recombinant human ccl4 Search Results


94
Kingfisher Biotech recombinant human ccl4 variant s80t
SNPs of immune related genes in chromosome 17 from FM cohorts and transmission analysis from FM trios <xref ref-type= 1 , 2 , 3 ." width="250" height="auto" />
Recombinant Human Ccl4 Variant S80t, supplied by Kingfisher Biotech, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Human+CCL4+(MIP-1+beta)+Recombinant+Protein/pmc06013222-67-42-49
Average 94 stars, based on 1 article reviews
recombinant human ccl4 variant s80t - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

N/A
Human CCL4 (MIP-1 beta) ELISA Standard Recombinant Protein for ELISA, Ctrl
  Buy from Supplier

92
R&D Systems ccl4
Fig. 2 BTG3-KO keratinocytes release IL1α, IL10, and <t>CCL4</t> to promote 3T3-L1 adipogenic differentiation. a Schematic workflow of cytokine antibody array analysis. CM was collected after 48 h of culture, and analyzed using a human cytokine antibody array. BTG3-KO CM was a mixture from the three KO clones indicated. b The levels of factors and cytokines, including IL1α, IL10, and CCL4, were increased in BTG3-KO CM. CM from (a) was subjected to antibody array analysis. Signals from duplicated spots were quantified and compared between parental and BTG3-KO cells. CCL7 is shown as an unaltered control. c mRNA expression levels of IL1A, IL10, CCL4, and VEGFD, but not CCL7, were increased in BTG3-KO HaCaT cells. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed and results from three independent experiments are shown. d–i Elevated expression levels of IL1α, IL10, and CCL4 in the back skin of Btg3-KO mice. 8-week-old WT and Btg3-KO mice were shaved and their back skin was collected 3 weeks later and embedded for immunohistochemical (IHC) analysis using antibodies against IL1α d, IL10 f, and CCL4 h. Examples of positively stained cell are indicated by arrows. Quantified results (n = 6) are shown in e, g, and i, respectively. j Addition of recombinant IL1α, IL10, and CCL4 to parental CM promotes 3T3-L1 differentiation. Adipogenesis was measured by Oil Red O staining followed by quantification. k Antibody-mediated neutralization of IL1α, IL10 and CCL4 in BTG3-KO CM reduced the effect on 3T3-L1 adipogenic differentiation. *P < 0.05. **P < 0.01.
Ccl4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Recombinant+Human+CCL4%2FMIP-1+beta+Protein/pm38714880-215-10-20
Average 92 stars, based on 1 article reviews
ccl4 - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

94
R&D Systems recombinant human ccl4 mip 1β
Fig. 2 BTG3-KO keratinocytes release IL1α, IL10, and <t>CCL4</t> to promote 3T3-L1 adipogenic differentiation. a Schematic workflow of cytokine antibody array analysis. CM was collected after 48 h of culture, and analyzed using a human cytokine antibody array. BTG3-KO CM was a mixture from the three KO clones indicated. b The levels of factors and cytokines, including IL1α, IL10, and CCL4, were increased in BTG3-KO CM. CM from (a) was subjected to antibody array analysis. Signals from duplicated spots were quantified and compared between parental and BTG3-KO cells. CCL7 is shown as an unaltered control. c mRNA expression levels of IL1A, IL10, CCL4, and VEGFD, but not CCL7, were increased in BTG3-KO HaCaT cells. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed and results from three independent experiments are shown. d–i Elevated expression levels of IL1α, IL10, and CCL4 in the back skin of Btg3-KO mice. 8-week-old WT and Btg3-KO mice were shaved and their back skin was collected 3 weeks later and embedded for immunohistochemical (IHC) analysis using antibodies against IL1α d, IL10 f, and CCL4 h. Examples of positively stained cell are indicated by arrows. Quantified results (n = 6) are shown in e, g, and i, respectively. j Addition of recombinant IL1α, IL10, and CCL4 to parental CM promotes 3T3-L1 differentiation. Adipogenesis was measured by Oil Red O staining followed by quantification. k Antibody-mediated neutralization of IL1α, IL10 and CCL4 in BTG3-KO CM reduced the effect on 3T3-L1 adipogenic differentiation. *P < 0.05. **P < 0.01.
Recombinant Human Ccl4 Mip 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Recombinant+Human+CCL4%2FMIP-1+beta+Protein/pmc06299526-218-0-3
Average 94 stars, based on 1 article reviews
recombinant human ccl4 mip 1β - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
OriGene ggtcatacacgtactcctggac r
Fig. 2 BTG3-KO keratinocytes release IL1α, IL10, and <t>CCL4</t> to promote 3T3-L1 adipogenic differentiation. a Schematic workflow of cytokine antibody array analysis. CM was collected after 48 h of culture, and analyzed using a human cytokine antibody array. BTG3-KO CM was a mixture from the three KO clones indicated. b The levels of factors and cytokines, including IL1α, IL10, and CCL4, were increased in BTG3-KO CM. CM from (a) was subjected to antibody array analysis. Signals from duplicated spots were quantified and compared between parental and BTG3-KO cells. CCL7 is shown as an unaltered control. c mRNA expression levels of IL1A, IL10, CCL4, and VEGFD, but not CCL7, were increased in BTG3-KO HaCaT cells. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed and results from three independent experiments are shown. d–i Elevated expression levels of IL1α, IL10, and CCL4 in the back skin of Btg3-KO mice. 8-week-old WT and Btg3-KO mice were shaved and their back skin was collected 3 weeks later and embedded for immunohistochemical (IHC) analysis using antibodies against IL1α d, IL10 f, and CCL4 h. Examples of positively stained cell are indicated by arrows. Quantified results (n = 6) are shown in e, g, and i, respectively. j Addition of recombinant IL1α, IL10, and CCL4 to parental CM promotes 3T3-L1 differentiation. Adipogenesis was measured by Oil Red O staining followed by quantification. k Antibody-mediated neutralization of IL1α, IL10 and CCL4 in BTG3-KO CM reduced the effect on 3T3-L1 adipogenic differentiation. *P < 0.05. **P < 0.01.
Ggtcatacacgtactcctggac R, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Macrophage+Inflammatory+Protein+1+beta+(CCL4)+(NM_002984)+Human+Recombinant+Protein/pm32424999-61-135-154
Average 90 stars, based on 1 article reviews
ggtcatacacgtactcctggac r - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
R&D Systems recombinant human ccl4
Fig. 1. Multiple-sequence comparisons and a phylogenetic tree based on porcine <t>CCL4</t> and other CCL4 proteins identified in different species. [A] Multiple-sequence alignment of porcine CCL4 with other CCL4s deposited in GenBank: Bos taurus (cow, NP_001068615.1), Homo sapiens (human, NP_002975.1), Pan troglodytes (chimpanzee, XP_016787457.1), Oryctolagus cuniculus (rabbit, NP_001075665.1), Mus musculus (mouse, NP_038680.1), Rattus norvegicus (rat, NP_446310.1), and Gallus gallus (chicken, NP_990051.1). Similar regions in the sequences are boxed. White letters shaded in black indicate that the similarity of this position is 100%, whereas the dark grey letters mean that the similarity of the position is over 75%, but below 100%. The SCY domain involved in the intercrine α family of cytokines was found to be conserved. [B] A phylogenetic tree was constructed by the neighbor- joining method using amino acid sequences from diverse species, and the scale bar indicates the genetic distance among species. [C] A comparison of porcine CCL4 sequence homology to other CCL4s.
Recombinant Human Ccl4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Recombinant+Human+CCL4%2FMIP-1+beta+Protein%2C+CF/pm30056935-72-0-9
Average 90 stars, based on 1 article reviews
recombinant human ccl4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
R&D Systems recombinant human interleukin 1β
Fig. 1. Multiple-sequence comparisons and a phylogenetic tree based on porcine <t>CCL4</t> and other CCL4 proteins identified in different species. [A] Multiple-sequence alignment of porcine CCL4 with other CCL4s deposited in GenBank: Bos taurus (cow, NP_001068615.1), Homo sapiens (human, NP_002975.1), Pan troglodytes (chimpanzee, XP_016787457.1), Oryctolagus cuniculus (rabbit, NP_001075665.1), Mus musculus (mouse, NP_038680.1), Rattus norvegicus (rat, NP_446310.1), and Gallus gallus (chicken, NP_990051.1). Similar regions in the sequences are boxed. White letters shaded in black indicate that the similarity of this position is 100%, whereas the dark grey letters mean that the similarity of the position is over 75%, but below 100%. The SCY domain involved in the intercrine α family of cytokines was found to be conserved. [B] A phylogenetic tree was constructed by the neighbor- joining method using amino acid sequences from diverse species, and the scale bar indicates the genetic distance among species. [C] A comparison of porcine CCL4 sequence homology to other CCL4s.
Recombinant Human Interleukin 1β, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Recombinant+Human+CCL4%2FMIP-1+beta+Protein%2C+CF/pm10899828-71-61-66
Average 93 stars, based on 1 article reviews
recombinant human interleukin 1β - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
R&D Systems recombinant human mip 1b rhmip 1b
Fig. 1. Multiple-sequence comparisons and a phylogenetic tree based on porcine <t>CCL4</t> and other CCL4 proteins identified in different species. [A] Multiple-sequence alignment of porcine CCL4 with other CCL4s deposited in GenBank: Bos taurus (cow, NP_001068615.1), Homo sapiens (human, NP_002975.1), Pan troglodytes (chimpanzee, XP_016787457.1), Oryctolagus cuniculus (rabbit, NP_001075665.1), Mus musculus (mouse, NP_038680.1), Rattus norvegicus (rat, NP_446310.1), and Gallus gallus (chicken, NP_990051.1). Similar regions in the sequences are boxed. White letters shaded in black indicate that the similarity of this position is 100%, whereas the dark grey letters mean that the similarity of the position is over 75%, but below 100%. The SCY domain involved in the intercrine α family of cytokines was found to be conserved. [B] A phylogenetic tree was constructed by the neighbor- joining method using amino acid sequences from diverse species, and the scale bar indicates the genetic distance among species. [C] A comparison of porcine CCL4 sequence homology to other CCL4s.
Recombinant Human Mip 1b Rhmip 1b, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/recombinant+human+ccl4/Recombinant+Human+CCL4%2FMIP-1+beta+(aa+26-92)+Protein/10__1128_slash_jvi__75__9__4258___4267__2001-129-20-24
Average 90 stars, based on 1 article reviews
recombinant human mip 1b rhmip 1b - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

N/A
The Recombinant Human CCL4 MIP 1 beta Protein from Novus Biologicals is derived from E coli The Recombinant Human CCL4 MIP 1 beta Protein has been validated for the following applications Functional SDS Page
  Buy from Supplier

N/A
MIP 1b; Recombinant Human Macrophage Inflammatory protein-1 beta (CCL4); Recombinant Human Macrophage Inflammatory protein-1 beta (CCL4)
  Buy from Supplier

N/A
C-C Motif Chemokine Ligand 4 (CCL4) is a 7.66 kDa cytokine with 69 amino acid residues. CCL4, also named macrophage inflammatory protein-1β (MIP-1β), is mainly secreted from neutrophils, monocytes, B cells, T cells, fibroblasts, endothelial
  Buy from Supplier

Image Search Results


SNPs of immune related genes in chromosome 17 from FM cohorts and transmission analysis from FM trios <xref ref-type= 1 , 2 , 3 ." width="100%" height="100%">

Journal: PLoS ONE

Article Title: SNPs in inflammatory genes CCL11 , CCL4 and MEFV in a fibromyalgia family study

doi: 10.1371/journal.pone.0198625

Figure Lengend Snippet: SNPs of immune related genes in chromosome 17 from FM cohorts and transmission analysis from FM trios 1 , 2 , 3 .

Article Snippet: Recombinant human CCL3 (MIP-1 α ), CCL4 (MIP-1 β ), CCL11 (Eotaxin), CCL1 (MCP-1), IL-13, GM-CSF, IL-4, and IFN γ were obtained from ProSpec Protein-Specialists (East Brunswick, NJ, USA); LPS from E. coli (055:B5) were purchased from Sigma-Aldrich (St. Louis, MO, USA); recombinant human CCL4 variant (S80T) was from Kingfisher Biotech, Inc (St Paul, MN, USA); anti-human CCR5-PE (CD195, Clone# J418F1), anti-human CCR1-APC (CD191, Clone# 5F10B29), anti-human CD4-PerCP (Clone# OKT4) and anti-human CD3-FITC (clone# SK7) were from Biolegend (San Diego, CA, USA); Indo-1-AM was from Molecular Probes (Eugene, OR).

Techniques: Transmission Assay

A-C , CCL11, CCL4, and CCL3 levels in female healthy controls (Ctrl, n = 48) vs female FM patients with wild type CCL11 (n = 19) or var CCL11 (n = 14). D-F , CCL4, CCL3 and CCL11 levels in female healthy controls (Ctrl, n = 48) vs wild type CCL4 (n = 49) or varCCL4 (n = 24) in female FM patients. (* P<0.05, ** P<0.01, *** P<0.001 in comparison with female healthy controls; # P<0.05 in comparison with female FM patients with wild type CCL4.

Journal: PLoS ONE

Article Title: SNPs in inflammatory genes CCL11 , CCL4 and MEFV in a fibromyalgia family study

doi: 10.1371/journal.pone.0198625

Figure Lengend Snippet: A-C , CCL11, CCL4, and CCL3 levels in female healthy controls (Ctrl, n = 48) vs female FM patients with wild type CCL11 (n = 19) or var CCL11 (n = 14). D-F , CCL4, CCL3 and CCL11 levels in female healthy controls (Ctrl, n = 48) vs wild type CCL4 (n = 49) or varCCL4 (n = 24) in female FM patients. (* P<0.05, ** P<0.01, *** P<0.001 in comparison with female healthy controls; # P<0.05 in comparison with female FM patients with wild type CCL4.

Article Snippet: Recombinant human CCL3 (MIP-1 α ), CCL4 (MIP-1 β ), CCL11 (Eotaxin), CCL1 (MCP-1), IL-13, GM-CSF, IL-4, and IFN γ were obtained from ProSpec Protein-Specialists (East Brunswick, NJ, USA); LPS from E. coli (055:B5) were purchased from Sigma-Aldrich (St. Louis, MO, USA); recombinant human CCL4 variant (S80T) was from Kingfisher Biotech, Inc (St Paul, MN, USA); anti-human CCR5-PE (CD195, Clone# J418F1), anti-human CCR1-APC (CD191, Clone# 5F10B29), anti-human CD4-PerCP (Clone# OKT4) and anti-human CD3-FITC (clone# SK7) were from Biolegend (San Diego, CA, USA); Indo-1-AM was from Molecular Probes (Eugene, OR).

Techniques: Comparison

A-B . WT CCL4 and varCCL4 both stimulate and cross-block calcium mobilization in CCR5 positive immature dendritic cell ( A ) or CEM.NK R CCR5 T-cells ( B ). Ionomycin and CCL3 were used as positive controls. C-D . varCCL4 induces greater down-regulation of cell surface CCR5 than WT CCL4 on immature dendritic cells ( C ) and CEM.NK R CCR5 T-cell line ( D ). Cells were treated with 80 ng/mL of each CCL4 species for 3 hours, surface CCR5 was stained with anti-CCR5 antibody and analyzed by flow cytometry (** P<0.01, *** P<0.001 in comparison with untreated control; # P<0.05 in comparison with WT CCL4).

Journal: PLoS ONE

Article Title: SNPs in inflammatory genes CCL11 , CCL4 and MEFV in a fibromyalgia family study

doi: 10.1371/journal.pone.0198625

Figure Lengend Snippet: A-B . WT CCL4 and varCCL4 both stimulate and cross-block calcium mobilization in CCR5 positive immature dendritic cell ( A ) or CEM.NK R CCR5 T-cells ( B ). Ionomycin and CCL3 were used as positive controls. C-D . varCCL4 induces greater down-regulation of cell surface CCR5 than WT CCL4 on immature dendritic cells ( C ) and CEM.NK R CCR5 T-cell line ( D ). Cells were treated with 80 ng/mL of each CCL4 species for 3 hours, surface CCR5 was stained with anti-CCR5 antibody and analyzed by flow cytometry (** P<0.01, *** P<0.001 in comparison with untreated control; # P<0.05 in comparison with WT CCL4).

Article Snippet: Recombinant human CCL3 (MIP-1 α ), CCL4 (MIP-1 β ), CCL11 (Eotaxin), CCL1 (MCP-1), IL-13, GM-CSF, IL-4, and IFN γ were obtained from ProSpec Protein-Specialists (East Brunswick, NJ, USA); LPS from E. coli (055:B5) were purchased from Sigma-Aldrich (St. Louis, MO, USA); recombinant human CCL4 variant (S80T) was from Kingfisher Biotech, Inc (St Paul, MN, USA); anti-human CCR5-PE (CD195, Clone# J418F1), anti-human CCR1-APC (CD191, Clone# 5F10B29), anti-human CD4-PerCP (Clone# OKT4) and anti-human CD3-FITC (clone# SK7) were from Biolegend (San Diego, CA, USA); Indo-1-AM was from Molecular Probes (Eugene, OR).

Techniques: Blocking Assay, Staining, Flow Cytometry, Comparison, Control

Purified CD4 T-cells from mismatched donors were co-incubated for nine days and treated with WT or varCCL4 (50ng/mL) for 3 hours, surface stained with anti-CCR5 antibody and analyzed by flow cytometry (** P<0.01, *** P<0.001 in comparison with untreated control; # P<0.05 in comparison with WT CCL4).

Journal: PLoS ONE

Article Title: SNPs in inflammatory genes CCL11 , CCL4 and MEFV in a fibromyalgia family study

doi: 10.1371/journal.pone.0198625

Figure Lengend Snippet: Purified CD4 T-cells from mismatched donors were co-incubated for nine days and treated with WT or varCCL4 (50ng/mL) for 3 hours, surface stained with anti-CCR5 antibody and analyzed by flow cytometry (** P<0.01, *** P<0.001 in comparison with untreated control; # P<0.05 in comparison with WT CCL4).

Article Snippet: Recombinant human CCL3 (MIP-1 α ), CCL4 (MIP-1 β ), CCL11 (Eotaxin), CCL1 (MCP-1), IL-13, GM-CSF, IL-4, and IFN γ were obtained from ProSpec Protein-Specialists (East Brunswick, NJ, USA); LPS from E. coli (055:B5) were purchased from Sigma-Aldrich (St. Louis, MO, USA); recombinant human CCL4 variant (S80T) was from Kingfisher Biotech, Inc (St Paul, MN, USA); anti-human CCR5-PE (CD195, Clone# J418F1), anti-human CCR1-APC (CD191, Clone# 5F10B29), anti-human CD4-PerCP (Clone# OKT4) and anti-human CD3-FITC (clone# SK7) were from Biolegend (San Diego, CA, USA); Indo-1-AM was from Molecular Probes (Eugene, OR).

Techniques: Purification, Incubation, Staining, Flow Cytometry, Comparison, Control

Fig. 2 BTG3-KO keratinocytes release IL1α, IL10, and CCL4 to promote 3T3-L1 adipogenic differentiation. a Schematic workflow of cytokine antibody array analysis. CM was collected after 48 h of culture, and analyzed using a human cytokine antibody array. BTG3-KO CM was a mixture from the three KO clones indicated. b The levels of factors and cytokines, including IL1α, IL10, and CCL4, were increased in BTG3-KO CM. CM from (a) was subjected to antibody array analysis. Signals from duplicated spots were quantified and compared between parental and BTG3-KO cells. CCL7 is shown as an unaltered control. c mRNA expression levels of IL1A, IL10, CCL4, and VEGFD, but not CCL7, were increased in BTG3-KO HaCaT cells. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed and results from three independent experiments are shown. d–i Elevated expression levels of IL1α, IL10, and CCL4 in the back skin of Btg3-KO mice. 8-week-old WT and Btg3-KO mice were shaved and their back skin was collected 3 weeks later and embedded for immunohistochemical (IHC) analysis using antibodies against IL1α d, IL10 f, and CCL4 h. Examples of positively stained cell are indicated by arrows. Quantified results (n = 6) are shown in e, g, and i, respectively. j Addition of recombinant IL1α, IL10, and CCL4 to parental CM promotes 3T3-L1 differentiation. Adipogenesis was measured by Oil Red O staining followed by quantification. k Antibody-mediated neutralization of IL1α, IL10 and CCL4 in BTG3-KO CM reduced the effect on 3T3-L1 adipogenic differentiation. *P < 0.05. **P < 0.01.

Journal: Cell death and differentiation

Article Title: A keratinocyte-adipocyte signaling loop is reprogrammed by loss of BTG3 to augment skin carcinogenesis.

doi: 10.1038/s41418-024-01304-7

Figure Lengend Snippet: Fig. 2 BTG3-KO keratinocytes release IL1α, IL10, and CCL4 to promote 3T3-L1 adipogenic differentiation. a Schematic workflow of cytokine antibody array analysis. CM was collected after 48 h of culture, and analyzed using a human cytokine antibody array. BTG3-KO CM was a mixture from the three KO clones indicated. b The levels of factors and cytokines, including IL1α, IL10, and CCL4, were increased in BTG3-KO CM. CM from (a) was subjected to antibody array analysis. Signals from duplicated spots were quantified and compared between parental and BTG3-KO cells. CCL7 is shown as an unaltered control. c mRNA expression levels of IL1A, IL10, CCL4, and VEGFD, but not CCL7, were increased in BTG3-KO HaCaT cells. Reverse transcription quantitative polymerase chain reaction (RT-qPCR) was performed and results from three independent experiments are shown. d–i Elevated expression levels of IL1α, IL10, and CCL4 in the back skin of Btg3-KO mice. 8-week-old WT and Btg3-KO mice were shaved and their back skin was collected 3 weeks later and embedded for immunohistochemical (IHC) analysis using antibodies against IL1α d, IL10 f, and CCL4 h. Examples of positively stained cell are indicated by arrows. Quantified results (n = 6) are shown in e, g, and i, respectively. j Addition of recombinant IL1α, IL10, and CCL4 to parental CM promotes 3T3-L1 differentiation. Adipogenesis was measured by Oil Red O staining followed by quantification. k Antibody-mediated neutralization of IL1α, IL10 and CCL4 in BTG3-KO CM reduced the effect on 3T3-L1 adipogenic differentiation. *P < 0.05. **P < 0.01.

Article Snippet: The following recombinant proteins were used: IL1α (200-LA-002), IL10 (217-IL-005), CCL4 (271-BME-010), CCL20 (360-MP-025), FGF7 (251-KG-010), and IL15 (247-ILB-005) from R&D Systems, and EGF (E4269) from SigmaAldrich.

Techniques: Ab Array, Clone Assay, Control, Expressing, Reverse Transcription, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Immunohistochemical staining, Staining, Recombinant, Neutralization

Fig. 6 Model of BTG3 in the regulation of adipogenesis and the development of skin cancer. Our data are consistent with a role of BTG3 in safeguarding the functional interplay between keratinocytes and adipocytes. In the absence of BTG3, keratinocytes, by releasing IL1α, IL10 and CCL4, promote their own mesenchymal transition by an autocrine mechanism and adipocyte differentiation through paracrine. The latter, in turn, fuels further keratinocyte proliferation and migration by releasing EGF, CCL20, and FGF7, thus forming a feedforward loop to promote skin oncogenesis.

Journal: Cell death and differentiation

Article Title: A keratinocyte-adipocyte signaling loop is reprogrammed by loss of BTG3 to augment skin carcinogenesis.

doi: 10.1038/s41418-024-01304-7

Figure Lengend Snippet: Fig. 6 Model of BTG3 in the regulation of adipogenesis and the development of skin cancer. Our data are consistent with a role of BTG3 in safeguarding the functional interplay between keratinocytes and adipocytes. In the absence of BTG3, keratinocytes, by releasing IL1α, IL10 and CCL4, promote their own mesenchymal transition by an autocrine mechanism and adipocyte differentiation through paracrine. The latter, in turn, fuels further keratinocyte proliferation and migration by releasing EGF, CCL20, and FGF7, thus forming a feedforward loop to promote skin oncogenesis.

Article Snippet: The following recombinant proteins were used: IL1α (200-LA-002), IL10 (217-IL-005), CCL4 (271-BME-010), CCL20 (360-MP-025), FGF7 (251-KG-010), and IL15 (247-ILB-005) from R&D Systems, and EGF (E4269) from SigmaAldrich.

Techniques: Functional Assay, Migration

Fig. 1. Multiple-sequence comparisons and a phylogenetic tree based on porcine CCL4 and other CCL4 proteins identified in different species. [A] Multiple-sequence alignment of porcine CCL4 with other CCL4s deposited in GenBank: Bos taurus (cow, NP_001068615.1), Homo sapiens (human, NP_002975.1), Pan troglodytes (chimpanzee, XP_016787457.1), Oryctolagus cuniculus (rabbit, NP_001075665.1), Mus musculus (mouse, NP_038680.1), Rattus norvegicus (rat, NP_446310.1), and Gallus gallus (chicken, NP_990051.1). Similar regions in the sequences are boxed. White letters shaded in black indicate that the similarity of this position is 100%, whereas the dark grey letters mean that the similarity of the position is over 75%, but below 100%. The SCY domain involved in the intercrine α family of cytokines was found to be conserved. [B] A phylogenetic tree was constructed by the neighbor- joining method using amino acid sequences from diverse species, and the scale bar indicates the genetic distance among species. [C] A comparison of porcine CCL4 sequence homology to other CCL4s.

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 1. Multiple-sequence comparisons and a phylogenetic tree based on porcine CCL4 and other CCL4 proteins identified in different species. [A] Multiple-sequence alignment of porcine CCL4 with other CCL4s deposited in GenBank: Bos taurus (cow, NP_001068615.1), Homo sapiens (human, NP_002975.1), Pan troglodytes (chimpanzee, XP_016787457.1), Oryctolagus cuniculus (rabbit, NP_001075665.1), Mus musculus (mouse, NP_038680.1), Rattus norvegicus (rat, NP_446310.1), and Gallus gallus (chicken, NP_990051.1). Similar regions in the sequences are boxed. White letters shaded in black indicate that the similarity of this position is 100%, whereas the dark grey letters mean that the similarity of the position is over 75%, but below 100%. The SCY domain involved in the intercrine α family of cytokines was found to be conserved. [B] A phylogenetic tree was constructed by the neighbor- joining method using amino acid sequences from diverse species, and the scale bar indicates the genetic distance among species. [C] A comparison of porcine CCL4 sequence homology to other CCL4s.

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Sequencing, Construct, Comparison

Fig. 2. Relative expression and localization of CCL4 and CCR5 mRNAs in the porcine endometrium during the estrous cycle and early pregnancy. [A and B] Differential expression of CCL4 [A] and CCR5 [B] mRNAs was determined using quantitative RT-PCR in porcine endometrium during the estrous cycle (days 9, 12, and 15) and early pregnancy (days 9, 10, 12, 13, 14, 20, and 30). Expression of CCL4 and CCR5 mRNAs was normalized to GAPDH. Data were analyzed and compared to data from day 9 of the estrous cycle in pigs. Asterisks indicate a significant difference in the expression (***P < 0.001, **P < 0.01, and *P < 0.05). [C and D] Localization of CCL4 [C] and CCR5 [D] mRNAs was analyzed in porcine endometrium by in situ hybridization during the estrous cycle and early pregnancy. Legend: GE, glandular epithelium; LE, luminal epithelium. The scale bar is 50 µm (the first horizontal panels and sense) and 20 µm (the second horizontal panels).

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 2. Relative expression and localization of CCL4 and CCR5 mRNAs in the porcine endometrium during the estrous cycle and early pregnancy. [A and B] Differential expression of CCL4 [A] and CCR5 [B] mRNAs was determined using quantitative RT-PCR in porcine endometrium during the estrous cycle (days 9, 12, and 15) and early pregnancy (days 9, 10, 12, 13, 14, 20, and 30). Expression of CCL4 and CCR5 mRNAs was normalized to GAPDH. Data were analyzed and compared to data from day 9 of the estrous cycle in pigs. Asterisks indicate a significant difference in the expression (***P < 0.001, **P < 0.01, and *P < 0.05). [C and D] Localization of CCL4 [C] and CCR5 [D] mRNAs was analyzed in porcine endometrium by in situ hybridization during the estrous cycle and early pregnancy. Legend: GE, glandular epithelium; LE, luminal epithelium. The scale bar is 50 µm (the first horizontal panels and sense) and 20 µm (the second horizontal panels).

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Expressing, Quantitative RT-PCR, In Situ Hybridization

Fig. 3. Effects of CCL4 on proliferation and cell cycle of pLE cells. [A] Proliferation of porcine uterine luminal epithelial (pLE) cells in response to various doses of CCL4 (0, 5, 10, 25, 50, and 100 ng/mL). Relative proliferation is expressed as a percentage ratio relative to vehicle-treated pLE cells (100%). [B and C] Western blot analyses revealed abundances of PCNA [B] and phosphorylated cyclin D1 (p-cyclin D1) [C] in pLE cells treated with CCL4 (0, 10, 25, and 50 ng/mL). The intensity of the immunoblots was calculated to normalize the data on PCNA to α-tubulin (TUBA) and to normalize p-Cyclin D1 data to total cyclin D1. All error bars represent standard error of the mean (SEM) of representative experiments conducted in triplicate. [D] The proportion of cells in various stages of the cell cycle were analyzed by flow cytometry after propidium iodide (PI) staining to determine effects of CCL4-treated progression of pLE cells through the cell cycle. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05).

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 3. Effects of CCL4 on proliferation and cell cycle of pLE cells. [A] Proliferation of porcine uterine luminal epithelial (pLE) cells in response to various doses of CCL4 (0, 5, 10, 25, 50, and 100 ng/mL). Relative proliferation is expressed as a percentage ratio relative to vehicle-treated pLE cells (100%). [B and C] Western blot analyses revealed abundances of PCNA [B] and phosphorylated cyclin D1 (p-cyclin D1) [C] in pLE cells treated with CCL4 (0, 10, 25, and 50 ng/mL). The intensity of the immunoblots was calculated to normalize the data on PCNA to α-tubulin (TUBA) and to normalize p-Cyclin D1 data to total cyclin D1. All error bars represent standard error of the mean (SEM) of representative experiments conducted in triplicate. [D] The proportion of cells in various stages of the cell cycle were analyzed by flow cytometry after propidium iodide (PI) staining to determine effects of CCL4-treated progression of pLE cells through the cell cycle. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05).

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Western Blot, Cytometry, Staining

Fig. 4. Stimulatory effects of CCL4 on activation of PI3K and MAPK pathways in pLE cells. [A to F] Western blot analyses indicate the abundances of p-AKT [A], p-P70S6K [B], p-S6 [C], p-ERK1/2 [D], p-JNK [E], and p-P38 [F] proteins in pLE cells treated with CCL4. The intensity of immunoblots was calculated to normalize data for each phosphoprotein to the corresponding total protein. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05).

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 4. Stimulatory effects of CCL4 on activation of PI3K and MAPK pathways in pLE cells. [A to F] Western blot analyses indicate the abundances of p-AKT [A], p-P70S6K [B], p-S6 [C], p-ERK1/2 [D], p-JNK [E], and p-P38 [F] proteins in pLE cells treated with CCL4. The intensity of immunoblots was calculated to normalize data for each phosphoprotein to the corresponding total protein. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05).

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Activation Assay, Western Blot

Fig. 5. Effects of CCL4 during cotreatment with inhibitors of PI3K or MAPKs on the proliferation and signal transduction in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with CCL4 (50 ng/mL), or cotreatment with CCL4 plus wortmannin (1 μM), U0126 (20 μM), SP600125 (20 μM), or SB203580 (20 μM). Relative proliferation of pLE cell presented as a percentage ratio relative to proliferation of vehicle-treated pLE cells (100%). [B to H] Western blot analyses indicate the abundances of p-AKT [B], p-P70S6K [C], p-S6 [D], p-ERK1/2 [E], p-JNK [F], p-P38 [G], and p-Cyclin D1 [H] proteins in pLE cells treated with CCL4 or in pLE cells cotreatment with each inhibitor. The intensity of immunoblots was calculated to normalize abundance of each phosphoprotein to the corresponding total protein. Asterisks denote a significant difference from vehicle-treated pLE cells (***P < 0.001, **P < 0.01, and *P < 0.05).

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 5. Effects of CCL4 during cotreatment with inhibitors of PI3K or MAPKs on the proliferation and signal transduction in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with CCL4 (50 ng/mL), or cotreatment with CCL4 plus wortmannin (1 μM), U0126 (20 μM), SP600125 (20 μM), or SB203580 (20 μM). Relative proliferation of pLE cell presented as a percentage ratio relative to proliferation of vehicle-treated pLE cells (100%). [B to H] Western blot analyses indicate the abundances of p-AKT [B], p-P70S6K [C], p-S6 [D], p-ERK1/2 [E], p-JNK [F], p-P38 [G], and p-Cyclin D1 [H] proteins in pLE cells treated with CCL4 or in pLE cells cotreatment with each inhibitor. The intensity of immunoblots was calculated to normalize abundance of each phosphoprotein to the corresponding total protein. Asterisks denote a significant difference from vehicle-treated pLE cells (***P < 0.001, **P < 0.01, and *P < 0.05).

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Transduction, Western Blot

Fig. 6. Effects of CCL4 on tunicamycin-stimulated ER stress in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with tunicamycin (0.25 μg/mL), CCL4 (50 ng/ mL), or their combination for 48 h. Relative proliferation of pLE cells is presented as the ratio relative to vehicle-treated pLE cells (100%). [B to G] Western blot analyses reveals the abundances of GRP78 [B], IRE1α [C], ATF6α [D], p-PERK [E], p-eIF2α [F], and GADD153 [G] proteins in pLE cells during treatment with tunicamycin, CCL4, or their combination for 24 h. The intensity of immunoblots was calculated to normalize abundance of each target protein to the respective total protein or TUBA. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of tunicamycin alone.

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 6. Effects of CCL4 on tunicamycin-stimulated ER stress in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with tunicamycin (0.25 μg/mL), CCL4 (50 ng/ mL), or their combination for 48 h. Relative proliferation of pLE cells is presented as the ratio relative to vehicle-treated pLE cells (100%). [B to G] Western blot analyses reveals the abundances of GRP78 [B], IRE1α [C], ATF6α [D], p-PERK [E], p-eIF2α [F], and GADD153 [G] proteins in pLE cells during treatment with tunicamycin, CCL4, or their combination for 24 h. The intensity of immunoblots was calculated to normalize abundance of each target protein to the respective total protein or TUBA. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of tunicamycin alone.

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Western Blot

Fig. 7. Effects of CCL4 on LPS-induced inflammation in pLE cells. [A to E] Western blot analyses of the abundances MyD88 [A], IRAK1 [B], TAK1 [C], IKKα/β [D], and NF-κB [E] proteins in pLE cells treated with LPS (20 μg/mL), CCL4 (50 ng/mL), or their combination for 24 h. The intensity of immunoblots was calculated to normalize the abundance of each target protein to the corresponding total protein or TUBA. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of LPS alone.

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 7. Effects of CCL4 on LPS-induced inflammation in pLE cells. [A to E] Western blot analyses of the abundances MyD88 [A], IRAK1 [B], TAK1 [C], IKKα/β [D], and NF-κB [E] proteins in pLE cells treated with LPS (20 μg/mL), CCL4 (50 ng/mL), or their combination for 24 h. The intensity of immunoblots was calculated to normalize the abundance of each target protein to the corresponding total protein or TUBA. Asterisks indicate a significant difference from vehicle-treated pLE cells (**P < 0.01 and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of LPS alone.

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Western Blot

Fig. 8. Effects of CCR5 antagonist on CCL4-induced proliferation and signal transduction molecules in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with Maraviroc (3 μg/mL), CCL4 (50 ng/mL), or their combination for 48 h. Relative cellular proliferation is presented as a percentage ratio relative to vehicle-treated pLE cells (100%). [B to G] Western blot analyses indicate abundances of p-AKT [B], p-P70S6K [C], p-S6 [D], p-ERK1/2 [E], p-JNK [F], and p-P38 [G] proteins in pLE cells during treatment with Maraviroc, CCL4, or their combination for 24 h. The intensity of immunoblots was calculated to normalize abundance of each phosphoprotein to the corresponding total protein. Asterisks denote a significant difference from vehicle-treated pLE cells (**P < 0.01, and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of Maraviroc alone.

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 8. Effects of CCR5 antagonist on CCL4-induced proliferation and signal transduction molecules in pLE cells. [A] Proliferation of pLE cells was analyzed during treatment with Maraviroc (3 μg/mL), CCL4 (50 ng/mL), or their combination for 48 h. Relative cellular proliferation is presented as a percentage ratio relative to vehicle-treated pLE cells (100%). [B to G] Western blot analyses indicate abundances of p-AKT [B], p-P70S6K [C], p-S6 [D], p-ERK1/2 [E], p-JNK [F], and p-P38 [G] proteins in pLE cells during treatment with Maraviroc, CCL4, or their combination for 24 h. The intensity of immunoblots was calculated to normalize abundance of each phosphoprotein to the corresponding total protein. Asterisks denote a significant difference from vehicle-treated pLE cells (**P < 0.01, and *P < 0.05). Lowercase letter (a) indicates a statistically significant change (P < 0.05) compared with effects of Maraviroc alone.

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Transduction, Western Blot

Fig. 9. Effects of CCL4 on interactions between peri-implantation conceptuses and maternal endometrium during the implantation period. [A] Proliferation of pTr cells was analyzed during treatment with CCL4 in a dose-dependent manner (0, 5, 10, 25 and 50 ng/mL) for 48 h. Relative proliferation of cells is presented as a percentage ratio relative to vehicle-treated pTr cells (100%). [B and C] Migration of pTr [B] and pLE [C] cells was analyzed using Transwell migration plates during treatment with CCL4 (0, 5, 10, 25 and 50 ng/mL) for 6 h. Relative migration of cells is presented as a percentage ratio relative to vehicle-treated cells (100%). [E to I] Relative expression of mRNAs for porcine implantation-related genes ADIPOR1 [E], ADIPOR2 [F], EGFR [G], FGFR1 [H] and VEGFR [I] in pTr cells in response to CCL4. The expression of target genes was normalized to GAPDH. Data were analyzed to compare treated versus untreated pTr cells. [J to N] Relative expression of ADIPOR1 [J], ADIPOR2 [K], EGFR [L], FGFR1 [M] and VEGFR [N] mRNAs in pLE cells in response to CCL4. The expression of target genes was normalized to GAPDH. Data were analyzed to compare effects relative to untreated pLE cells. Asterisks denote a significant difference from vehicle- treated cells (***P < 0.001, **P < 0.01, and *P < 0.05).

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 9. Effects of CCL4 on interactions between peri-implantation conceptuses and maternal endometrium during the implantation period. [A] Proliferation of pTr cells was analyzed during treatment with CCL4 in a dose-dependent manner (0, 5, 10, 25 and 50 ng/mL) for 48 h. Relative proliferation of cells is presented as a percentage ratio relative to vehicle-treated pTr cells (100%). [B and C] Migration of pTr [B] and pLE [C] cells was analyzed using Transwell migration plates during treatment with CCL4 (0, 5, 10, 25 and 50 ng/mL) for 6 h. Relative migration of cells is presented as a percentage ratio relative to vehicle-treated cells (100%). [E to I] Relative expression of mRNAs for porcine implantation-related genes ADIPOR1 [E], ADIPOR2 [F], EGFR [G], FGFR1 [H] and VEGFR [I] in pTr cells in response to CCL4. The expression of target genes was normalized to GAPDH. Data were analyzed to compare treated versus untreated pTr cells. [J to N] Relative expression of ADIPOR1 [J], ADIPOR2 [K], EGFR [L], FGFR1 [M] and VEGFR [N] mRNAs in pLE cells in response to CCL4. The expression of target genes was normalized to GAPDH. Data were analyzed to compare effects relative to untreated pLE cells. Asterisks denote a significant difference from vehicle- treated cells (***P < 0.001, **P < 0.01, and *P < 0.05).

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Migration, Expressing

Fig. 10. Hypothetical illustration of CCL4-mediated signal transduction in pLE cells. CCL4 activates PI3K and MAPK pathways through CCR5, thereby improving the proliferation and survival of pLE cells. Treatment with CCL4 prevents tunicamycin-induced cell death via effects on UPR-regulatory proteins. In addition, treatment with CCL4 inhibits LPS-triggered inflammation in pLE cells by regulating NF-κB signaling proteins. Overall, CCL4 may play an important role in development of the porcine endometrium in the early gestational period.

Journal: Developmental biology

Article Title: Characterization of C-C motif chemokine ligand 4 in the porcine endometrium during the presence of the maternal-fetal interface.

doi: 10.1016/j.ydbio.2018.06.022

Figure Lengend Snippet: Fig. 10. Hypothetical illustration of CCL4-mediated signal transduction in pLE cells. CCL4 activates PI3K and MAPK pathways through CCR5, thereby improving the proliferation and survival of pLE cells. Treatment with CCL4 prevents tunicamycin-induced cell death via effects on UPR-regulatory proteins. In addition, treatment with CCL4 inhibits LPS-triggered inflammation in pLE cells by regulating NF-κB signaling proteins. Overall, CCL4 may play an important role in development of the porcine endometrium in the early gestational period.

Article Snippet: Recombinant human CCL4 (catalog number: 271-BME/CF) was purchased from R&D Systems (Minneapolis, MN, USA).

Techniques: Transduction