|
OriGene
anddsc2 primers Anddsc2 Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/10__1158_slash_1541___7786__mcr___22___0763-64-51-55?v=OriGene Average 91 stars, based on 1 article reviews
anddsc2 primers - by Bioz Stars,
2026-07
91/100 stars
|
Buy from Supplier |
|
OriGene
gtggtagtaaccaaagcatctgc Gtggtagtaaccaaagcatctgc, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc07385665-101-7-9?v=OriGene Average 92 stars, based on 1 article reviews
gtggtagtaaccaaagcatctgc - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
|
OriGene
myh7 Myh7, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc12141862-173-28-29?v=OriGene Average 93 stars, based on 1 article reviews
myh7 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
primer Primer, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm25762510-58-36-39?v=OriGene Average 90 stars, based on 1 article reviews
primer - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
cxcl9 ![]() Cxcl9, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/10__1172_slash_jci86953-272-1-11?v=OriGene Average 90 stars, based on 1 article reviews
cxcl9 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
n cadherin ![]() N Cadherin, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc12646010-218-7-14?v=OriGene Average 93 stars, based on 1 article reviews
n cadherin - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
mouse pfkfb3 ![]() Mouse Pfkfb3, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm28875330-63-3-8?v=OriGene Average 90 stars, based on 1 article reviews
mouse pfkfb3 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
bard1 Figures S4–S6 . " width="250" height="auto" />Bard1, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc09719099-81-0-2?v=OriGene Average 90 stars, based on 1 article reviews
bard1 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
hp204660 Figures S4–S6 . " width="250" height="auto" />Hp204660, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc12098778-468-12-14?v=OriGene Average 93 stars, based on 1 article reviews
hp204660 - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
OriGene
mir 203 Figures S4–S6 . " width="250" height="auto" />Mir 203, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pmc05118090-200-2-16?v=OriGene Average 90 stars, based on 1 article reviews
mir 203 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
mir675 specific upsteam primers ![]() Mir675 Specific Upsteam Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm26376677-245-24-28?v=OriGene Average 90 stars, based on 1 article reviews
mir675 specific upsteam primers - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
OriGene
cggttagcagtatgttgtccagc 30 origene n a primers ![]() Cggttagcagtatgttgtccagc 30 Origene N A Primers, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/primer+pairs/pm39753138-244-13-14?v=OriGene Average 92 stars, based on 1 article reviews
cggttagcagtatgttgtccagc 30 origene n a primers - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Journal of Clinical Investigation
Article Title: NLRC4 suppresses melanoma tumor progression independently of inflammasome activation
doi: 10.1172/jci86953
Figure Lengend Snippet: Figure 5. Absence of NLRC4 in macrophages alters the tumor cytokine and chemokine milieu. (A–F) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells. On day 12 after inoculation, total RNA was isolated from homogenized tumors and used to determine cytokine and chemokine expression via quantitative qPCR utilizing a PCR array. Selected genes from the array are displayed; data are pooled from 3 separate experiments (n = 3 mice per group). (G and H) WT and Nlrc4–/– mice were injected s.c. with 1 × 105 B16F10 cells; 14 days after inoculation, tumors were harvested, pooled, and FACS sorted based on CD45.2 and F4/80 staining. RNA was isolated from CD45.2- and CD45.2+F4/80+ cells and used to determine Cxcl9, Cxcl10, Cxcl13, and Cxcl16 expression by qPCR; data are representative of 2 independent experiments with n ≥ 5 pooled tumors per group. (I) WT and Nlrc4–/– BMDMs were challenged for 9 hours with B16F10 whole tumor homogenate. Cxcl9, Cxcl10, and Cxcl13 expression was determined by qPCR. Data are pooled from 3 independent experi- ments, and fold change in gene expression is relative to unstimulated samples. (J and K) WT and Nlrc4–/– BMDMs were challenged with 50 ng/ml LPS, 50 μg/ml LTA, 100 ng/ml FSL-1, and 1 μg/ml Pam3CSK4. Twenty hours later, supernatants were collected and levels of IL-6 (J) and IL-12p40 (K) determined by ELISA; data are representative of 3 independent experiments. (A–F and I) Error bars represent SEM. (J and K) Error bars represent SD. (I–K) *P ≤ 0.05, **P ≤ 0.01, and ***P ≤ 0.001, unpaired 2-tailed Student’s t test.
Article Snippet: Ifng,
Techniques: Injection, Isolation, Expressing, Staining, Gene Expression, Enzyme-linked Immunosorbent Assay
Journal: Pharmaceutical research
Article Title: Liposomes co-Loaded with 6-Phosphofructo-2-Kinase/Fructose-2, 6-Biphosphatase 3 (PFKFB3) shRNA Plasmid and Docetaxel for the Treatment of non-small Cell Lung Cancer.
doi: 10.1007/s11095-017-2244-x
Figure Lengend Snippet: Fig. 4 Impact of PSH-L at different doses of pshPFKFB3 on PFKFB3 mRNA expression in A549 cells. Bar graph depicts real-time RT-PCR expression of PFKFB3 as compared to untreated control cells. The results show mean of three independent experiments with SEM. NC-pDNA-L liposomes with 100 ng of NC-pDNA, LF2K100 = Lipofectamine-2000 complexed with pshPFKFB3 100 ng, PSH-L20, 40, 60 and 100 = PSH-L with 20 ng, 40 ng, 60 ng and 100 ng of pshPFKFB3.
Article Snippet: Q-PCR primers for
Techniques: Expressing, Quantitative RT-PCR, Control, Liposomes
Journal: Pharmaceutical research
Article Title: Liposomes co-Loaded with 6-Phosphofructo-2-Kinase/Fructose-2, 6-Biphosphatase 3 (PFKFB3) shRNA Plasmid and Docetaxel for the Treatment of non-small Cell Lung Cancer.
doi: 10.1007/s11095-017-2244-x
Figure Lengend Snippet: Fig. 8 A. Western blot densitometric analysis of PFKFB3, various cell survival markers, apoptotic markers and stress related markers. The results show mean of three independent experiments. * indicates p < 0.05 compared with untreated controls; ** indicates p < 0.01 compared to untreated controls.
Article Snippet: Q-PCR primers for
Techniques: Western Blot
Figures S4–S6 . " width="100%" height="100%">
Journal: iScience
Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
doi: 10.1016/j.isci.2022.105626
Figure Lengend Snippet: BRCA1 protein interacts with and ubiquitinates PERK and IRE1 (A–D) Total protein extracts were isolated from (A) control or BRCA1-depleted MCF7, (B) control or BRCA1-depleted MDA-MB-231cells, (C) MDA-MB-436 cells (+ or def), and (D) control, BRCA1 or BARD1 over-expressing MDA-MB-436 BRCA1-def cells. (E and F) Immunoprecipitation (IP) of BRCA1 protein pull-downs of PERK and IRE1 from MCF7 (E) or MDA-MB-231 (F) cytoplasmic protein extract. BRCA1 IB: ∗ = hyperphosphorylated BRCA1, ∗∗ = truncated BRCA1. ∗∗∗ = delta11q isoform. IRE1 IB: ∗ = possible ubiquitinated IRE1. (G and H) Ubiquitination analysis of PERK and IRE1 in (G) MCF7 cells or (H) MDA-MB-231 cells. Cells were transfected with control or BRCA1 siRNA. BRCA1 siRNA transfected cells were either untreated or treated with DMSO or Bortezomib overnight before harvesting for protein analysis. (I and J) In vitro ubiquitination analysis of (I) PERK or (J) IRE1 with E1, UBE2J1, BRCA1, BARD1, and/or ubiquitin. Ubiquitinated PERK or IRE1 was detected with an anti-Ub antibody. Ub = Ubiquitin. Bortz = Bortezomib. Data are represented as mean ± SD. P value was calculated by Student’s two-tailed, unpaired t -test. ∗ <0.05. See also
Article Snippet:
Techniques: Isolation, Control, Expressing, Immunoprecipitation, Ubiquitin Proteomics, Transfection, In Vitro, Two Tailed Test
Journal: iScience
Article Title: BRCA1 mediates protein homeostasis through the ubiquitination of PERK and IRE1
doi: 10.1016/j.isci.2022.105626
Figure Lengend Snippet:
Article Snippet:
Techniques: Virus, Recombinant, Ubiquitin Proteomics, Extraction, SYBR Green Assay, Isolation, Control, Plasmid Preparation, Software
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 1: miR675 promotes liver cancer cells proliferation A. a. (left) The photography of the Hep3B cell lines transfected with pCMV-mir or pCMV-miR675. (right)Real-time RT-PCR for mature miR675 in miR675 overexpressed or mock control Hep3B stable cell lines (3# and 6# clone) ;U6 as internal control ;Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05. b. Cell proliferation assay was performed in 96-well format using the CCK8 cells proliferation kit to determine the cell viability as described by the manufacturer. Each sample was assayed in triplicates for 3 days consecutively .Cell growth curve was based on the corresponding the relative values of OD450 and each point represents the mean of three independent samples. Data are means of value from three independent experiments, bar±SEM. **, P < 0.01 ;*, P < 0.05.c. (right)Cell plate colony formation ability assay. Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05 . (left)The photography of colonies from the cell lines indicated in left. B. a. (Left)Real-time RT-PCR for mature miR675 in miR675 knocked down or mock control Hep3B stable cell lines ;U6 as internal control; Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ). (right) The photography of the cell lines transfected with pGFP-V-RS or pGFP-V-RS-miR675.b.Cell proliferation assay was performed in 96-well format using the CCK8 cells proliferation kit to determine the cell viability as described by the manufacturer. Each sample was assayed in triplicates for 3 days consecutively.Cell growth curve was based on the corresponding values of OD450 and each point represents the mean of three independent samples. Data are means of value from three independent experiments , bar±SEM. **, P < 0.01 ;*, P < 0.05 .c. (right)Cell plate colony formation ability assay. Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05 . (left)The photography of colonies from the cell lines indicated in left. C. a. Real-time RT-PCR for mature miR675 in miR675 overexpressed or knocked-down HepG2 stable cell lines;U6 as internal control ;Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05. b. Cell proliferation assay was performed in 96-well format using the CCK8 cells proliferation kit to determine the cell viability as described by the manufacturer. Each sample was assayed in triplicates for 3 days consecutively .Cell growth curve was based on the corresponding the relative values of OD450 and each point represents the mean of three independent samples. Data are means of value from three independent experiments, bar±SEM. **, P < 0.01 ;*, P < 0.05.c. (left)Cell plate colony formation ability assay.Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05 . (right)The photography of colonies from the cell lines indicated in left . d. Cell BrdU assay.Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05 .
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Transfection, Quantitative RT-PCR, Control, Stable Transfection, Proliferation Assay, BrdU Staining
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 2: miR675 accelerates liver cancer cell growth in vivo A. a. The photography of xenograft tumors from Balb/C null mouse injected with Hep3B cells transfected with pCMV-miR or pCMV-miR675 subcutaneously at armpit.b. (left)The xenograft tumors formation ability (%) in two groups indicated in lower. (right)The xenograft tumors weight (gram) in two groups indicated in lower. Data were means of value from six Balb/c mice, mean±SEM, n = 6, *, P < 0.05;**, P < 0.01. c. A portion of each xenograft tumor was fixed in 4% formaldehyde and embedded in paraffin, and the micrometers of sections (4µm) were made for hematoxylin-eosin (HE) staining (original magnification×100). d.anti-PCNA immunostainning in xenograft tumor sample (6#). B. a. The photography of xenograft tumors from Balb/C null mouse injected with Hep3B cells transfected with pCMV-miR or pCMV-miR675 subcutaneously at armpit .b. The xenograft tumors weight (gram) in two groups indicated in left. Data were means of value from six Balb/c mice, mean±SEM, n = 6, *, P < 0.05;**, P < 0.01. c. A portion of each xenograft tumor was fixed in 4% formaldehyde and embedded in paraffin, and the micrometers of sections (4µm) were made for hematoxylin-eosin (HE) staining (original magnification×100). d. anti-PCNA immunostainning in xenograft tumor sample (pCMV-miR 2# and pCMV-miR675 2#). C. a. The photography of xenograft tumors from Balb/C null mouse injected with HepG2 cells transfected with pCMV-miR, pCMV-miR675 , pGFP-V-RS or pGFP-V-RS-miR675subcutaneously at armpit .b. The xenograft tumors weight (gram) in the four groups indicated in left. Data were means of value from six Balb/c mice, mean±SEM, n = 6, *, P < 0.05;**, P < 0.01. c. A portion of each xenograft tumor was fixed in 4% formaldehyde and embedded in paraffin, and the micrometers of sections (4µm) were made for hematoxylin-eosin (HE) staining (original magnification×100). d. anti-PCNA and anti-k67 immunostainning in xenograft tumor samples.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: In Vivo, Injection, Transfection, Staining
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 3: miR675 inhibits HP1 α, HP1 β, HP1 γ expression in human liver cancer cells. A. MirTarget bioinformatics analysis. a. Mir675 targets for human HP1 α 3’UTR ; b.Mir675 targets for huamn HP1 β 3’UTR;c.Mir675 targets for HP1 γ 3’UTR. B. HP1α, β, γ-3’-UTR-Luciferase activity assay. Hep3B cells were transfected with pMirTarget-control, pMirTarget-HP1α3’UTR, pMirTarget-mutant HP1α3’UTR, pMirTarget-HP1β3’UTR, pMirTarget-mutant HP1β3’UTR, pMirTarget-HP1γ3’UTR, pMirTarget-mutant HP1γ3’UTR, pCMV-miR , pCMV-miR675, pCMV-mutant miR675 respectively. Data are means of value from three independent experiment , bar±SEM. **, P < 0.01. C. Western blotting analysis using anti-HP1 α, anti-HP1β, anti-HP1γ in Hep3B cell lines transfected with pCMV-miR , pCMV-miR675, pGFP-V-RS-miR675, respectively.β-actin as internal control. D. Western blotting analysis using anti-HP1 α, anti-HP1β, anti-HP1γ in Hep3B cell lines transfected with pGFP-V-RS , pGFP-V-RS-miR675, respectively.β-actin as internal control. C.Western blotting analysis using anti-HP1 α, anti-HP1β, anti-HP1γ in Hep3B cell lines transfected with pCMV-miR , pCMV-miR675, pGFP-V-RS- miR675, respectively.β-actin as internal control. D.Western blotting analysis using anti-Cadherin 13 , anti-RUNX1 , anti-RB1 in Hep3B cell lines transfected with pCMV-miR , pCMV-miR675, respectively.β-actin as internal control.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Expressing, Luciferase, Activity Assay, Transfection, Control, Mutagenesis, Western Blot
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 4: miR675 enhances EGR1 via reducing HP1 α in human liver cancer cells. A. a.Co-Immunoprecipitation (IP) with anti-SUV39h1 followed by western blotting with anti-HP1α or anti-Histone3 in miR675 overexpressied and control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-HP1α. β-actin as internal control. b. Co-Immunoprecipitation (IP) with anti- SUV39h1 followed by western blotting with anti-HP1α or anti-Histone3 in miR675 knockdown and control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-HP1α. β-actin as internal control. B. a.Co-Immunoprecipitation (IP) wih anti-H3k27Ac followed by western blotting with anti-SUV39H1 in miR675 overexpressied, miR675 plus HP1α overexpressed and control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-SUV39h1. b.Co-Immunoprecipitation (IP) wih anti-H3k27Ac followed by western blotting with anti-SUV39H1 in miR675 knockdown control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-SUV39h1. C. a.Co-Immunoprecipitation (IP) with anti-SUZ12 followed by western blotting with anti-EZH2, anti-HP1α in miR675 overexpressied, miR675 plus HP1α overexpressed and control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-EZH2. b. Co-Immunoprecipitation (IP) wih anti-SUZ12 followed by western blotting with anti-EZH2, anti-HP1α in miR675 knockdown and control Hep3B. IgG IP as negative control. INPUT refers to western blotting with anti-EZH2. D. a. Real-time RT- PCR for mature miR675 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α respectively. U6 as internal control. b.Western blotting with anti-HP1α, anti-H3K9me3, anti-H3K27me3, anti-pHistone3, H3K27Ac, anti-H3K4me3 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. β-actin as internal control. c.Western blotting with anti-PKM2 in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. β-actin as internal control. d.Western blotting with anti-HP1α, anti-H3K9me3, anti-H3K27me3, anti-pHistone3, H3K27Ac, anti-H3K4me3 in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675 respectively. β-actin as internal control. e.Western blotting with anti-PKM2 in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675 respectively. β-actin as internal control. E. a.Chromatin Immunoprecipitation (CHIP) with anti-H3K9me3, anti-H3K27me3, anti-H3K27Ac and anti-HP1α followed by PCR with EGR1 promoter primers in miR675 overexpressied , miR675 pluc HP1α overexpressed and control Hep3B. IgG IP as negative control. IgG CHIP as negative control. EGR1 promoter DNA sequence as INPUT. EGR1 DNA** as negative control.b. Chromatin Immunoprecipitation (CHIP) with anti-H3K9me3, anti-H3K27me3, anti-H3K27Ac and anti-HP1α followed by real-time PCR with EGR1 promoter primers in miR675 overexpressied , miR675 pluc HP1α overexpressed and control Hep3B. F. EGR1 promoter luciferase activity assay in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. Each value was presented as mean±standard error of the mean (SEM). G. Western blotting with anti-EGR1 and CO-IP with anti-SUM (EGR1 IB) in Hep3B cells transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3-HP1α respectively. β-actin as internal control. H. Western blotting with anti-EGR1 and CO-IP with anti-SUM (EGR1 IB) in Hep3B cells transfected with pGFP-V-RS, pGFP-V-RS-miR675, pGFP- V-RS- HP1α respectively. β-actin as internal control.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Immunoprecipitation, Western Blot, Control, Negative Control, Knockdown, Quantitative RT-PCR, Transfection, Chromatin Immunoprecipitation, Sequencing, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Co-Immunoprecipitation Assay
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 5: miR675 upregulates H19 through EGR1 activation. A. informatices analysis:EGR1 site (5’-CGCCCCCGC-3’) and 5’-GCGGGGGCG-3’ on H19 promoter region. B. DNA pulldown with Biotin-EGR1 followed by Western blotting with anti-EGR1in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α.Histone as internal control.Biotin as INPUT. C. Chromatin Immunoprecipitation (CHIP) with anti-EGR1 followed by PCR with H19 promoter primers in Hep3B transfected with pCMV- miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α.IgG IP as negative control. H19 promoter DNA sequence as INPUT. D. H19 promoter luciferase activity assay in Hep3B cells transfected with pCMV6-entery, pCMV6-entry-EGR1, pGFP-V-RS-EGR1 respectively. Each value was presented as mean±standard error of the mean (SEM). E. Western blotting for EGR1 and RT-PCR analysis for H19 in Hep3B transfected with pCMV6-AC-GFP, pCMV6-AC-GFP-EGR1, pGFP-V-RS-EGR1 respectively. β-actin as internal control. F. H19 promoter luciferase activity assay in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1HP1α, pCMV- miR675 plus pcDNA3.1HP1αβγ, pCMV-miR675 plus pGFP-V-RS- EGR1, pCMV-miR plus pCMV6-entry-EGR1, pCMV-miR675 plus pCMV6-entry-EGR1 respectively. Each value was presented as mean±standard error of the mean (SEM). G. a.RT-PCR analysis for H19 in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1HP1α, pCMV-miR675 plus pcDNA3.1HP1αβγ, pCMV-miR675 plus pGFP-V-RS- EGR1, pCMV-miR plus pCMV6-entry-EGR1, pCMV-miR675 plus pCMV6-entry-EGR1 respectively. β-actin as internal control. b. RT-PCR analysis for H19 in Hep3B transfected with pGFP-V-RS, pGFP-V-RS--miR675 respectively. β-actin as internal control.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Activation Assay, Western Blot, Transfection, Control, Chromatin Immunoprecipitation, Negative Control, Sequencing, Luciferase, Activity Assay, Reverse Transcription Polymerase Chain Reaction
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 6: H19 upregulates and activates PKM2 to promote hepatocarcinogenesis A. a.real-time RT-PCR analysis for mature miR675 in Hep3B transfected with pCI-control, pCI-H19. U6 as internal control. b. real-time RT-PCR analysis for mature miR675 in HepG2 transfected with pCI-control, pCI-H19, pGFP-V-RS, pGFP-V-RS-H19 . U6 as internal control. B. RT-PCR analysis for H19 in Hep3B transfected with pCI-H19. β-actin as internal control. C. Cell proliferation assay was performed in 96-well format using the CCK8 cells proliferation kit to determine the cell viability as described by the manufacturer. Each sample was assayed in triplicates for 3 days consecutively. Cell growth curve was based on the corresponding the relative values of OD450 and each point represents the mean of three independent samples. Data are means of value from three independent experiments , bar±SEM. **, P < 0.01 ;*, P < 0.05 . D. Cell plate colony formation ability assay. Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05. E. S phase cells assay using BrdU. Each value was presented as mean±standard error of the mean (SEM). F. Tumorigenesis test in vivo. Xenograft weight are means of value from six Balb/C nude mice, bar±SEM. **, P < 0.01 ;*, P < 0.05 . G. RNA Immunoprecipitation (RIP) with anti-PKM2 followed by RT-PCR with H19 mRNA in Hep3B transfected with pCMV-miR, pCMV-miR675, pCMV-miR675 plus pcDNA3.1-HP1α. IgG IP as negative control. H19 cDNA sequence as INPUT. H. Western blotting analysis for PKM2 and its polymer in Hep3B transfected with pCI--H19. β-actin as internal control. I. Western blotting analysis for C-Myc, Pim1, H-Ras, CDK4, CyclinD1, RB and PCNA analysis in Hep3B transfected with pCI-H19. β-actin as internal control. J. C-myc, Ras, Pim1 , CyclinD1 and pRB promoter luciferase activity assay in Hep3B transfected with pCI-H19 respectively. Each value was presented as mean±standard error of the mean (SEM). K. Western blotting analysis for PKM2 and its polymer in Hep3B transfected with pGFP-V-RS, pGFP-V-RS-miR675, pGFP-V- RS-H19, pGFP-V-RS-EGR1, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-EGR1. β-actin as internal control. L. Western blotting analysis for H-Ras, C-Myc, CyclinD1 in Hep3B transfected with pCMV-mir, pCMV-miR675, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCI-H19 plus pGFP-V-RS-PKM2. β-actin as internal control.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Quantitative RT-PCR, Transfection, Control, Reverse Transcription Polymerase Chain Reaction, Proliferation Assay, In Vivo, RNA Immunoprecipitation, Negative Control, Sequencing, Western Blot, Polymer, Luciferase, Activity Assay
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 7: miR675 oncogenic action depends on PKM2 activity A. The representative analytic results of in situ hybridization for H19 and miR675, and immunohistochemistry staining for PKM2, HP1α, EGR1 in formalin-fixed, paraffin-embedded human liver cancer tissue (indicated with yellow Dotted circles) and their paired adjacent noncancerous tissues (indicated with Dotted red circles) from the same patient (DAB stainning, original magnification×100). B. Western blotting for PKM2 and RT-PCR analysis for H19 in HepG2 cell lines transfected with pCMV-miR, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V-RS-PKM2, pCCI-H19 plus pGFP-V- RS-PKM2. C. Cell proliferation assay was performed in 96-well format using the CCK8 cells proliferation kit to determine the cell viability as described by the manufacturer. Each sample was assayed in triplicates for 3 days consecutively .Cell growth curve was based on the corresponding the relative values of OD450 and each point represents the mean of three independent samples. Data are means of value from three independent experiments, bar±SEM. **, P < 0.01 ;*, P < 0.05. D. Cell plate colony formation ability assay.Data are means of value from three independent experiment , bar±SEM. **, P < 0.01 ;*, P < 0.05 . E. a. The photography of xenograft tumors from Balb/C nude mice injected with HepG2 cells transfected with pCMV-mir, pCMV-miR675 plus pGFP-V-RS-H19, pCMV-miR675 plus pGFP-V- RS-PKM2, pCI-H19 plus pGFP-V-RS-PKM2 subcutaneously at armpit .b. The xenograft tumors weight (gram) in two groups indicated in left. Data were means of value from six Balb/C nude mice, mean±SEM, n = 6, *, P < 0.05;**, P < 0.01.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Activity Assay, In Situ Hybridization, Immunohistochemistry, Staining, Formalin-fixed Paraffin-Embedded, Western Blot, Reverse Transcription Polymerase Chain Reaction, Transfection, Proliferation Assay, Injection
Journal: Oncotarget
Article Title: miR675 upregulates long noncoding RNA H19 through activating EGR1 in human liver cancer.
doi: 10.18632/oncotarget.5579
Figure Lengend Snippet: Figure 8: The schematic illustrates a model that miR675 is involved in the epigenetic regulation of H3K9me3 , H3K27me3 for gene expression in tumorigenesis. miR675 overexpression promotes and silencing miR675 attenuated liver cancer cell growth in vitro and in vivo. Mechanistically , miR675 decreases the heterochromatin protein HP1α, HP1β, HP1γ expression in human liver cancer cells which causes a marginal decrease of the total histone H3 lysine 9 trimethylation (H3K9me3) and total histone H3 lysine 27 trimethylation (H3K27me3) and a increase of total histone H3 lysine 27 acetylation (H3K27Ac). Notably, a significant reduction of H3K9me3 and H3K27me3 loading onto the promoter region of EGR1 which triggers EGR1 transcription, sumoylation and activation to upregulate H19, a large intergenic non-coding RNA (lincRNA).Intriguingly, H19 induces and activates tumor-specific pyruvate kinase M2 (PKM2) which is essential for the warburg effect in its dimer and for gene expression in its teramer during tumorigenesis.
Article Snippet: Real-time RT-PCRbased detection of mature miR-675 and U6 snRNA was achieved with the miRNA Detection kit (including a universe primer, U6 primers, Qiagen) and
Techniques: Gene Expression, Over Expression, In Vitro, In Vivo, Expressing, Activation Assay