R788 Reduces Excess MUC1 from Lung Epithelia of Mice with ALI (A) IF images from lung tissue sections stained with MUC1 (green), phalloidin (yellow), and DAPI (gray) demonstrate that ischemia/reperfusion (I/R)-induced remote ALI resulted in increased MUC1 in lung epithelium. Treatment with fostamatinib over the course of 10 days suppressed MUC1 levels in mouse lung epithelium. (B) Single-cell tissue analysis, based on IF of MUC1 and phalloidin (panel 1). In each image (panel 1), nuclei were identified based on DAPI staining (rainbow colors represent different cell nuclei in panel 2). The cell bodies were identified based on phalloidin staining surrounding each nucleus (orange cell borders, panel 3). Lastly, MUC1 IF intensity (green in panel 3) and phalloidin intensities were calculated within each cell body. (C) Bar graph ratio of MUC1:phalloidin intensities in all cells of tissue sections from sham-treated mice and mice subjected to I/R-induced ALI, treated either with or without fostamatinib. Average MUC1 intensity values per cell were normalized to the average phalloidin levels. Means ± SDs (n = 3 mice/condition/dose). ns, *p < 0.05, **p < 0.01, and ***p < 0.001.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-MUC1(Clone 214D4) StemCell Technologies Cat#: 60137; RRID: AB_118530 Armenian monoclonal hamster anti-MUC1 Abcam Cat#:ab80952; RRID: AB_1640314 Alexa Fluor 488-conjugated AffiniPure Goat anti-Armenian hamster IgG Jackson Immunoresearch Cat# 127-545-099 RRID: AB_2338996 Chemicals, Peptides, and Recombinant Proteins Rhodamine Phalloidin Cytoskeleton Cat#: PHDR1 SYK inhibitor R788 Rigel Pharmaceuticals N/A Caspase 3/7 Thermo Fisher Cat#: C10423 ROS Thermo Fisher Cat#: C10443 DRAQ7 Bio Status Cat#: DR71000 LOX sCIVAX Cat#: LOX-1S TMRM Thermo Fisher Cat#:T668 Critical Commercial Assays ABI Cells-to-CT kit Thermo Fisher Scientific Cat#: A35379 CellEvent Caspase 3/7 Green Flow Cytometry Assay Kit Thermo Fisher Cat#: C10427 Experimental Models: Cell Lines Human: P kidney epithelial cells 18 N/A Experimental Models: Organisms/Strains Mouse: C57BL/6J mice Jackson Laboratories N/A Oligonucleotides Primer: MUC1 Forward: GGCAGAGAAAGGAAATGGCACATCACT 18 N/A Primer: MUC1 Reverse: CTGCTGCTCCTCACAGTGCTTACAGGT 18 N/A Software and Algorithms Harmony High-Content Imaging and Analysis Software Perkin Elmer HH17000001 RStudio: Version 1.0.153 RStudio Rstudio.com Harmony High-Content Imaging and Analysis Software Perkin Elmer HH17000001 GraphPad Prism: Version 7 GraphPad Graphpad.com Spotfire Software Tibco N/A Genedata Screener Software Genedata Genedata.com Other Opera Phenix High-Content Screening System Perkin Elmer HH14000000 Broad Repurposing Library 17 N/A

Techniques: In Vivo, Staining, Single Cell

Journal: Frontiers in Immunology

Article Title: Crosstalk Between Circulating Follicular T Helper Cells and Regulatory B Cells in Children With Extrinsic Atopic Dermatitis

doi: 10.3389/fimmu.2021.785549

Figure Lengend Snippet: The phenotype of IL-10 + Breg cells in peripheral blood from patients with AD. (A, B) The percentages of CD19 + CD24 hi CD38 hi transitional B cells and CD19 + CD24 hi CD27 + memory B cells in patients with AD are normal (HC: n = 19; patients with AD: n = 29). (C) Distribution of IL-10 + B cells within B cell subsets, defined by expression of CD24/CD38 and CD24/CD27, in patients with AD and in healthy controls. (D, E) CD24 hi CD38 hi and CD24 hi CD27 + cells were more frequent in IL-10 + B cells than in IL-10 - B cells (HC: n = 11; patients with AD: n = 13). Data are represented as median and interquartile range. *P < 0.05, **P < 0.01, and ***P < 0.001 (Mann-Whitney U -test).

Article Snippet: The following specific antibodies were used to stain the cells after permeabilization with 0.05% saponin (Sigma): anti-CD38 (ab235118; abcam), anti-CD24 (ab202073; abcam), anti-phospho-STAT3 (9145S; Cell Signaling Technology), anti-phosphotyrosine (05-1050X; Merck Millipore), anti-pBTK (ab52192; abcam), and anti-pCD19 (3571S; Cell Signaling Technology).

Techniques: Expressing, MANN-WHITNEY

Journal: Frontiers in Immunology

Article Title: Crosstalk Between Circulating Follicular T Helper Cells and Regulatory B Cells in Children With Extrinsic Atopic Dermatitis

doi: 10.3389/fimmu.2021.785549

Figure Lengend Snippet: Breg cells from patients with EAD are less able to suppress differentiation of Tfh cells. (A) CD19 + CD24 hi CD38 hi B cells were isolated from HC and patients with EAD by flow cytometry, and CD4 + naïve T cells were isolated from HC by MACS. Cells were co-cultured for 72 h under Tfh-polarizing conditions. (B, C) The percentage of PD-1 + ICOS + CXCR5 + CD4 + Tfh cells was significantly reduced upon co-culture with Breg cells from HC (n = 4) compared with blank controls (group medium, n = 4), but not upon co-culture with Breg cells from EAD patients (n = 4). (D) The suppressive effect of Bregs on Tfh cell differentiation decreased significantly after adding anti-IL-10 neutralizing antibody to the co-culture system (n = 4). Data are expressed as the means ± SEM. *P <0.05 and **P <0.01. ns, not significant (Mann-Whitney U -test). Data are representative of three independent experiments.

Article Snippet: The following specific antibodies were used to stain the cells after permeabilization with 0.05% saponin (Sigma): anti-CD38 (ab235118; abcam), anti-CD24 (ab202073; abcam), anti-phospho-STAT3 (9145S; Cell Signaling Technology), anti-phosphotyrosine (05-1050X; Merck Millipore), anti-pBTK (ab52192; abcam), and anti-pCD19 (3571S; Cell Signaling Technology).

Techniques: Isolation, Flow Cytometry, Cell Culture, Co-Culture Assay, Cell Differentiation, MANN-WHITNEY

Journal: Frontiers in Immunology

Article Title: Crosstalk Between Circulating Follicular T Helper Cells and Regulatory B Cells in Children With Extrinsic Atopic Dermatitis

doi: 10.3389/fimmu.2021.785549

Figure Lengend Snippet: CD19 + CD24 hi CD38 hi B cells from patients with EAD regulate BCR signaling normally but show impaired TLR-STAT3 signaling. (A) B cells were incubated with AF546-(Fab)2-anti-Ig(M+G), to mimic the antigen, for 30 min on ice to label the BCR, and then stimulated at 37°C for different times. (B) Analysis of the MFI of BCR, pCD19, pY, and pBtk in CD24 hi CD38 hi B cells after stimulation with soluble antigen. (C–F) B cells from patients with EAD or HC were stimulated for 48 h by CpG and incubated with AF546-(Fab)2-anti-Ig(M+G) for 30 min. The MFI of pSTAT3, pCD19, pY and pBtk in CD24 hi CD38 hi B cells was analyzed. Data are expressed as the means ± SEM. ****P < 0.0001 (Mann-Whitney U -test). Representative images are shown; in which more than 50 cells were individually analyzed using NIS-Elements AR 3.2 software. Data are representative of three independent experiments.

Article Snippet: The following specific antibodies were used to stain the cells after permeabilization with 0.05% saponin (Sigma): anti-CD38 (ab235118; abcam), anti-CD24 (ab202073; abcam), anti-phospho-STAT3 (9145S; Cell Signaling Technology), anti-phosphotyrosine (05-1050X; Merck Millipore), anti-pBTK (ab52192; abcam), and anti-pCD19 (3571S; Cell Signaling Technology).

Techniques: Incubation, MANN-WHITNEY, Software

Journal: The Journal of Neuroscience

Article Title: Growth-Associated Protein-43 Is Required for Commissural Axon Guidance in the Developing Vertebrate Nervous System

doi: 10.1523/JNEUROSCI.22-01-00239.2002

Figure Lengend Snippet: Growth cones from dissociated cortical cultures from GAP-43 (+/+) (a–d) or GAP-43 (−/−) (e–h) mice double labeled with TAG-1 (a–h) and rhodamine phalloidin (a′–h′) after 24 hr in vitro. Arrows indicate the growth cone used for measuring both lamellal area and pixel intensity of rhodamine phalloidin labeling with IP Lab (Scanalytics Inc.).Lines bisecting neurites indicate limit of growth cones used for measurement. Scale bar, 100 μm.

Article Snippet: Arrows indicate the growth cone used for measuring both lamellal area and pixel intensity of rhodamine phalloidin labeling with IP Lab (Scanalytics Inc.).

Techniques: Labeling, In Vitro