Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) Sequence alignments of miR-122 with 3’UTR of AKT3 from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Sequencing, Luciferase, Reporter Assay, Expressing, Plasmid Preparation, Transfection, Construct, Activity Assay, Binding Assay

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) The AKT3 transcript level normalized to its expression in normal liver (right Y axis) and normalized miR-122 expression (left Y axis) were measured in various HCC cell lines. ( B ) The relative expression level of closely homologous isoforms AKT1 and AKT2 were measured in HCC cell lines. ( C ) Western blot analysis of total AKT and AKT3 protein levels in various HCC cell lines. Actin was used as the loading control in these studies.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Western Blot, Control

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) AKT3 mRNA and protein levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone. The membrane blot of the Huh-7 cells required unusually long exposures before the AKT3 bands could be visualized. ( B ) AKT1 and AKT2 transcript levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Membrane

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. ( A ) Cell migration assays were performed on SNU-182 or Huh-7 cells over-expressing miR-122 GFP or GFP alone. Migratory responses to the bottom chamber with and without addition of stimulator (10% HGF) are shown. ( B ) Cell migration assays were performed using miR-122-GFP or GFP alone over-expressing SNU-182 cells with or without AKT3 reconstitution. ( C ) Phosphorylation of BAD, total BAD level and cleaved caspase 3 were measured in SNU-182 and Huh-7 cells over-expressing miR-122-GFP or GFP alone. ( D ) Transient reconstitution effects of AKT3 in SNU-182 cells over-expressing miR-122-GFP or GFP alone were also measured. Statistical significance between the indicated groups is depicted as *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Migration, Phospho-proteomics

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: Cell proliferation was measured in (A) SNU-182 and (C) Huh-7 parental cells and cells stably over-expressing miR-122-GFP or GFP alone. (B) Cell proliferation was measured in SNU-182 cells over-expressing miR-122-GFP or GFP with or without the reconstitution of AKT3 expression. (D) Nude mice were implanted with SNU-182 parental lines as well as cells over-expressing miR-122-GFP or GFP vector alone, and tumor growth was monitored and plotted as tumor volume (mm 3 ) over time. Statistical significance between the indicated groups are depicted as ** P <0.01, and *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Plasmid Preparation

Journal: OncoTargets and Therapy

Article Title:

Antitumor Effect of miR-1294/Pyruvate Kinase M2 Signaling Cascade in Osteosarcoma Cells

doi: 10.2147/ott.s232718

Figure Lengend Snippet: Figure 4 PKM2 was a target of miR-1294 in osteosarcoma cells. (A) PKM2 expression in human mesenchymal stem cells (hMSCs) and five osteosarcoma cell lines (Saos-2, MG63, U2OS, HOS, and 143B) was assessed by real-time PCR. (B) The miR-1294 binding site predictions for PKM2 3ʹUTR by microRNA.org. (C) A dual luciferase reporter assay was performed to confirm the binding in 293T cells. (D and E) PKM2 expression in U2OS and HOS cells transfected with miR-1294 mimic by real-time PCR and Western blot assays. (F and G) PKM2 expression in 143B cells transfected with miR-1294 inhibitor by real-time PCR and Western blot assays. Data are shown as mean ± SD. ∗P < 0.05, ∗∗∗P < 0.001.

Article Snippet: After dewaxing with xylene and rehydration with gradient ethanol, the sections were subjected to antigen retrieval and incubation with one of the primary antibodies against c-Myc (1:200; Proteintech), cyclin D1 (1:200; Boster), MMP2; (1:200; Proteintech), MMP-9 (1:200; Proteintech), and PKM2 (1:200; Proteintech) overnight at 4°C.

Techniques: Expressing, Real-time Polymerase Chain Reaction, Binding Assay, Luciferase, Reporter Assay, Transfection, Western Blot

Journal: OncoTargets and Therapy

Article Title:

Antitumor Effect of miR-1294/Pyruvate Kinase M2 Signaling Cascade in Osteosarcoma Cells

doi: 10.2147/ott.s232718

Figure Lengend Snippet: Figure 5 Overexpression of PKM2 reversed the actions of miR-1294 upregulation on osteosarcoma cells. (A) Cell proliferation was evaluated by CCK-8 assay. (B) Cell apoptosis was examined by flow cytometry using Annexin Vand PI staining. (C) Cell migration was assessed by a wound-healing assay. (D) Cell invasiveness was determined by transwell assay. (E) Expression levels of c-Myc, cyclin D1, cleaved-caspase 3, MMP-2, and MMP-9 were texted by Western blotting. Data are shown as mean ± SD. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

Article Snippet: After dewaxing with xylene and rehydration with gradient ethanol, the sections were subjected to antigen retrieval and incubation with one of the primary antibodies against c-Myc (1:200; Proteintech), cyclin D1 (1:200; Boster), MMP2; (1:200; Proteintech), MMP-9 (1:200; Proteintech), and PKM2 (1:200; Proteintech) overnight at 4°C.

Techniques: Over Expression, CCK-8 Assay, Cytometry, Staining, Migration, Wound Healing Assay, Transwell Assay, Expressing, Western Blot

Journal: OncoTargets and Therapy

Article Title:

Antitumor Effect of miR-1294/Pyruvate Kinase M2 Signaling Cascade in Osteosarcoma Cells

doi: 10.2147/ott.s232718

Figure Lengend Snippet: Figure 6 Overexpression of miR-1294 inhibited tumorigenicity of osteosarcoma cells. (A, B) Tumor volume in nude mice after subcutaneous injection of ME63 and U2O2 cells with or without overexpression of miR-1294. (C) The expression of miR-1294 in tumor tissues was determined by real-time PCR. (D, E) The expression of PKM2, c-Myc, cyclin D1, MMP-2, and MMP-9 in tumor tissues was assessed using immunohistochemistry and Western blot analysis. Data are shown as mean ± SD from 6 mice/ group. ∗P < 0.05, ∗∗∗P < 0.001.

Article Snippet: After dewaxing with xylene and rehydration with gradient ethanol, the sections were subjected to antigen retrieval and incubation with one of the primary antibodies against c-Myc (1:200; Proteintech), cyclin D1 (1:200; Boster), MMP2; (1:200; Proteintech), MMP-9 (1:200; Proteintech), and PKM2 (1:200; Proteintech) overnight at 4°C.

Techniques: Over Expression, Injection, Expressing, Real-time Polymerase Chain Reaction, Immunohistochemistry, Western Blot