poly Search Results


nebnext poly a mrna magnetic isolation module  (New England Biolabs)
99
New England Biolabs nebnext poly a mrna magnetic isolation module
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Nebnext Poly A Mrna Magnetic Isolation Module, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nebnext poly a mrna magnetic isolation module/product/New England Biolabs
Average 99 stars, based on 1 article reviews
nebnext poly a mrna magnetic isolation module - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
poly badge  (Merck & Co)
86
Merck & Co poly badge
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Poly Badge, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/poly badge/product/Merck & Co
Average 86 stars, based on 1 article reviews
poly badge - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
poly  (Shanghai Macklin Biochemical)
86
Shanghai Macklin Biochemical poly
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Poly, supplied by Shanghai Macklin Biochemical, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/poly/product/Shanghai Macklin Biochemical
Average 86 stars, based on 1 article reviews
poly - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier
poly i c  (Tocris)
95
Tocris poly i c
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Poly I C, supplied by Tocris, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/poly i c/product/Tocris
Average 95 stars, based on 1 article reviews
poly i c - by Bioz Stars, 2026-05
95/100 stars
  Buy from Supplier
gp repeats  (Proteintech)
93
Proteintech gp repeats
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Gp Repeats, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gp repeats/product/Proteintech
Average 93 stars, based on 1 article reviews
gp repeats - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier
parp1  (Proteintech)
96
Proteintech parp1
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Parp1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/parp1/product/Proteintech
Average 96 stars, based on 1 article reviews
parp1 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
3poly l lysine  (Beyotime)
99
Beyotime 3poly l lysine
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
3poly L Lysine, supplied by Beyotime, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3poly l lysine/product/Beyotime
Average 99 stars, based on 1 article reviews
3poly l lysine - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
equivalent purification column  (Bio-Rad)
99
Bio-Rad equivalent purification column
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Equivalent Purification Column, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/equivalent purification column/product/Bio-Rad
Average 99 stars, based on 1 article reviews
equivalent purification column - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier
vacuum poly prep columns  (Bio-Rad)
96
Bio-Rad vacuum poly prep columns
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Vacuum Poly Prep Columns, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vacuum poly prep columns/product/Bio-Rad
Average 96 stars, based on 1 article reviews
vacuum poly prep columns - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
human b poly s ctl  (Cellular Technology Ltd)
96
Cellular Technology Ltd human b poly s ctl
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Human B Poly S Ctl, supplied by Cellular Technology Ltd, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human b poly s ctl/product/Cellular Technology Ltd
Average 96 stars, based on 1 article reviews
human b poly s ctl - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier
poly didc poly di dc  (Santa Cruz Biotechnology)
94
Santa Cruz Biotechnology poly didc poly di dc
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Poly Didc Poly Di Dc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/poly didc poly di dc/product/Santa Cruz Biotechnology
Average 94 stars, based on 1 article reviews
poly didc poly di dc - by Bioz Stars, 2026-05
94/100 stars
  Buy from Supplier
perkin elmer 1000  (Revvity)
91
Revvity perkin elmer 1000
Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by <t>mRNA</t> signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.
Perkin Elmer 1000, supplied by Revvity, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/perkin elmer 1000/product/Revvity
Average 91 stars, based on 1 article reviews
perkin elmer 1000 - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

Image Search Results


Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Journal: bioRxiv

Article Title: A Yeast Two-Hybrid Protein Domain Screening Approach for Ebola Virus-Human Protein Interactions Identifies PABPC1 as a Host Factor Required for Replication

doi: 10.64898/2026.03.05.709814

Figure Lengend Snippet: Inhibition of PABPC1 expression reduces EBOV replication. HeLa cells were mock-transfected (reagent only) or transfected with two distinct PABPC1 siRNAs or nontargeting AllStars negative control siRNAs. At 48 h post-transfection, cells were infected with EBOV at an MOI of 0.1. A.) At 16 hpi, samples were inactivated in 10% neutral-buffered formalin and RNAFISH was performed using probes detecting (+) sense NP and VP35 RNA (magenta). Nuclei were visualized by staining with Hoechst (blue). Scale bar = 250 μM. B.) Quantification of NP and VP35 RNA staining in panel A was performed in ImageJ by calculating the area occupied by mRNA signal and normalizing it to the area occupied by Hoechst (nuclei) signal. C.) In a parallel set of samples, total RNA was isolated by lysing the cells with Trizol reagent at 16 hours post infection. NP RNA levels were quantified by one-step RT-qPCR using a (+) sense NP probe to detect EBOV RNA and are normalized to the level of β-Actin RNA. D) Depletion of PABPC1 in siRNA-treated cells. A parallel set of samples were subjected to SDS-PAGE followed by western blotting with PABPC1 and actin antibodies. Molecular weight markers in kDa are shown at left.

Article Snippet: Unidirectional cDNA was prepared from 1 μg of total RNA using the NEBNext® UltraTM Directional RNA Library Prep Kit for Illumina following the “Protocol for use with NEBNext Poly(A) mRNA Magnetic Isolation Module (NEB #E7490)” through step 1.7 (Manual Version 5.0 5/15) with the following changes: 1) poly(A)+ mRNA was eluted for 5 minutes at 65 °C to prevent fragmentation; 2) after synthesizing second strand cDNA, the cDNA was purified using a Zymo Research DNA Clean & Concentrator-5 column (#D4013); 3) the adaptor primer (/5Phos/GATCGGAAGAGCTTGTTCTACCGAGGGACCC/ideoxyU/ ACTACTGCCTAAC GAACTCCCGCTCTTCCGATC*T; * indicates a phosphorothioate bond; synthesized and PAGE purified by IDT) was a modification of the NEBNext Adaptor for Illumina (E7352A).

Techniques: Inhibition, Expressing, Transfection, Negative Control, Infection, Staining, Isolation, Quantitative RT-PCR, SDS Page, Western Blot, Molecular Weight