reverse primer Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

99
Illumina Inc phix index3 control
Phix Index3 Control, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phix index3 control/product/Illumina Inc
Average 99 stars, based on 1 article reviews
phix index3 control - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

96
Illumina Inc rna reverse transcription primer
Characterization <t>of</t> <t>transcription</t> start sites in S. agalactiae. A . Visualization of sequence reads mapped to the genome of strain NEM316 in conditions of dRNA-seq: strand-specific sequencing of transcript 5′ ends with (TAP+) and without (TAP-) TAP treatment, and strand-specific <t>RNA-seq.</t> Two dRNA-seq experiments are shown corresponding to 1: RNA from multiple growth conditions (MG sample); 2: RNA from a ∆covRS mutant grown to mid-exponential phase. The RNA-seq library was prepared with the wt strain at mid-exponential phase. B . Detailed view of the 958000–978000 region. Protein coding genes annotated on the (+) and (−) strands are indicated by red and blue large arrows. TSSs are depicted as small arrows. Based on dRNA-seq and RNA-seq data, a transcript corresponding to a ncRNA (srn040/tmRNA) was annotated and is shown as a large green arrow . C . Proportions of the total TSSs detected under each experimental condition. Grey: TSSs detected with RNA from multiple growth conditions (wt, MG); red: TSSs not detected in wt, MG. MG: mixture of growth conditions; LE: late exponential phase; midE: mid-exponential growth phase; AcStr: acid stress. D : Proportions of TSSs according to the number of experiments in which they were detected.
Rna Reverse Transcription Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rna reverse transcription primer/product/Illumina Inc
Average 96 stars, based on 1 article reviews
rna reverse transcription primer - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

94
Illumina Inc truseq reverse primer

Truseq Reverse Primer, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/truseq reverse primer/product/Illumina Inc
Average 94 stars, based on 1 article reviews
truseq reverse primer - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Qiagen forward and reverse primers

Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega m13/puc reverse sequencing primer 2

M13/Puc Reverse Sequencing Primer 2, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m13/puc reverse sequencing primer 2/product/Promega
Average 90 stars, based on 1 article reviews
m13/puc reverse sequencing primer 2 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega improm-ii reverse transcription kit with a random hexamer primer

Improm Ii Reverse Transcription Kit With A Random Hexamer Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/improm-ii reverse transcription kit with a random hexamer primer/product/Promega
Average 90 stars, based on 1 article reviews
improm-ii reverse transcription kit with a random hexamer primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies forward and reverse primers

Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Eton Bioscience ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca

Ndufa4 Qpcr Primer: Forward Cgcttggcactgtttaatcca, supplied by Eton Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca/product/Eton Bioscience
Average 90 stars, based on 1 article reviews
ndufa4 qpcr primer: forward - cgcttggcactgtttaatcca - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
LGC Biosearch reverse primer

Reverse Primer, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse primer/product/LGC Biosearch
Average 90 stars, based on 1 article reviews
reverse primer - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers

Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Promega oligo (dt) primer and m-mlv reverse transcriptase

Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Characterization of transcription start sites in S. agalactiae. A . Visualization of sequence reads mapped to the genome of strain NEM316 in conditions of dRNA-seq: strand-specific sequencing of transcript 5′ ends with (TAP+) and without (TAP-) TAP treatment, and strand-specific RNA-seq. Two dRNA-seq experiments are shown corresponding to 1: RNA from multiple growth conditions (MG sample); 2: RNA from a ∆covRS mutant grown to mid-exponential phase. The RNA-seq library was prepared with the wt strain at mid-exponential phase. B . Detailed view of the 958000–978000 region. Protein coding genes annotated on the (+) and (−) strands are indicated by red and blue large arrows. TSSs are depicted as small arrows. Based on dRNA-seq and RNA-seq data, a transcript corresponding to a ncRNA (srn040/tmRNA) was annotated and is shown as a large green arrow . C . Proportions of the total TSSs detected under each experimental condition. Grey: TSSs detected with RNA from multiple growth conditions (wt, MG); red: TSSs not detected in wt, MG. MG: mixture of growth conditions; LE: late exponential phase; midE: mid-exponential growth phase; AcStr: acid stress. D : Proportions of TSSs according to the number of experiments in which they were detected.

Journal: BMC Genomics

Article Title: Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae

doi: 10.1186/s12864-015-1583-4

Figure Lengend Snippet: Characterization of transcription start sites in S. agalactiae. A . Visualization of sequence reads mapped to the genome of strain NEM316 in conditions of dRNA-seq: strand-specific sequencing of transcript 5′ ends with (TAP+) and without (TAP-) TAP treatment, and strand-specific RNA-seq. Two dRNA-seq experiments are shown corresponding to 1: RNA from multiple growth conditions (MG sample); 2: RNA from a ∆covRS mutant grown to mid-exponential phase. The RNA-seq library was prepared with the wt strain at mid-exponential phase. B . Detailed view of the 958000–978000 region. Protein coding genes annotated on the (+) and (−) strands are indicated by red and blue large arrows. TSSs are depicted as small arrows. Based on dRNA-seq and RNA-seq data, a transcript corresponding to a ncRNA (srn040/tmRNA) was annotated and is shown as a large green arrow . C . Proportions of the total TSSs detected under each experimental condition. Grey: TSSs detected with RNA from multiple growth conditions (wt, MG); red: TSSs not detected in wt, MG. MG: mixture of growth conditions; LE: late exponential phase; midE: mid-exponential growth phase; AcStr: acid stress. D : Proportions of TSSs according to the number of experiments in which they were detected.

Article Snippet: RNA ligated to the two adapters was reverse-transcribed with the Superscript II Reverse Transcriptase (Life Technologies) and the RNA reverse transcription primer (Illumina TruSeq Small RNA kit).

Techniques: Sequencing, RNA Sequencing Assay, Mutagenesis

Identification of a novel riboswitch upstream gbs1262. A . Transcriptional organization deduced from dRNA-seq and RNA-seq experiments. Reads aligning upstream gbs1262 were visualized by IGV browser . The sequence of the sRNA resulting from transcription premature arrest at a rho-independent terminator is indicated as a grey arrow. B . Secondary structure predicted by RNalifold , based on the alignment of 14 sequences similar to gbs1262 5′UTR in Lactobacillales and upstream a potential tryptophan-related gene in F. nucleatum (Additional file ). The two conserved folded structures are indicated in red and green boxes, with the green box corresponding to a rho-independent terminator. Sequence covariations supporting the consensus structure are marked by color: red marks pairs with no sequence variation; ochre and green mark pairs with 2 or 3 types of pairs, respectively. C and D . Alternative structures of gbs1262 putative riboswitch as determined by mfold , showing the formation of an antiterminator structure .

Journal: BMC Genomics

Article Title: Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae

doi: 10.1186/s12864-015-1583-4

Figure Lengend Snippet: Identification of a novel riboswitch upstream gbs1262. A . Transcriptional organization deduced from dRNA-seq and RNA-seq experiments. Reads aligning upstream gbs1262 were visualized by IGV browser . The sequence of the sRNA resulting from transcription premature arrest at a rho-independent terminator is indicated as a grey arrow. B . Secondary structure predicted by RNalifold , based on the alignment of 14 sequences similar to gbs1262 5′UTR in Lactobacillales and upstream a potential tryptophan-related gene in F. nucleatum (Additional file ). The two conserved folded structures are indicated in red and green boxes, with the green box corresponding to a rho-independent terminator. Sequence covariations supporting the consensus structure are marked by color: red marks pairs with no sequence variation; ochre and green mark pairs with 2 or 3 types of pairs, respectively. C and D . Alternative structures of gbs1262 putative riboswitch as determined by mfold , showing the formation of an antiterminator structure .

Article Snippet: RNA ligated to the two adapters was reverse-transcribed with the Superscript II Reverse Transcriptase (Life Technologies) and the RNA reverse transcription primer (Illumina TruSeq Small RNA kit).

Techniques: RNA Sequencing Assay, Sequencing

Journal: Methods in molecular biology (Clifton, N.J.)

Article Title: Probing transcriptome-wide RNA structural changes dependent on the DEAD-box helicase Dbp2

doi: 10.1007/978-1-0716-0935-4_18

Figure Lengend Snippet:

Article Snippet: Set up a PCR reaction as below: table ft1 table-wrap mode="anchored" t5 Component Volume (μL) Final quantity Ligated cDNA (or water for primer-dimer control) 5 μL ? dNTP mixture, 2.5 mM (provided with Takara Ex Taq) 2 0.2 mM Ex Taq buffer, 10X 2.5 1X Illumina TruSeq forward primer (5 μM) 1 0.2 μM Illumina TruSeq reverse primer (5 μM) 1 0.2 μM TaKaRa Ex Taq (50 U/μL) 0.5 0.1 U/μL Nuclease-free water 13 13 μL Open in a separate window Amplify the cDNAs by PCR using the following conditions ( Note 9 ). table ft1 table-wrap mode="anchored" t5 Step Temperature Time Number of cycles Initial denaturation 98 °C 1 min 1 Denaturation 98 °C 10 sec 10 – 35 Annealing 55 °C 30 sec Extension 72 °C 1 min Final extension 72 °C 10 min 1 Incubation 4 °C 2 min 1 Open in a separate window Resolve PCR products by PAGE ( Note 10 ), and collect fragments larger than 150 bp as described in section 3.4 , step 8 – 10.

Techniques:

Journal: Methods in molecular biology (Clifton, N.J.)

Article Title: Probing transcriptome-wide RNA structural changes dependent on the DEAD-box helicase Dbp2

doi: 10.1007/978-1-0716-0935-4_18

Figure Lengend Snippet:

Article Snippet: Set up a PCR reaction as below: table ft1 table-wrap mode="anchored" t5 Component Volume (μL) Final quantity Ligated cDNA (or water for primer-dimer control) 5 μL ? dNTP mixture, 2.5 mM (provided with Takara Ex Taq) 2 0.2 mM Ex Taq buffer, 10X 2.5 1X Illumina TruSeq forward primer (5 μM) 1 0.2 μM Illumina TruSeq reverse primer (5 μM) 1 0.2 μM TaKaRa Ex Taq (50 U/μL) 0.5 0.1 U/μL Nuclease-free water 13 13 μL Open in a separate window Amplify the cDNAs by PCR using the following conditions ( Note 9 ). table ft1 table-wrap mode="anchored" t5 Step Temperature Time Number of cycles Initial denaturation 98 °C 1 min 1 Denaturation 98 °C 10 sec 10 – 35 Annealing 55 °C 30 sec Extension 72 °C 1 min Final extension 72 °C 10 min 1 Incubation 4 °C 2 min 1 Open in a separate window Resolve PCR products by PAGE ( Note 10 ), and collect fragments larger than 150 bp as described in section 3.4 , step 8 – 10.

Techniques: