Journal: Aging (Albany NY)

Article Title: ER-depletion lowering the 'hypothalamus-uterus-kidney' axis functions by perturbing the renal ERβ/Ptgds signalling pathway

doi: 10.18632/aging.102401

Figure Lengend Snippet: Correlation analyses illustrated the relationships among ‘genes-metabolites-phenotypes’ in ER-depletion-induced renal lipid metabolism disorder. ( A ) Relative peptide quantification in control and OVX rat urine samples. n=3, mean ± s.e.m.; ( B ) Real time PCR assays of uterus ERβ among control, OVX and OVX+E2 rats. n=3, mean ± s.e.m.; ( C ) Average weekly body weight (g) from 0 to 12 weeks before and after surgery and average organ/body weight ratio (organ %) at 12 weeks after surgery. ( D ) Kidney biochemical profiles in the sera of control and OVX rats. ( E ) Lipid biochemical profiles in the sera of control and OVX rats. n=6, mean ± s.d., compared to control rats, *p ˂ 0.05, **p ˂ 0.005, ***p ˂ 0.0005. Correlation heat map representation of the differentially expressed gene and metabolite markers in organs, renal biochemistry, and lipid biochemistry phenotypes including genes clustered into organ phenotypes, subsets of genes clustered into organ functions and subsets of genes clustered into eicosanoid markers in urine ( F ) and serum ( G ).

Article Snippet: We performed real time polymerase chain reaction (PCR) analysis for ERβ assay (ref. NM_012754.1, 204 bp, 60°C, Servicebio: forward primer: 5′- CTGGGTGATTGCGAAGAGTGG -3′ and reverse primer: 5′- GAGGACTTGTACCCTCGAAG CG -3′) ( , ).

Techniques: Control, Real-time Polymerase Chain Reaction

Journal: Aging (Albany NY)

Article Title: ER-depletion lowering the 'hypothalamus-uterus-kidney' axis functions by perturbing the renal ERβ/Ptgds signalling pathway

doi: 10.18632/aging.102401

Figure Lengend Snippet: ER-depletion reduce HUK functions attribute to ERβ/Ptgds signalling pathway disturbance. Immunofluorescence (IF) analysis including the staining images ( A – C ) and AOD calculation data ( D ) in the left panel shows the double staining of ERβ (red) and Ptgds (green) from kidney ( A ), uterine ( B ), and hypothalamic ( C ) among control, OVX, and E2+OVX rats. Scale bar, 50 μM. The AOD ratio indicates the ratio of optical density (IOD) and values to staining area (AREA). Western blot (WB) analysis including the gel images ( E – F ) and protein loading data ( H ) in the middle panel present the ERβ and Ptgds proteins expression from kidney ( E ), uterine ( F ), and hypothalamic ( G ) among control, OVX, and E2+OVX rats. n=3, mean ± s.e.m. Real time PCR analysis of the transcription levels of ERβ and Ptgds expression various among control, OVX and OVX+E2 rats along ‘hypothalamus-uterus-kidney axis’ in the right panel ( I – K ). n=3, mean ± s.e.m., NS, not significant. Morris water maze test including location test and spatial learning test for control, OVX, and E2+OVX rats. As well as ( L ) escape latency duration, swimming length to the escape platform, number of crossings escape platform position, and ( M ) the images of total movement towards to the target for control, OVX, and E2+OVX rats. n=6, mean ± s.d., *p < 0.05, **p < 0.005, ***p < 0.0005 versus control rats; #p < 0.05, ##p < 0.005, ###p < 0.0005 versus control rats, NS, not significant.

Article Snippet: We performed real time polymerase chain reaction (PCR) analysis for ERβ assay (ref. NM_012754.1, 204 bp, 60°C, Servicebio: forward primer: 5′- CTGGGTGATTGCGAAGAGTGG -3′ and reverse primer: 5′- GAGGACTTGTACCCTCGAAG CG -3′) ( , ).

Techniques: Immunofluorescence, Staining, Double Staining, Control, Western Blot, Expressing, Real-time Polymerase Chain Reaction

Journal: Scientific Reports

Article Title: Transcriptome responses in alfalfa associated with tolerance to intensive animal grazing

doi: 10.1038/srep19438

Figure Lengend Snippet: Primers used in real-time RT-PCR analysis of 12 grazing upregulated transcripts, as identified from the transcriptome analysis, and two reference genes UBL-2a and ADF.

Article Snippet: To validate those results, real-time RT-PCR analysis was subsequently performed on an Opticon II system (MJ Research, Waltham, MA, USA), with SYBR® green reagents (Bio-Rad, Hercules, CA) in a 20 μl reaction volume that contained 250 nM transcript-specific primer pairs ( ).

Techniques: Quantitative RT-PCR