Journal: Glia

Article Title: FABP7 upregulation induces a neurotoxic phenotype in astrocytes.

doi: 10.1002/glia.23879

Figure Lengend Snippet: FIGURE 5 Overexpression of FABP7 confers upon nontransgenic astrocytes a pro-inflammatory phenotype. (a) Primary confluent spinal cord astrocyte cultures obtained from neonatal nontransgenic (NonTG) mice were transduced with adenovirus expressing GFP or FABP7. After 48 hr, FABP7 and GFAP protein levels were determined and corrected by ACTIN levels. (b,c) Quantification of the images shown in (a). (d) Fabp7, Nos2, Il6, Ptgs2, Ccl5, Cxcl10, Ppara, and Pparg mRNA levels in astrocytes treated as in (a). mRNA levels were determined by real-time PCR and corrected by Actin mRNA levels. Data are expressed as percentage of GFP control cells. (e) CXCL10 levels in conditioned media (48 hr) from GFP or FABP7 overexpressing NonTG astrocytes. Data are expressed as percentage of GFP control cells. (f) Nitrite (NO2 −) and nitrate (NO3 −) levels in conditioned media (48 hr) from GFP or FABP7 overexpressing NonTG astrocytes. (g,h) Astrocytes were treated as in (a) and 48 hr later chromatin immunoprecipitation was performed with a preimmune IgG (CIgG) or an anti-NF-κB p65 subunit antibody. Purified DNA was analyzed by real- time PCR with specific primers flanking an NF-κB binding site in the Cxcl10 (g) or Nos2 (h) promoter. (i) Real-time PCR analysis of Fabp7, Nos2, Il6, Ptgs2, Ccl5, and Cxcl10 mRNA expression levels 48 hr after FABP7 or FABP7(3A) overexpression in neonatal NonTG astrocytes. mRNA levels were corrected by Actin levels and expressed as percentage of GFP control cells. The data points for GFP and FABP7 in panel (i) were also included in Panel (d). Panel (d) includes additional biological replicates performed independently of the experiment described in Panel (i). (j) Relative luminescence produced by firefly luciferase expressed under an NF-κB-driven promoter 48 hr after FABP7 or FABP7 (3A) overexpression in neonatal NonTG astrocytes. Relative firefly luciferase luminescence was corrected by the amount of Renilla luciferase activity controlled by a constitutive promoter and expressed as percentage of GFP control cells. For all graph panels, data are expressed as mean ± SD (*p < .05)

Article Snippet: Adenovirus expressing a firefly luciferase gene under the control of a synthetic promoter that contains direct repeats of the NF-κB binding site (Ad-NFkb-Luc) or a Renilla luciferase under a constitutive pro- moter (Ad-pRL-Luc) were obtained from Vector Biolabs.

Techniques: Over Expression, Transduction, Expressing, Real-time Polymerase Chain Reaction, Control, Chromatin Immunoprecipitation, Purification, Binding Assay, Produced, Luciferase, Activity Assay

Journal: Endocrinology

Article Title: The Autophagy Gene Atg16L1 is Necessary for Endometrial Decidualization

doi: 10.1210/endocr/bqz039

Figure Lengend Snippet: List of primers and probes

Article Snippet: Mice were genotyped using RedTaq Polymerase (Sigma) Mix and the gene specific primers listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene name Species Application, Chemistry Company Sequence/Catalogue number ATG16L1 HM Mouse Genotyping IDT P1: TGGCTGGAGTGCGATCTTCC P2: CAGACGGCAAACGACTGTCCT P3: CAGGATCCTTCTGCACACATTT P4: CACCTGGTTACATTGGCAAACA PR Cre Mouse Genotyping IDT P1: ATG TTT AGC TGG CCC AAA TG P2: TAT ACC GAT CTC CCT GGA CG P3: CCC AAA GAG ACA CCA GGA AG Atg16L1 flox Mouse Genotyping IDT P1: GGAACCACGCTGACATTTGACACTG P2: CAAAGAACAACGAGTGGCAGTAG P3: CATCAGATACACTAGAGCTGG Prp Mouse qPCR, Sybr IDT F: TCC TGG CCA ATA ATG CTG CCA TTG R: AGC AGC CAT TCT CTC CTG TTT GAC 18S Mouse qPCR, Sybr IDT F: TTC CTT ACC TGG TTG ATC CTG CCA R: AGC CAT TCG CAG TTT CAC TGT ACC Wnt4 Mouse qPCR, Taqman ABI Mm01194003_m1 Bmp2 Mouse qPCR, Taqman ABI Mm01340178_m1 Atg16L1 Mouse qPCR, Taqman ABI Mm00513084_m1 18S Mouse qPCR, Taqman ABI 4318839 IGFBP1 Human qPCR, Taqman ABI Hs00236877_m1 PRL Human qPCR, Taqman ABI Hs00168730_m1 Open in a separate window All primer sequences are written 5’ to 3’ Abbreviations: ABI, Applied Biosystems; IDT, integrated DNA technologies; qPCR, quantitative polymerase chain reaction.

Techniques: Sequencing

Journal: Endocrinology

Article Title: The Autophagy Gene Atg16L1 is Necessary for Endometrial Decidualization

doi: 10.1210/endocr/bqz039

Figure Lengend Snippet: Knock down of ATG16L1 in human endometrial stromal cells impairs decidualization. A) Cellular morphology and B) quantitative PCR analysis of the decidualization marker IGFBP1 and PRL following transfection with control or ATG16L1 siRNA and hormonal stimulation. Data is normalized to 18S and expressed as fold change over Day 0 controls. Results are shown as mean ± standard error (SE) from 3 replicates of 1 patient-derived primary endometrial cell line. The experiment carried out on hESCs derived from 4 different individuals. (n = 4). Black arrowhead indicates fibroblast morphology and red arrowhead indicates decidualizing morphology. C) Immunoblotting of ATG16L1 and LC3B on the protein lysate from the hESCs collected at day 0 and day 6 after transfected with control or ATG16L1 siRNA. The GAPDH is used as an internal loading control; ****P < 0.0001.

Article Snippet: Mice were genotyped using RedTaq Polymerase (Sigma) Mix and the gene specific primers listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Gene name Species Application, Chemistry Company Sequence/Catalogue number ATG16L1 HM Mouse Genotyping IDT P1: TGGCTGGAGTGCGATCTTCC P2: CAGACGGCAAACGACTGTCCT P3: CAGGATCCTTCTGCACACATTT P4: CACCTGGTTACATTGGCAAACA PR Cre Mouse Genotyping IDT P1: ATG TTT AGC TGG CCC AAA TG P2: TAT ACC GAT CTC CCT GGA CG P3: CCC AAA GAG ACA CCA GGA AG Atg16L1 flox Mouse Genotyping IDT P1: GGAACCACGCTGACATTTGACACTG P2: CAAAGAACAACGAGTGGCAGTAG P3: CATCAGATACACTAGAGCTGG Prp Mouse qPCR, Sybr IDT F: TCC TGG CCA ATA ATG CTG CCA TTG R: AGC AGC CAT TCT CTC CTG TTT GAC 18S Mouse qPCR, Sybr IDT F: TTC CTT ACC TGG TTG ATC CTG CCA R: AGC CAT TCG CAG TTT CAC TGT ACC Wnt4 Mouse qPCR, Taqman ABI Mm01194003_m1 Bmp2 Mouse qPCR, Taqman ABI Mm01340178_m1 Atg16L1 Mouse qPCR, Taqman ABI Mm00513084_m1 18S Mouse qPCR, Taqman ABI 4318839 IGFBP1 Human qPCR, Taqman ABI Hs00236877_m1 PRL Human qPCR, Taqman ABI Hs00168730_m1 Open in a separate window All primer sequences are written 5’ to 3’ Abbreviations: ABI, Applied Biosystems; IDT, integrated DNA technologies; qPCR, quantitative polymerase chain reaction.

Techniques: Knockdown, Real-time Polymerase Chain Reaction, Marker, Transfection, Control, Derivative Assay, Western Blot