Journal: bioRxiv

Article Title: TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancer

doi: 10.1101/2023.08.30.555468

Figure Lengend Snippet: Unbiased proteomics analysis was performed on total lysates from SQD9 cells with TIPRL1 WT expression or TIPRL indel mutation without irradiation or 4h, 24h and 48h after exposure to 6 Gy irradiation (n=1). The total amount of proteins loaded on LC-MS/MS in each condition was very similar, displaying a CV (variation coefficient) of 12% for the average, and of 19% for the standard deviation of the raw protein abundance between all 8 samples. A Heat map showing normalized protein abundances of all identified PP2A-like phosphatase-related proteins in the indicated cell lines and conditions. B – D Validation of expression of PP2A C ( B ), B55α ( C ) and PP6C ( D ) in TIPRL1_WT cells vs TIPRL1 indel_2 cells. Western blots of total lysates without irradiation, or 1h, 4h, 24h or 48h after exposure to 6 Gy were developed using a primary PP2A C, B55α and PP6C antibody. Ponceau was used as loading control. A representative blot is shown (upper panel). Quantifications represent mean ± SEM of n=3 (t-test, *: p<0.05) (lower panel). E – H Frequency distribution of the logarithms of normalized protein abundance ratios between TIPRL1_WT and TIPRL1 indel_2 cell lysates without ( E ) or 4h ( F ), 24h ( G ) and 48h ( H ) after exposure to 6 Gy irradiation. I Heat map showing normalized protein abundances of enriched genes (David functional annotation clustering analysis) after rank regression (p<0.05) with a negative slope of the regression line of normalized protein abundances obtained from TIPRL1_WT cells (4h, 24h and 48h post-RT).

Article Snippet: PP2A dimer was purchased from SignalChem (PP2Aα/PPP2R1A Active Complex, referred to as PP2AD).

Techniques: Expressing, Mutagenesis, Irradiation, Liquid Chromatography with Mass Spectroscopy, Standard Deviation, Quantitative Proteomics, Biomarker Discovery, Western Blot, Control, Functional Assay

Journal: bioRxiv

Article Title: TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancer

doi: 10.1101/2023.08.30.555468

Figure Lengend Snippet: A – D Protein lysates of non-irradiated (0 Gy) or irradiated (6 Gy) TIPRL1_WT (No Flag), Rescue TIPRL1_WT, Rescue TIPRL1_S265A and Rescue TIPRL1_S265D cells were prepared at indicated times post-RT, and subjected to anti-FLAG immunoprecipitation (IP). Representative blots of PP2A C ( A ), PP6C ( B ), DNA-PKcs ( C ) and RAD51 ( D ) expression and retrieval in the IPs in function of irradiation are shown (left panels). Lysate preparation and IPs were performed in the presence of PPIs (to preserve TIPRL1 S265 phosphorylation), except for ( A ) (to allow detection of the PP2A-TIPRL1 interaction). Corresponding quantifications (right panels) of TIPRL1–PP2A C binding (n=3, mean ± SEM, one-way ANOVA followed by Tukey’s multiple comparison) ( A ), TIPRL1–PP6C binding (n=3, mean ± SEM, one- way ANOVA followed by Tukey’s multiple comparison) ( B ), TIPRL1–DNA-PKcs binding (n=2, mean ± SEM) ( C ) and TIPRL1–RAD51 binding (n=2, mean ± SEM) ( D ) are shown.

Article Snippet: PP2A dimer was purchased from SignalChem (PP2Aα/PPP2R1A Active Complex, referred to as PP2AD).

Techniques: Irradiation, Immunoprecipitation, Expressing, Phospho-proteomics, Binding Assay, Comparison

Journal: bioRxiv

Article Title: TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancer

doi: 10.1101/2023.08.30.555468

Figure Lengend Snippet: Hypothesis shown for TIPRL1 WT ( A ), TIPRL1 S265A ( B ) and TIPRL1 S265D ( C ). The model implies two types of modifications that are both induced by RT (or, likely more general, by DSBs): a (not further investigated/specified) histone modification (M) and the newly identified ATM- dependent TIPRL1 phosphorylation at S265 (P). In the absence of both modifications (no RT), TIPRL1 does not bind any histones. In the presence of one of either modification (or D phosphomimic), binding is promoted. In the presence of both modifications, binding is inhibited. The model provides a rationale for TIPRL1 recruitment through (RT-induced, modified) histones in the vicinity of activated ATM, and for subsequent release of phosphorylated TIPRL1 from these sites. TIPRL1 interaction with DSB repair factors, DNA-PKcs (involved in Non-Homologous End Joining, NHEJ) and RAD51 (involved in Homologous Recombination repair, HR) appears not strictly affected by TIPRL1 S265 phosphorylation, but is increased by RT. If and how TIPRL1 might regulate the functions of the latter to promote DNA repair, and whether that involves inhibition of PP2A-like phosphatases PP2A, PP4 and/or PP6, remains an open question.

Article Snippet: PP2A dimer was purchased from SignalChem (PP2Aα/PPP2R1A Active Complex, referred to as PP2AD).

Techniques: Modification, Phospho-proteomics, Binding Assay, Non-Homologous End Joining, Homologous Recombination, Inhibition

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac activates JAK3/STAT5 signaling in human Tregs. Expanded human Tregs were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and cultured in SFM with anti-CD3/CD28 beads and IL-2 for 3 days before analysis. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B-D) Expression of PP2Ac in GFP+ cells was assessed at the mRNA and protein levels using qPCR (B), Western blotting (C), and flow cytometry (D) (n=3). (E) A representative immunoblot (left) and densitometry analysis of the resulting data (right) of protein extracts from transduced Tregs were probed for tyrosine-phosphorylated JAK3 (Tyr980/981), total JAK3, tyrosine-phosphorylated STAT5 (Tyr694), PP2Ac, and β-Tubulin (n=3). (F) IL-2-induced pSTAT5 dose-response curves of transduced Tregs (GFP+Foxp3+) (left) and nonlinear regression analysis of the binding data (middle) to determine EC50 (right) for IL-2-induced pSTAT5 activation (n=6). Data in plots are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B-F). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Transduction, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Flow Cytometry, Binding Assay, Activation Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression of PP2Ac upregulates IL-2-dependent genes in human Tregs. Tregs from different healthy adult donors (n=3) were expanded and lentiviral transduced in vitro. Total RNA was isolated from vector-transduced or PP2Ac-overexpressed Tregs 3 days after lentiviral transduction and analyzed by real-time qPCR. Data were normalized to the mRNA level in the control vector-transduced cells. The sample in each graph with the highest fold change is from the same donor.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, In Vitro, Isolation, Plasmid Preparation, Transduction

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Increased expression of CD25 induced by PP2Ac overexpression does not fully account for enhanced pSTAT5 activation. Expanded human Tregs from different healthy adult donors (n=4) were lentiviral transduced with control vector or a plasmid encoding PP2Ac, and analyzed 3 days later. (A) CD25 level of Foxp3+ GFP+ transduced Tregs. Numbers represent MFI of CD25 for the indicated cell population. (B) Representative gating strategy of FACS plots to identify transduced Tregs with a similar MFI of CD25 (represented in the P5 gate). (C) IL-2-induced pSTAT5 dose-response curves (left) of control or PP2Ac-overexpressed Tregs with similar CD25 levels, as shown in Fig. 5B. Nonlinear regression analysis of the binding data (middle) was conducted to determine the EC50 (right) for IL-2-induced pSTAT5. (D) MFI of pSTAT5 vs. CD25 levels in control and PP2Ac-overexpressed Tregs after stimulation with IL-2 (1 unit/mL) for 15 min (n=4). Representative gating strategy (left) and quantified data (right) where the MFI of CD25 was normalized to 1 based for the gated cell with the lowest amount of CD25. Data (C, D) are shown as means ± SEM and were analyzed by one-sample two-tailed t test (C) or a paired two-tailed t test (D). *P < 0.05, **P < 0.01, ****P<0.0001.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Expressing, Over Expression, Activation Assay, Transduction, Plasmid Preparation, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: PP2Ac increases survival, activation, and immunosuppressive function of human Tregs. Representative histograms (A) and quantitative evaluation (B) of expression of the indicated markers for control and PP2Ac-overexpressed Tregs (n=4). (C) In vitro suppression assay of CD8+ T cells (responders) by control or PP2Ac-overexpressed Tregs (n=3). Data (B, C) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B) or an unpaired two-tailed t test (C).*P < 0.05, **P < 0.01, ***P<0.001, ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Activation Assay, Expressing, In Vitro, Suppression Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Knockdown of PP2Ac reduces pSTAT5 response to IL-2 by human Tregs. Expanded human Tregs were lentiviral transduced with control or PP2Ac shRNA and analyzed after 3 days. (A) Transduction efficiency was assessed by the percentage of GFP+ cells. (B) Expression of PP2Ac was assessed by qPCR (n=3), western blotting (n=3), and flow cytometry (n=3) in control and PP2Ac knockdown Tregs. (C) FACS gating strategy for pSTAT5 activation analysis. Tregs transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency. Numbers represent MFI of PP2Ac for the indicated cell population. (D) IL-2-induced pSTAT5 dose-response curves (left) for the indicated group of Tregs shown in Fig. 7C (n=6). Nonlinear regression analysis of the binding data (middle) was used to determine EC50 (right) (E) Representative histograms (left) and quantitative evaluation (right) of pSTAT5 MFI for indicated cell population after treatment with 40 and 400 pM of IL-2 (n=6). The numbers represent MFI of the gated pSTAT5+ cells. (F) Representative histograms of IL-2R subunit expression on control and PP2Ac shRNA transduced Tregs. Data (B-E) are shown as means ± SEM and were analyzed by a one-sample two-tailed t test (B, D-E) or an unpaired two-tailed t test (D).*P < 0.05, **P < 0.01, ***P<0.001, ****P<0.0001, ns, not significant;

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Transduction, shRNA, Expressing, Western Blot, Flow Cytometry, Activation Assay, Binding Assay, Two Tailed Test

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: CD25 and protein phosphatase 2A cooperate to enhance IL-2R signaling in human regulatory T cells

doi: 10.4049/jimmunol.1801570

Figure Lengend Snippet: Overexpression and knockdown of PP2Ac does not alter pSTAT5 response to IL-2 by human Teff cells. (A-B) Expression of PP2Ac in freshly isolated Treg and TEM cells were assessed using Western blotting (n=3) (A) and flow cytometry (n=3) (B). (C) Quantification of the enzymatic activity of PP2A in freshly isolated Treg and TEM cells (n=3). (D, E) Transduction efficiency in vector-transduced and PP2Ac-overexpressed Teff cells (D) or in control and PP2Ac shRNA-transduced cells (E) was assessed by the percentage of GFP+ cells. (F, G) PP2Ac expression in control and PP2Ac-transduced overexpressed cells (F) or in control and PP2Ac shRNA knockdown cells (G) was assessed by flow cytometry (n=3). Teff cells transduced with PP2Ac shRNA were gated into two groups according to the knockdown efficiency and this gating strategy was used for pSTAT5 analysis in Fig. 8K. (H, I) Representative histograms for CD25 expression for control and PP2Ac-overexpressed (H) or for control and PP2Ac shRNA transduced Teff cells (I). The numbers in the FACS plots are the MFI of CD25 for the indicated cell populations. (J, K) IL-2-induced pSTAT5 dose-response curves (left) of control and PP2Ac-overexpressed (J) or control and PP2Ac shRNA transduced Teff cells (K). Nonlinear regression analysis of the binding data (middle) was performed to determine EC50 (right) (n=3). Data (A-C, F, G, J, K) are shown as the means ± SEM and were analyzed by a one-sample two-tailed t test (A-C, F, J, K).. *P < 0.05; ***P < 0.001; ns, not significant.

Article Snippet: The full coding sequences of human PP2Ac was PCR amplified from PP2Ac-alpha (PPP2CA) ( {"type":"entrez-nucleotide","attrs":{"text":"NM_002715","term_id":"1519312245","term_text":"NM_002715"}} NM_002715 ) human untagged clone (# SC321401, Origene, Rockville, MD) using the following primers: PPP2CA - cloning-for 5’- TATGGATCCATGGACGAGAAGGTGTTCACCAAGG-3’; PPP2CA - cloning-rev 5’- GTGTGGAATTCTTACAGGAAGTAGTCTGGGGTACGACG −3’.

Techniques: Over Expression, Expressing, Isolation, Western Blot, Flow Cytometry, Activity Assay, Transduction, Plasmid Preparation, shRNA, Binding Assay, Two Tailed Test

Journal: Journal of Clinical Investigation

Article Title: Dietary potassium stimulates Ppp1Ca-Ppp1r1a dephosphorylation of kidney NaCl cotransporter and reduces blood pressure

doi: 10.1172/jci158498

Figure Lengend Snippet: Figure 6. Potassium regulates PP1A interaction with and dephosphorylation of NCC. (A) In vitro protein phosphatase (PP) assay. Representative immu- noblots of p-NCC and t-NCC are shown for assays of NCC with PP1A (lanes 1 and 2), PP2A (lanes 5 and 6), and calcineurin A (CALNA) or vehicle (lanes 3, 7, and 11). For these studies, NCC was isolated by IP with an anti-NCC antibody (lanes 1, 2, 3, 5, 6, and 7) and compared with the negative control IgG (lanes 4, 8, and 12). (B) PP1A preferentially interacted with NCC in glutathione-agarose affinity chromatography assays with the GST fusion protein of the NCC terminus GST-NCC-(N), but not the negative control GST alone. Shown are representative immunoblot binding assays with recombinant PP1A, PP2A, and CALNA. Input protein phosphatase (lane 1) is shown relative to GST-bound (lane 2) or GST-NCC-(N) (lane 3). (C) A greater amount of PP1A co-immuno precipitated with NCC when the extracellular K+ concentration was high. Representative immunoblots show NCC, PP1A, and p-NCC (T58) in anti-FLAG immunoprecipitated samples relative to input from FLAG-tagged NCC-expressing MDCKI cells incubated with 3.5 mM (control), 0.5 mM (low), or 8 mM (high) K+ buffers. Low-chloride buffer was used as a positive control to elevate p-NCC (T58) levels. Graphs show semiquantitative assessment of NCC, PP1, and p-NCC (T58) in NCC immunoprecipitated samples (bottom, right) relative to input. Data are from 3 individual experiments with 3 replicates for each condition (n = 9). *P < 0.05, relative to the low-K+ condition, by 1-way ANOVA followed by multiple-comparison test. Data are presented as the mean ± SEM. CALNA, calcineurin.

Article Snippet: Eluate was incubated with either (a) 10 units of Protein Phosphatase 1 Catalytic Subunit, α-isoform (MilliporeSigma, catalog P7937; 6123.08 units/mg) and 1 mM MnCl2 in 1× PP1 reaction buffer (10 mM NaCl, 5 mM imidazole [pH 7.4], 0.2 mM DTT, 2.5‰Tween 20); (b) 25 ng PP2Aα (SignalChem, catalog P16-20BH) in 1× PP2 reaction buffer (25 mM HEPES [pH 7.2], 50 mM NaCl, 2.5 mM EDTA, 50 mM imidazole, 0.2% 2-mercaptolethanol, 65 ng/μL BSA); or (c) 10 units of PP3 (MilliporeSigma, catalog C1907), 1 mM MnCl2 and 10 μg/mL calmodulin (MilliporeSigma, catalog P0270) in 1× PP3 reaction buffer (50 mM Tris-HCl [pH 7.0], 50 μM CaCl2, 50 μg/mL BSA) at 30°C for 30 minutes.

Techniques: De-Phosphorylation Assay, In Vitro, Isolation, Negative Control, Affinity Chromatography, Western Blot, Binding Assay, Recombinant, Concentration Assay, Immunoprecipitation, Expressing, Incubation, Control, Positive Control, Comparison

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effect of okadaic acid (OA; 10 −9 M) on corticosteroid sensitivity (A), GR nuclear translocation (B), phosphorylation levels of GR-Ser 226 (C) and JNK1 (D) in U937 cells (n = 3–4). E: Effect of PP2A siRNA on IC 50 of dexamethasone on TNFα-induced IL-8 (n = 7). Values represent means ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT), * P <0.05.

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Translocation Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: Effects of IL-2/IL-4 co-treatment for 48 h on IC 50 of dexamethasone on TNFα-induced IL-8 release (A), PP2A C protein expression (B), immunoprecipitated PP2A (IP-P2A) activity (C), PP2A C -Tyr 307 phosphorylation(D), GR-Ser 226 phosphorylation (E) and JNK1 phosphorylation (F). Values represent means ± SEM (n = 3–4). # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: PP2A C protein expression (A), PP1 protein expression (B), immunoprecipitated PP2A (IP-PP2A) activity (C), phosophorylation levels of GR-Ser 226 (D) and PP2A C -Tyr 307 (F) in PBMCs from severe asthmatics (SA) and healthy volunteers (HV). E. Correlation between PP2A C expression and GR-Ser 226 phosphorylation. The dotted lines show 95% confidence interval. # P <0.05, ## P <0.01 (vs. HV).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Immunoprecipitation, Activity Assay

Journal: PLoS ONE

Article Title: Defects of Protein Phosphatase 2A Causes Corticosteroid Insensitivity in Severe Asthma

doi: 10.1371/journal.pone.0027627

Figure Lengend Snippet: (A) PP2A C and JNK1 expression in GR-immunoprecipitates. Expression levels of PP2A C in GR (B)- or JNK1 (D)-immunoprecipitates. PP2A activity in GR (C)- and JNK1 (E) immunoprecipitates were also determined. Values represent means of four experiments ± SEM. # P <0.05, ## P <0.01 (vs. non-treatment control; NT).

Article Snippet: 2 µg of DNA/plasmids (pCMV6 Entry, OriGene Technologies, Rockville, MD) containing the human PP2A catalytic subunit, alpha isoform (PP2A Cα ) gene were transfected to U937 cells pretreated with 50 ng/ml of PMA for 4 h. 20 h after the transfection, the medium was changed to the appropriate treatment in 1% FBS medium.

Techniques: Expressing, Activity Assay

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A) Loss of PME-1 suppresses whole cell PP2A activity. PP2A phosphatase activity was analyzed with phospho-peptides as a substrate and calculated as difference between samples ± 10 nM okadaic acid. N = 4. *: P <0.05 vs. WT. (B) Loss of PME-1 suppresses PP2A specific activity. PP2A specific phosphatase activity was analyzed with immunoprecipitation based PP2A activity assay. N = 4. *: P <0.05 vs. WT. (C-D) Loss of PME-1 enhances PP2Ac methylation. Cell lysates were treated with or without NaOH. The ratio of demethylated PP2Ac was determined by immunoblotting for demethylated PP2Ac (deMet PP2Ac). Representative picture (C) and quantitative data (D) from 3 independent experiments are shown. *: P <0.05 vs. WT.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Activity Assay, Immunoprecipitation, Methylation, Western Blot

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A-E) Loss of PME-1 affects specifically PP2Ac protein levels. Levels of proteins in wild type (WT) and PME-1 KO (KO) MEFs were determined by immunoblotting and representative images (A) and quantitative data for PP2Ac (B), PP2A A (C), PP4c (D), and PP6c (E) from 3 independent experiments are shown. *: P <0.05 vs. WT.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Western Blot

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A-B) Loss of PME-1 does not affect PP2Ac mRNA expression. mRNA levels of PP2Ac α (A) and β (B) isoforms were analyzed by real-time qPCR. Quantitative data from 2 independent experiments performed in duplicate are shown. (C-D) PME-1 protects PP2Ac from protein degradation. PP2Ac degradation was analyzed by cycloheximide chase assay. Representative images (C) and quantitative data for PP2Ac protein level (D) from 5 independent experiments are shown. *: P <0.05 vs. WT.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Expressing

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A) Loss of PME-1 enhances PP2Ac ubiquitination. FLAG-PP2Ac was transiently expressed by TetOn system in WT and PME-1 KO MEFs, and cells were treated with or without MG132 (10 μM) for 16 h. FLAG-PP2Ac was immunoprecipitated with FLAG-M2 beads, and ubiquitinated PP2Ac was detected by immunoblotting. Representative images from 2 independent experiments were shown. (B) K41R mutation of PP2Ac blocks PP2Ac ubiquitination. FLAG-PP2Ac WT and K41R mutants were transiently expressed by TetOn system in PME-1 KO MEFs, and cells were treated with or without MG132 (10 μM) for 16 h. FLAG-PP2Ac was immunoprecipitated with FLAG-M2 beads, and ubiquitinated PP2Ac was detected by immunoblotting. Representative images from 2 independent experiments were shown. (C) Proteasome inhibitor blocks PP2Ac degradation. PME-1 KO MEFs were treated with 25 μM cycloheximide with or without 10 μM MG132. Endogenous PP2Ac protein level was detected by immunoblotting. Representative images from 3 independent experiments were shown.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Ubiquitin Proteomics, Immunoprecipitation, Western Blot, Mutagenesis

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A) PME-1 inhibitor decreases PP2Ac protein levels. WT MEFs were treated with ABL127 (5 or 10 μM) for 48 hr and levels of proteins were determined by immunoblotting. Representative images (A) and quantitative data (B) from 4 independent experiments are shown. *: P <0.05 vs. ABL127 untreated. (C-D) Methyl esterase activity of PME-1 is required to maintain PP2Ac levels. PME-1 KO MEFs were expressed FLAG-PME-1 WT or S156A (methyl esterase dead), and levels of proteins were determined by immunoblotting. Empty vector was used as mock. Representative images (C) and quantitative data (D) from 3 independent experiments are shown. *: P <0.05 vs. FLAG-PME-1 WT expressed KO MEFs.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Western Blot, Activity Assay, Plasmid Preparation

Journal: PLoS ONE

Article Title: Protein Phosphatase Methyl-Esterase PME-1 Protects Protein Phosphatase 2A from Ubiquitin/Proteasome Degradation

doi: 10.1371/journal.pone.0145226

Figure Lengend Snippet: (A) Loss of PME-1 suppresses cell proliferation. Cell proliferation of wild type (WT) and PME-1 KO (KO) MEFs were determined by Cell Counting Kit-8. N = 4 *: P <0.05 vs. WT. (B-D) Effects of PME-1 KO on ERK1/2 and Akt phosphorylation. WT and KO MEFs were stimulated with EGF (50 ng/ml) for indicated time periods and ERK1/2 and Akt phosphorylation was determined by immunoblotting. Representative images (B) from 3 independent experiments, and quantitative data for phospho-ERK1/2 (C) and phosphoT308 Akt (D) are shown. *: P <0.05 vs. WT. (E-F) Loss of PME-1 enhances the association of PP2A AB55αC complex. FLAG-B55α or B56α were transiently expressed in WT and PME-1 KO MEFs, and immunoprecipitated with FLAG-M2 beads. Empty vector was used as mock. PP2Ac and A subunit association was detected by immunoblotting. Representative images from 3 independent experiments were shown.

Article Snippet: Antibodies were obtained from the indicated supplier: anti-PP2A A subunit (Santa Cruz Biotech, CA, USA, sc-6112), anti-PP4c (Bethyl, TX, USA), anti-phospho ERK1/2, anti-phospho Thr308 Akt, anti-total ERK1/2, anti-total Akt (Cell Signaling, MA, USA), anti-FLAG tag (Sigma, MO, USA), anti-ubiquitin (Life Sensors, PA, USA), anti-PME-1 (LifeSpan BioScience, WA, USA), anti-demethyl PP2Ac (Merck Millipore, MA, USA, 05–577), anti-total PP2Ac (Millipore, 07–324), anti-tubulin alpha (Thermo Scientific, MA, USA), p97/VCP (GeneTex, CA, USA).

Techniques: Cell Counting, Phospho-proteomics, Western Blot, Immunoprecipitation, Plasmid Preparation