Journal: Cell Systems

Article Title: Context Specificity in Causal Signaling Networks Revealed by Phosphoprotein Profiling

doi: 10.1016/j.cels.2016.11.013

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal anti-RBM15 , Novus Biologicals , Cat#21390002; RRID: AB_2175759.

Techniques: Transduction, Recombinant, Protease Inhibitor, Bicinchoninic Acid Protein Assay, Software, Inhibition, Modification

Journal: bioRxiv

Article Title: Safety and efficacy of C9ORF72 -repeat RNA nuclear export inhibition in amyotrophic lateral sclerosis

doi: 10.1101/2021.04.12.438950

Figure Lengend Snippet: ( A ) Bar chart representing the genome-wide number of identified splicing alterations at exon (purple) or gene (green) level for the C9-ALS-disease, C9-ALS-treated and SRSF1-depleted healthy neurons. ( B ) Genome wide nuclear RNA export analysis of the SRSF1 depletion in C9-ALS patient derived neurons. The heatmap represents transcript fold changes for FC>3 in WCT and FC>3 in CyT. Red labels shows down-regulated transcripts while green depicts upregulated transcripts. ( C ) Venn diagram representing the lists of RNA nuclear export alterations and SRSF1-RNAi-induced neuroprotective changes in C9-ALS neurons. ( D ) Relative RNA expression levels of RSL1D1 , MTCL1 , DAPK1 , NUP98 , MSH6 , RBM15 , USP19 and FN1 transcripts in total, nuclear and cytoplasmic fractions were quantified using qRT-PCR in biological triplicates following normalization to U1 snRNA levels and to 100% for whole-cell healthy neurons treated with C-RNAi (mean ± SEM; two-way ANOVA with Tukey’s correction for multiple comparisons, NS: not significant; *: p<0.05, **: p<0.01, ***: p<0.001; ****: p<0.0001; N (qRT-PCR reactions)=3).

Article Snippet: Primers for Drosophila Tub84b (Ling et al ., PLoS ONE 2011; 6:e17762): Fwd: 5’-TGGGCCCGTCTGGACCACAA-3’ Rev: 5’-TCGCCGTCACCGGAGTCCAT-3’ Primers for Drosophila SK (designed using Primer-BLAST): Fwd: 5’-ACCCTGTACTGCTGTTGCC-3’ Rev: 5’-TGTACAGATTCTGATGGATGGCTT-3’ Primers for Drosophila NAAT1 (designed using Primer-BLAST): Fwd: 5’-CACGGGATTGGCCTTCATCT-3’ Rev: 5’-CACGGGATTGGCCTTCATCT-3’ Primers for Drosophila DHD (designed using Primer-BLAST): Fwd: 5’-GTGGTCCCTGCAAGGAAATG-3’ Rev: 5’-CACCTTGTAGCGCTCCGTC-3’ Primers for Human U1 snRNA (Hautbergue et al ., 2017; 8:16063): Fwd: 5’-CCATGATCACGAAGGTGGTT-3’ Rev: 5’-ATGCAGTCGAGTTTCCCACA-3’ Primers for Human SRSF1 (Hautbergue et al ., 2017; 8:16063): Fwd: 5’-CCGCATCTACGTGGGTAACT-3’ Rev: 5’-TCGAACTCAACGAAGGCGAA-3 Primers for Human C9ORF72 (Hautbergue et al ., 2017; 8:16063): Intron-1 Rev: 5’-GGAGAGAGGGTGGGAAAAAC-3’ Exon-3 Rev: 5’-GTCGACATGACTGCATTCCA-3’ Exon-1 For: 5’-TCAAACAGCGACAAGTTCCG-3’ Primers for Human Usp49 (Origene): Fwd: 5’-GGAGAATCTACGCTTGTGACCAG-3’ Rev: 5’-CGGAGAACCTGAGGTAGTCTGT-3’ Primers for Human RSL1D1 (Origene): Fwd: 5’-TCCGAAGACGAAATCCCACAGC-3’ Rev: 5’-GTGCTGGGATTAGGACTCTTTGC-3’ Primers for Human MSH6 (Origene): Fwd: 5’-AAGGACTGGCAGTCTGCTGTAG-3’ Rev: 5’-CGGCAACACAGAATTACTGGGCGA-3’ Primers for Human RBM15 (Origene): Fwd: 5’-CTTCCCACCTTGTGAGTTCTCC-3’ Rev: 5’-CTTCTTGTTCTCATACCTAACTCC-3’ Primers for Human MTCL3 (Origene): Fwd: 5’-TGCTCAAGTGCCGTCTGGAACA-3’ Rev: 5’-TGACTGTCTGCCAGGAGCTTCT-3’ Primers for Human NUP98 (Origene): Fwd: 5’-CCATCTATGGATGACCTGTAAA-3’ Rev: 5’-TCCGACCAATAGTGAAATCAGAGA-3’ Primers for Human DAPK1 (Origene): Fwd: 5’-CCAGACTGTCTTCCACCAACTC-3’ Rev: 5’-TCCTCACACTCACGTTCTCGCA-3’ Primers for Human FN1 (Origene): Fwd: 5’-GGACACAACGATGCTTCCTGAG-3’ Rev: 5’-ACAACACCGAGGTGACTGAGAC-3’ Primers for Human USP19 (Origene): Fwd: 5’-GCTGCTATCCTCAGAGTTGGCT-3’ Rev: 5’-TCATCCTCCGACTGTTGCTTCC-3’ Primers for Human KCNN1 (Origene): Fwd: 5’-TGCTGGTCTTCAGCATCTCCTC-3’ Rev: 5’-CGTAGCCAATGGAGAGGAAGGT-3’ Primers for Human KCNN2 (Origene): Fwd: 5’-GCCTTATCAGTCTCTCCACGATC-3’ Rev: 5’-CCAGTCATCTGCTCCATTGTCC-3’ Primers for Human KCNN3 (Origene): Fwd: 5’-GCCTTATCAGTCTGTCCACCATC-3’ Rev: 5’-TACAGGATGCGCTCGTAGGTCA-3’ Primers for Human KCNN4 (Origene): Fwd: 5’-CATTCCTGACCATCGGCTATGG-3’ Rev: 5’-GCCTTGTTAAACTCCAGCTTCCG-3’ Primers for Human TRX1 (Origene): Fwd: 5’-GTAGTTGACTTCTCAGCCACGTG-3’ Rev: 5’-CTGACAGTCATCCACATCTACTTC-3’

Techniques: Genome Wide, Derivative Assay, RNA Expression, Quantitative RT-PCR

Journal: The EMBO Journal

Article Title: METTL3/MYCN cooperation drives neural crest differentiation and provides therapeutic vulnerability in neuroblastoma

doi: 10.1038/s44318-024-00299-8

Figure Lengend Snippet: Reagents and tools table

Article Snippet: Rabbit polyclonal anti-RBM15 , Atlas Antibodies , Cat# HPA019824, RRID:AB_1856113.

Techniques: Sequencing, Cloning, Imaging, Staining, Software, Control, Mutagenesis, Plasmid Preparation

Journal: The Kaohsiung Journal of Medical Sciences

Article Title: N6‐methyladenosine ‐mediated LINC01087 promotes lung adenocarcinoma progression by regulating miR ‐514a‐3p to upregulate centrosome protein 55

doi: 10.1002/kjm2.12879

Figure Lengend Snippet: The effects of RNA‐binding motif protein 15 (RBM15) on the m 6 A modification level and stability of LINC01087. (A) Total m 6 A modification levels in lung adenocarcinoma (LUAD) cells and human bronchial epithelial cells were determined using the methylated RNA binding protein immunoprecipitation (Me‐RIP) assay. (B) The binding relationship between RBM15 and LINC01087 was determined using the RNA immunoprecipitation (RIP) assay. RBM15 antibody was used for RIP assay to isolate RBM15‐bonded RNAs, followed by real‐time quantitative polymerase chain reaction (RT‐qPCR) using LINC01087 specific primers. (C) Levels of m 6 A modification in LINC01087 after RBM15 knockdown in LUAD cells were determined with the MeRIP assay. (D) m 6 A modification sites in LINC01087 were predicted using the SRAMP database. (E) Schematic diagram showing m 6 A modification site and synonymous mutation in LINC01087. (F) The expression level of LINC01087 in LUAD cells cotransfected with sh‐RBM15 and LINC01087‐WT/LINC01087‐MUT was determined by RT‐qPCR. (A–C) Mut, adenine residues substituted by cytosine. (G) Levels of m 6 A modification in LINC01087 in LUAD cells cotransfected with sh‐RBM15 and LINC01087‐WT or LINC01087‐MUT were determined using the Me‐RIP assay. (H) LINC01087 mRNA stability in LUAD cells after RBM15 knockdown was determined with the RNA stability assay. Data are presented as means ± SD. N = 3/group. All data were obtained from three independent replicates. * p <0.05; ** p <0.01; *** p <0.001.

Article Snippet: Short hairpin RNAs targeting LINC01087 (sh‐LINC01087: 5′‐GCAAGAATGTGGATTTATTTC‐3′) and RBM15 (sh‐RBM15: 5′‐AGGTGATAGTTGGGCATATAT‐3′), miR‐514a‐3p mimics (sense: 5′‐AUUGACACUUCUGUGAGUAGA‐3′, antisense: 5′‐UCUACUCACAGAAGUGUCAAU‐3′), miR‐514a‐3p inhibitor (5′‐UCUACUCACAGAAGUGUCAAU‐3′), and their negative controls (sh‐NC: 5′‐UUCUCCGAACGUGUCACGUTT‐3′; mimics NC: sense: 5′‐UCACAACCUCCUAGAAAGAGUAGA‐3′, antisense: 5′‐UCUACUCUUUCUAGGAGGUUGUGA‐3′; inhibitor NC: 5′‐UCUACUCUUUCUAGGAGGUUGUGA‐3′) were provided by GenePharma.

Techniques: RNA Binding Assay, Modification, Methylation, Immunoprecipitation, Binding Assay, RNA Immunoprecipitation, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Knockdown, Mutagenesis, Expressing, Stability Assay