94
|
ATCC
puc18 derived plasmid psf12 ggt Puc18 Derived Plasmid Psf12 Ggt, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/puc18 derived plasmid psf12 ggt/product/ATCC Average 94 stars, based on 1 article reviews
puc18 derived plasmid psf12 ggt - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
94
|
TaKaRa
3247 gggtctttggaatttactggggtcttttca 3218 3247 Gggtctttggaatttactggggtcttttca 3218, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3247 gggtctttggaatttactggggtcttttca 3218/product/TaKaRa Average 94 stars, based on 1 article reviews
3247 gggtctttggaatttactggggtcttttca 3218 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pbr322 timer Pbr322 Timer, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pbr322 timer/product/Addgene inc Average 93 stars, based on 1 article reviews
pbr322 timer - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
94
|
Addgene inc
vector puc18 h1 rnai Vector Puc18 H1 Rnai, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/vector puc18 h1 rnai/product/Addgene inc Average 94 stars, based on 1 article reviews
vector puc18 h1 rnai - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
94
|
Qiagen
dna size marker puc18 hae iii Dna Size Marker Puc18 Hae Iii, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna size marker puc18 hae iii/product/Qiagen Average 94 stars, based on 1 article reviews
dna size marker puc18 hae iii - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
92
|
Addgene inc
herbert schweizer Herbert Schweizer, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/herbert schweizer/product/Addgene inc Average 92 stars, based on 1 article reviews
herbert schweizer - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
93
|
Addgene inc
puc18 mini tn7t lac vector Puc18 Mini Tn7t Lac Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/puc18 mini tn7t lac vector/product/Addgene inc Average 93 stars, based on 1 article reviews
puc18 mini tn7t lac vector - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
91
|
Addgene inc
ids 125765 Ids 125765, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ids 125765/product/Addgene inc Average 91 stars, based on 1 article reviews
ids 125765 - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
90
|
Addgene inc
puc18 mini tn7t plac dcas9 Puc18 Mini Tn7t Plac Dcas9, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/puc18 mini tn7t plac dcas9/product/Addgene inc Average 90 stars, based on 1 article reviews
puc18 mini tn7t plac dcas9 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
92
|
Addgene inc
addgene plasmid Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/addgene plasmid/product/Addgene inc Average 92 stars, based on 1 article reviews
addgene plasmid - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
92
|
Addgene inc
ha nls flpo wpre sv40 pa loxp pgk neo polya loxp cassette Ha Nls Flpo Wpre Sv40 Pa Loxp Pgk Neo Polya Loxp Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ha nls flpo wpre sv40 pa loxp pgk neo polya loxp cassette/product/Addgene inc Average 92 stars, based on 1 article reviews
ha nls flpo wpre sv40 pa loxp pgk neo polya loxp cassette - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
90
|
ATCC
ef 63 Ef 63, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ef 63/product/ATCC Average 90 stars, based on 1 article reviews
ef 63 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |