Journal: Developmental biology

Article Title: A Sprouty4 reporter to monitor FGF/ERK signaling activity in ESCs and mice

doi: 10.1016/j.ydbio.2018.06.017

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: AlexaFluor® conjugated secondary antibodies (ThermoFisher Scientific) were used at a 1:500 dilution. table ft1 table-wrap mode="anchored" t5 caption a7 Reagent or resource Source Identifier Antibodies anti-BRACHYURY (IF 1:200 dilution) R&D: AF2085 AB_2200235 anti-tERK (WB 1:1000 dilution) Abeam: ab36991 AB_732206 anti-pERK (WB 1:500 dilution) Cell Signaling: 4370S AB_2315112 anti-FOXA2 (IF 1:500 dilution) Abeam: ab108422 AB_11157157 anti-GATA6 (IF 1:100 dilution) R&D: AF1700 AB_2108901 anti-GATA6 (IF 1:500 dilution) Cell Signaling: 5851 AB_10705521 anti-GFP (IF 1:400 dilution) Jackson Labs: GFP-1020 AB_10000240 anti-NANOG (IF 1:200 dilution) ThermoFisher AB_763613 Scientific anti-NANOG (IF 1:500 dilution) Cosmo Bio: REC-RCAB0002PF AB_567471 anti-POU5F1 (IF: 1:200 dilution) Santa Cruz: sc5279 AB_628051 anti-SOX2 (IF 1:100 dilution) Abeam: ab97959 AB_2341193 anti-SOX17 (IF 1:100 dilution) R&D:AF1924 AB_355060 anti-TUBULIN (WB 1:5000 dilution) Sigma: T6074 AB_477582 Bacterial and Virus Strains Biological Samples Chemicals, Peptides, and Recombinant Proteins rhFGF2 R&D: 233-FB rhFGF4 R&D: 235-F4 PD0325901 (MEK inhibitor) Stemgent: 04–0006 AZD4547 (FGFRi inhibitor) Santa Cruz: sc-364421 rhFGF2 Cell GS: GFH146 rhFGF4 Peprotech: 100–31 CHIR99021 (GSK3b inhibitor) Stemgent: 04–0004 Critical Commercial Assays Deposited Data Experimental Models: Cell Lines Spry4 H2B-Venus/+ embryonic stem cell line Spry4 H2B-Venus/+ ; FGF4 −/− embryonic stem cell line Experimental Models: Organisms/Strains Spry4 H2B-Venus/+ mouse line Oligonucleotides Spry4 H2B-Venus genotyping primer 1: Spry4 _genotyping_5’fwd_#2: GGCTAGTCCCTCCTTGCTTCC Spry4 H2B-Venus genotyping primer 2: LAR3 EN2: CAACGGGTTCTTCTGTTAGTCC Spry4 H2B-Venus genotyping primer 2: Spry4 _genotyping_3’rev_#1: GGCTGGAGGTCCTGAACTGC Recombinant DNA Software and Algorithms Fiji http://fiji.sc SCR_002285 GraphPad Prism http://www.graphpad.com / SCR_002798 MATLAB http://www.mathworks.com/products/matlab/ SCR_001622 RStudio http://www.rstudio.com/ SCR_000432 Other Open in a separate window KEY RESOURCES TABLE 2.6.

Techniques: Virus, Recombinant, Software

Journal: International Journal of Molecular Sciences

Article Title: A Bioengineering Approach for the Development of Fibroblast Growth Factor-7-Functionalized Sericin Biomaterial Applicable for the Cultivation of Keratinocytes

doi: 10.3390/ijms23179953

Figure Lengend Snippet: The proliferation of NHEK cells induced by H1/FGF-7. NHEK cells were seeded onto a 24-well plate at a density of 7500 cells per 500 µL of DK-SFM. The culture was then supplemented with SC powder, F7-SC powder, F7-PH crystals, or rhFGF-7 and incubated at 37 °C and 5% CO 2 for 3 days. The amounts of supplemented samples are indicated on the horizontal axis. Cell proliferation rates were determined as viable cell numbers (as measured using the WST-8 assay) relative to non-treated control culture with PBS only. Data are presented as means ± standard deviations (SDs) of triplicate assays. n.s p > 0.05 vs. non-treated control; a p < 0.001 vs. non-treated control; b p < 0.01 vs. 50 µg of F7-SC; c p < 0.001 vs. 100 µg of F7-SC; d p < 0.001 vs. 1 ng of rhFGF-7; and e p < 0.001 vs. of 5 ng of rhFGF-7.

Article Snippet: Different amounts (1, 5, and 10 ng) of rhFGF-7 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) in 50 µL of PBS were added directly to the positive-control wells.

Techniques: Incubation

Journal: International Journal of Molecular Sciences

Article Title: A Bioengineering Approach for the Development of Fibroblast Growth Factor-7-Functionalized Sericin Biomaterial Applicable for the Cultivation of Keratinocytes

doi: 10.3390/ijms23179953

Figure Lengend Snippet: Migration of NHEK cells induced by H1/FGF-7. NHEK cells at a density of 7500 cells per 500 µL of DK-SFM were incubated at 37 °C and 5% CO 2 for 16 h to induce starvation and then wounded via scratching. The wounded cultures were treated with 100 µg of SC powder, 100 µg of F7-SC powder, 5 × 10 5 F7-PH, or 10 ng of rhFGF-7, or PBS was added (for non-treated control); then, they were further incubated for 24 h. ( A ) The percentage of wound closure in the scratched NHEK cultures was determined through ImageJ analysis of the photos taken at 0 and at 24 h of treatment. Data are shown as means ± standard deviations (SDs) of triplicate assays. n.s p > 0.05 vs. non-treated control and a p < 0.05 vs. non-treated control. ( B ) Photos of the scratched cultures for ImageJ analysis. Scale bar, 200 μm.

Article Snippet: Different amounts (1, 5, and 10 ng) of rhFGF-7 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) in 50 µL of PBS were added directly to the positive-control wells.

Techniques: Migration, Incubation

Journal: International Journal of Molecular Sciences

Article Title: A Bioengineering Approach for the Development of Fibroblast Growth Factor-7-Functionalized Sericin Biomaterial Applicable for the Cultivation of Keratinocytes

doi: 10.3390/ijms23179953

Figure Lengend Snippet: Storage stability of H1/FGF-7 incorporated into sericin-cocoon powder. ( A ) Short-term (7 days) storage stability. Two identical sets of samples including suspensions of F7-SC powder (2 mg/mL), F7-PH crystals (1 × 10 7 cubes/mL), and a solution of commercial rhFGF-7 (50 µg/mL) were separately stored at −20 °C or 25 °C for 1 week prior to the assays. NHEK cells at a density of 7500 cells per 500 µL of DK-SFM were supplemented with 100 µg of F7-SC powder, 5 × 10 5 F7-PH crystals, or 10 ng of rhFGF-7. Proliferative activity of the samples was determined as viable cell number measured in the respective cultures after 3 days of cultivation at 37 °C and 5% CO 2 . The proliferative activity of the samples stored at −20 °C was set to 100%, and the relative activity of the corresponding samples stored at 25 °C was determined. ( B ) Long-term (3 months) storage stability of H1/FGF-7. The parameters and analysis method were the same as the 1-week analysis except for sample storage duration. Data are shown as means ± standard deviations (SDs) of triplicate assays. n.s p > 0.05 vs. −20 °C counterpart; a p < 0.001 vs. −20 °C counterpart; and b p < 0.01 vs. −20 °C counterpart.

Article Snippet: Different amounts (1, 5, and 10 ng) of rhFGF-7 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) in 50 µL of PBS were added directly to the positive-control wells.

Techniques: Activity Assay

Journal: International Journal of Molecular Sciences

Article Title: A Bioengineering Approach for the Development of Fibroblast Growth Factor-7-Functionalized Sericin Biomaterial Applicable for the Cultivation of Keratinocytes

doi: 10.3390/ijms23179953

Figure Lengend Snippet: Three-dimensional (3D) cultivation and differentiation of NHEK cells. NHEK cells were cultivated for 2 days on collagen gel under a submerged condition and continued to grow at the air–liquid interface in a medium containing 1.2 mM Ca 2+ with regular medium change until day 14. The 3D-cultivated cell culture was cryo-sectioned for analysis. ( A ) Hematoxylin and eosin (HE) staining of NHEK cells 3D-cultured (left panel) on collagen gel containing 800 µg of F7-SC powder or (right panel) using basal medium supplemented with 300 ng of rhFGF-7. Scale bar, 20 µm. ( B ) Immunofluorescent staining for expression of differentiation markers on NHEK cells 3D-cultured on collagen gel containing F7-SC powder. Detection of (left panel) loricrin and keratin 14 and (right panel) filaggrin and keratin 10. Nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI). Upper layer above the dashed line shows the speculated stratum corneum. Scale bar, 50 μm.

Article Snippet: Different amounts (1, 5, and 10 ng) of rhFGF-7 (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) in 50 µL of PBS were added directly to the positive-control wells.

Techniques: Cell Culture, Staining, Expressing