|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Illumina Inc
phix index3 control Phix Index3 Control, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phix index3 control/product/Illumina Inc Average 99 stars, based on 1 article reviews
phix index3 control - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
rna reverse transcription primer ![]() Rna Reverse Transcription Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rna reverse transcription primer/product/Illumina Inc Average 96 stars, based on 1 article reviews
rna reverse transcription primer - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Illumina Inc
truseq reverse primer ![]() Truseq Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/truseq reverse primer/product/Illumina Inc Average 94 stars, based on 1 article reviews
truseq reverse primer - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Qiagen
forward and reverse primers ![]() Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
m13/puc reverse sequencing primer 2 ![]() M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
improm-ii reverse transcription kit with a random hexamer primer ![]() Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/improm-ii reverse transcription kit with a random hexamer primer/product/Promega Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Biomics Biotechnologies
forward and reverse primers ![]() Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Eton Bioscience
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca ![]() Ndufa4 Qpcr Primer: Forward Cgcttggcactgtttaatcca, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca/product/Eton Bioscience Average 90 stars, based on 1 article reviews
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
LGC Biosearch
reverse primer ![]() Reverse Primer, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/LGC Biosearch Average 90 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Midland Certified Reagent
forward and reverse primers ![]() Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
oligo (dt) primer and m-mlv reverse transcriptase ![]() Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Genomics
Article Title: Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae
doi: 10.1186/s12864-015-1583-4
Figure Lengend Snippet: Characterization of transcription start sites in S. agalactiae. A . Visualization of sequence reads mapped to the genome of strain NEM316 in conditions of dRNA-seq: strand-specific sequencing of transcript 5′ ends with (TAP+) and without (TAP-) TAP treatment, and strand-specific RNA-seq. Two dRNA-seq experiments are shown corresponding to 1: RNA from multiple growth conditions (MG sample); 2: RNA from a ∆covRS mutant grown to mid-exponential phase. The RNA-seq library was prepared with the wt strain at mid-exponential phase. B . Detailed view of the 958000–978000 region. Protein coding genes annotated on the (+) and (−) strands are indicated by red and blue large arrows. TSSs are depicted as small arrows. Based on dRNA-seq and RNA-seq data, a transcript corresponding to a ncRNA (srn040/tmRNA) was annotated and is shown as a large green arrow . C . Proportions of the total TSSs detected under each experimental condition. Grey: TSSs detected with RNA from multiple growth conditions (wt, MG); red: TSSs not detected in wt, MG. MG: mixture of growth conditions; LE: late exponential phase; midE: mid-exponential growth phase; AcStr: acid stress. D : Proportions of TSSs according to the number of experiments in which they were detected.
Article Snippet: RNA ligated to the two adapters was reverse-transcribed with the Superscript II Reverse Transcriptase (Life Technologies) and the
Techniques: Sequencing, RNA Sequencing Assay, Mutagenesis
Journal: BMC Genomics
Article Title: Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae
doi: 10.1186/s12864-015-1583-4
Figure Lengend Snippet: Identification of a novel riboswitch upstream gbs1262. A . Transcriptional organization deduced from dRNA-seq and RNA-seq experiments. Reads aligning upstream gbs1262 were visualized by IGV browser . The sequence of the sRNA resulting from transcription premature arrest at a rho-independent terminator is indicated as a grey arrow. B . Secondary structure predicted by RNalifold , based on the alignment of 14 sequences similar to gbs1262 5′UTR in Lactobacillales and upstream a potential tryptophan-related gene in F. nucleatum (Additional file ). The two conserved folded structures are indicated in red and green boxes, with the green box corresponding to a rho-independent terminator. Sequence covariations supporting the consensus structure are marked by color: red marks pairs with no sequence variation; ochre and green mark pairs with 2 or 3 types of pairs, respectively. C and D . Alternative structures of gbs1262 putative riboswitch as determined by mfold , showing the formation of an antiterminator structure .
Article Snippet: RNA ligated to the two adapters was reverse-transcribed with the Superscript II Reverse Transcriptase (Life Technologies) and the
Techniques: RNA Sequencing Assay, Sequencing
Journal: Methods in molecular biology (Clifton, N.J.)
Article Title: Probing transcriptome-wide RNA structural changes dependent on the DEAD-box helicase Dbp2
doi: 10.1007/978-1-0716-0935-4_18
Figure Lengend Snippet:
Article Snippet: Set up a PCR reaction as below: table ft1 table-wrap mode="anchored" t5 Component Volume (μL) Final quantity Ligated cDNA (or water for primer-dimer control) 5 μL ? dNTP mixture, 2.5 mM (provided with Takara Ex Taq) 2 0.2 mM Ex Taq buffer, 10X 2.5 1X Illumina TruSeq forward primer (5 μM) 1 0.2 μM
Techniques:
Journal: Methods in molecular biology (Clifton, N.J.)
Article Title: Probing transcriptome-wide RNA structural changes dependent on the DEAD-box helicase Dbp2
doi: 10.1007/978-1-0716-0935-4_18
Figure Lengend Snippet:
Article Snippet: Set up a PCR reaction as below: table ft1 table-wrap mode="anchored" t5 Component Volume (μL) Final quantity Ligated cDNA (or water for primer-dimer control) 5 μL ? dNTP mixture, 2.5 mM (provided with Takara Ex Taq) 2 0.2 mM Ex Taq buffer, 10X 2.5 1X Illumina TruSeq forward primer (5 μM) 1 0.2 μM
Techniques: