pk Search Results


99
Hamilton Company 33 gauge needle
33 Gauge Needle, supplied by Hamilton Company, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/bio_rxiv__64898__2026__04__24__718784-70-14-16?v=Hamilton+Company
Average 99 stars, based on 1 article reviews
33 gauge needle - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
ATCC pk15 cells
Pk15 Cells, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pm41617085-173-15-17?v=ATCC
Average 96 stars, based on 1 article reviews
pk15 cells - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Hamilton Company syringe
Syringe, supplied by Hamilton Company, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/bio_rxiv__64898__2026__04__30__722028-220-38-39?v=Hamilton+Company
Average 99 stars, based on 1 article reviews
syringe - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
Vector Laboratories vectastain elite abc kit
Vectastain Elite Abc Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pm42025166-751-39-43?v=Vector+Laboratories
Average 96 stars, based on 1 article reviews
vectastain elite abc kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
Vector Laboratories vectastain elite abc hrp reagent
Vectastain Elite Abc Hrp Reagent, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/10__1093_slash_jbmrpl_slash_ziag063-68-23-29?v=Vector+Laboratories
Average 99 stars, based on 1 article reviews
vectastain elite abc hrp reagent - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

96
Vector Laboratories vector laboratory kit
Vector Laboratory Kit, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pmc13124509-99-28-28?v=Vector+Laboratories
Average 96 stars, based on 1 article reviews
vector laboratory kit - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

94
Carna Inc kinase enzyme
Kinase Enzyme, supplied by Carna Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/us08119812-298-10-17?v=Carna+Inc
Average 94 stars, based on 1 article reviews
kinase enzyme - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
OriGene akt3 3 utr
( A ) Sequence alignments of miR-122 with 3’UTR of <t>AKT3</t> from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.
Akt3 3 Utr, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pmc03820664-143-30-16?v=OriGene
Average 90 stars, based on 1 article reviews
akt3 3 utr - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

92
Matrigen Life Technologies microbeads
( A ) Sequence alignments of miR-122 with 3’UTR of <t>AKT3</t> from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.
Microbeads, supplied by Matrigen Life Technologies, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pm34976230-793-29-30?v=Matrigen+Life+Technologies
Average 92 stars, based on 1 article reviews
microbeads - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

94
Matrigen Life Technologies hydrogels 25 kpa
( A ) Sequence alignments of miR-122 with 3’UTR of <t>AKT3</t> from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.
Hydrogels 25 Kpa, supplied by Matrigen Life Technologies, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pmc13135401-218-5-5?v=Matrigen+Life+Technologies
Average 94 stars, based on 1 article reviews
hydrogels 25 kpa - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

xyl2  (ATCC)
96
ATCC xyl2
Candida tropicalis strains used in this study
Xyl2, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pmc01489653-105-7-12?v=ATCC
Average 96 stars, based on 1 article reviews
xyl2 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

96
ATCC porcine kidney pk 15
Candida tropicalis strains used in this study
Porcine Kidney Pk 15, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pk/pm41773859-86-11-14?v=ATCC
Average 96 stars, based on 1 article reviews
porcine kidney pk 15 - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


( A ) Sequence alignments of miR-122 with 3’UTR of AKT3 from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) Sequence alignments of miR-122 with 3’UTR of AKT3 from 3 mammalian species shows partial complementarity. ( B ) Schematic representation describing the 3’UTR luciferase reporter assay. The assay was carried out simultaneously in SNU-182 and Huh-7 cells, over-expressing miR-122 GFP or the GFP vector alone, as well as parental cells co-transfected with the pGL3-3’UTR construct containing AKT3 3’UTR. Luciferase assays were performed 48 hours after transfection using the Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity to account for variations in transfection efficiency. Firefly luciferase activity will be reduced if there is a direct binding between miR-122 and the 3’UTR of AKT3 sequence inserted in the vector. ( C ) Luciferase activity was measured in SNU-182 and Huh-7 parental, miR-122-GFP and GFP over-expressing cells transfected with the luciferase reporter 3’UTR construct or vector alone. Results represent at least three different independent experiments, and statistical significance between indicated groups is depicted as ** P <0.01, *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Sequencing, Luciferase, Reporter Assay, Expressing, Plasmid Preparation, Transfection, Construct, Activity Assay, Binding Assay

( A ) The AKT3 transcript level normalized to its expression in normal liver (right Y axis) and normalized miR-122 expression (left Y axis) were measured in various HCC cell lines. ( B ) The relative expression level of closely homologous isoforms AKT1 and AKT2 were measured in HCC cell lines. ( C ) Western blot analysis of total AKT and AKT3 protein levels in various HCC cell lines. Actin was used as the loading control in these studies.

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) The AKT3 transcript level normalized to its expression in normal liver (right Y axis) and normalized miR-122 expression (left Y axis) were measured in various HCC cell lines. ( B ) The relative expression level of closely homologous isoforms AKT1 and AKT2 were measured in HCC cell lines. ( C ) Western blot analysis of total AKT and AKT3 protein levels in various HCC cell lines. Actin was used as the loading control in these studies.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Western Blot, Control

( A ) AKT3 mRNA and protein levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone. The membrane blot of the Huh-7 cells required unusually long exposures before the AKT3 bands could be visualized. ( B ) AKT1 and AKT2 transcript levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone.

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: ( A ) AKT3 mRNA and protein levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone. The membrane blot of the Huh-7 cells required unusually long exposures before the AKT3 bands could be visualized. ( B ) AKT1 and AKT2 transcript levels were measured in SNU-182 and Huh-7 cells stably over-expressing miR-122-GFP or GFP alone.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Membrane

These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. ( A ) Cell migration assays were performed on SNU-182 or Huh-7 cells over-expressing miR-122 GFP or GFP alone. Migratory responses to the bottom chamber with and without addition of stimulator (10% HGF) are shown. ( B ) Cell migration assays were performed using miR-122-GFP or GFP alone over-expressing SNU-182 cells with or without AKT3 reconstitution. ( C ) Phosphorylation of BAD, total BAD level and cleaved caspase 3 were measured in SNU-182 and Huh-7 cells over-expressing miR-122-GFP or GFP alone. ( D ) Transient reconstitution effects of AKT3 in SNU-182 cells over-expressing miR-122-GFP or GFP alone were also measured. Statistical significance between the indicated groups is depicted as *** P <0.005.

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: These miR122 induced anti-tumor activities were rescued by ectopic expression of AKT3. ( A ) Cell migration assays were performed on SNU-182 or Huh-7 cells over-expressing miR-122 GFP or GFP alone. Migratory responses to the bottom chamber with and without addition of stimulator (10% HGF) are shown. ( B ) Cell migration assays were performed using miR-122-GFP or GFP alone over-expressing SNU-182 cells with or without AKT3 reconstitution. ( C ) Phosphorylation of BAD, total BAD level and cleaved caspase 3 were measured in SNU-182 and Huh-7 cells over-expressing miR-122-GFP or GFP alone. ( D ) Transient reconstitution effects of AKT3 in SNU-182 cells over-expressing miR-122-GFP or GFP alone were also measured. Statistical significance between the indicated groups is depicted as *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Expressing, Migration, Phospho-proteomics

Cell proliferation was measured in (A) SNU-182 and (C) Huh-7 parental cells and cells stably over-expressing miR-122-GFP or GFP alone. (B) Cell proliferation was measured in SNU-182 cells over-expressing miR-122-GFP or GFP with or without the reconstitution of AKT3 expression. (D) Nude mice were implanted with SNU-182 parental lines as well as cells over-expressing miR-122-GFP or GFP vector alone, and tumor growth was monitored and plotted as tumor volume (mm 3 ) over time. Statistical significance between the indicated groups are depicted as ** P <0.01, and *** P <0.005.

Journal: PLoS ONE

Article Title: miR-122 Regulates Tumorigenesis in Hepatocellular Carcinoma by Targeting AKT3

doi: 10.1371/journal.pone.0079655

Figure Lengend Snippet: Cell proliferation was measured in (A) SNU-182 and (C) Huh-7 parental cells and cells stably over-expressing miR-122-GFP or GFP alone. (B) Cell proliferation was measured in SNU-182 cells over-expressing miR-122-GFP or GFP with or without the reconstitution of AKT3 expression. (D) Nude mice were implanted with SNU-182 parental lines as well as cells over-expressing miR-122-GFP or GFP vector alone, and tumor growth was monitored and plotted as tumor volume (mm 3 ) over time. Statistical significance between the indicated groups are depicted as ** P <0.01, and *** P <0.005.

Article Snippet: The entire 3′UTR of the hsa-AKT3 gene was amplified from a human cDNA clone obtained from Origene using the following primers incorporating the Nhe I and Sal I restriction sites: AKT3 3′UTR forward, CGGCTAGCCGCGTCTCTTTCATTCTGCTACTTCACTGTC ; AKT3 3′UTR reverse, CCGGTCGACCGCTTCACTCAGGTAGAAATATGAAAAAGAAGG .

Techniques: Stable Transfection, Expressing, Plasmid Preparation

Candida tropicalis strains used in this study

Journal:

Article Title: Production of Xylitol from d -Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

doi: 10.1128/AEM.02699-05

Figure Lengend Snippet: Candida tropicalis strains used in this study

Article Snippet: Strain Genotype a Presence or absence of XYL2 ( XYL2/XYL2 ) b ATCC 20336 URA3/URA3 XYL2/XYL2 +/+ ATCC 20913 ura3/ura3 XYL2/XYL2 +/+ BSXDH-1 ura3/ura3 xyl2 Δ:: HUH/XYL2 −/+ BSXDH-2 ura3/ura3 xyl2 Δ:: hisG/XYL2 −/+ BSXDH-3 ura3/ura3 xyl2 Δ:: hisG/xyl2 Δ:: URA3 −/− Open in a separate window a Abbreviations: XYL2 , xylitol dehydrogenase gene; HUH , hisG-URA3-hisG . b +, presence of XYL2 ; −, absence of XYL2 .

Techniques:

Sequential gene disruption of XYL2 in C. tropicalis. (A) Physical maps of the disruption cassettes. (B) PCR confirmation of the specific integration of the first disruption cassette, where lanes 1 and 2 indicate PCR with primers XDH-F3 and HisG-F1 for amplification of 1.5 kb and lanes 3 and 4 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 2.6 kb. Lanes 1 and 3 represent the host strain, C. tropicalis ATCC 20913, lanes 2 and 4 represent BSXDH-1, and lane M represents the markers. (C) PCR confirmation of URA3 marker gene pop-out, where lanes 1 and 2 indicate PCR with primers XDH-F3 and HisG-F1 for amplification of 1.5 kb and lanes 3 and 4 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 2.6 kb. Lanes 1 and 3 represent BSXDH-1, lanes 2 and 4 represent BSXDH-2, and lane M represents the markers. (D) PCR confirmation of the specific integration of the second disruption cassette, where lanes 1 and 2 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 1.6 kb. Lane 1 represents BSXDH-2, lane 2 represents BSXDH-3, and lane M represents the markers.

Journal:

Article Title: Production of Xylitol from d -Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

doi: 10.1128/AEM.02699-05

Figure Lengend Snippet: Sequential gene disruption of XYL2 in C. tropicalis. (A) Physical maps of the disruption cassettes. (B) PCR confirmation of the specific integration of the first disruption cassette, where lanes 1 and 2 indicate PCR with primers XDH-F3 and HisG-F1 for amplification of 1.5 kb and lanes 3 and 4 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 2.6 kb. Lanes 1 and 3 represent the host strain, C. tropicalis ATCC 20913, lanes 2 and 4 represent BSXDH-1, and lane M represents the markers. (C) PCR confirmation of URA3 marker gene pop-out, where lanes 1 and 2 indicate PCR with primers XDH-F3 and HisG-F1 for amplification of 1.5 kb and lanes 3 and 4 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 2.6 kb. Lanes 1 and 3 represent BSXDH-1, lanes 2 and 4 represent BSXDH-2, and lane M represents the markers. (D) PCR confirmation of the specific integration of the second disruption cassette, where lanes 1 and 2 indicate PCR with primers XDH-R3 and Ura3-R for amplification of 1.6 kb. Lane 1 represents BSXDH-2, lane 2 represents BSXDH-3, and lane M represents the markers.

Article Snippet: Strain Genotype a Presence or absence of XYL2 ( XYL2/XYL2 ) b ATCC 20336 URA3/URA3 XYL2/XYL2 +/+ ATCC 20913 ura3/ura3 XYL2/XYL2 +/+ BSXDH-1 ura3/ura3 xyl2 Δ:: HUH/XYL2 −/+ BSXDH-2 ura3/ura3 xyl2 Δ:: hisG/XYL2 −/+ BSXDH-3 ura3/ura3 xyl2 Δ:: hisG/xyl2 Δ:: URA3 −/− Open in a separate window a Abbreviations: XYL2 , xylitol dehydrogenase gene; HUH , hisG-URA3-hisG . b +, presence of XYL2 ; −, absence of XYL2 .

Techniques: Disruption, Amplification, Marker

Physiological and enzymatic confirmation of XYL2 disruption. (A) Growth of the parental strain and the XYL2-disrupted mutants on minimal medium with d-xylose as a sole carbon and energy source. Strains are indicated as follows: 1, C. tropicalis ATCC 20913; 2, BSXDH-2; 3, BSXDH-3; and 4 to 8, other transformants of the second disruption. (B) Assay of XDH and XR activities in each strain. Black bars indicate specific activity of XDH, and gray and white bars represent specific activity of XR with NADPH or NADH as the cofactor, respectively.

Journal:

Article Title: Production of Xylitol from d -Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

doi: 10.1128/AEM.02699-05

Figure Lengend Snippet: Physiological and enzymatic confirmation of XYL2 disruption. (A) Growth of the parental strain and the XYL2-disrupted mutants on minimal medium with d-xylose as a sole carbon and energy source. Strains are indicated as follows: 1, C. tropicalis ATCC 20913; 2, BSXDH-2; 3, BSXDH-3; and 4 to 8, other transformants of the second disruption. (B) Assay of XDH and XR activities in each strain. Black bars indicate specific activity of XDH, and gray and white bars represent specific activity of XR with NADPH or NADH as the cofactor, respectively.

Article Snippet: Strain Genotype a Presence or absence of XYL2 ( XYL2/XYL2 ) b ATCC 20336 URA3/URA3 XYL2/XYL2 +/+ ATCC 20913 ura3/ura3 XYL2/XYL2 +/+ BSXDH-1 ura3/ura3 xyl2 Δ:: HUH/XYL2 −/+ BSXDH-2 ura3/ura3 xyl2 Δ:: hisG/XYL2 −/+ BSXDH-3 ura3/ura3 xyl2 Δ:: hisG/xyl2 Δ:: URA3 −/− Open in a separate window a Abbreviations: XYL2 , xylitol dehydrogenase gene; HUH , hisG-URA3-hisG . b +, presence of XYL2 ; −, absence of XYL2 .

Techniques: Disruption, Activity Assay

Xylitol production by the  XYL2  -disrupted mutant BSXDH-3 in a medium with 50 g liter −1 xylose and various cosubstrates at a concentration of 10 g liter −1

Journal:

Article Title: Production of Xylitol from d -Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

doi: 10.1128/AEM.02699-05

Figure Lengend Snippet: Xylitol production by the XYL2 -disrupted mutant BSXDH-3 in a medium with 50 g liter −1 xylose and various cosubstrates at a concentration of 10 g liter −1

Article Snippet: Strain Genotype a Presence or absence of XYL2 ( XYL2/XYL2 ) b ATCC 20336 URA3/URA3 XYL2/XYL2 +/+ ATCC 20913 ura3/ura3 XYL2/XYL2 +/+ BSXDH-1 ura3/ura3 xyl2 Δ:: HUH/XYL2 −/+ BSXDH-2 ura3/ura3 xyl2 Δ:: hisG/XYL2 −/+ BSXDH-3 ura3/ura3 xyl2 Δ:: hisG/xyl2 Δ:: URA3 −/− Open in a separate window a Abbreviations: XYL2 , xylitol dehydrogenase gene; HUH , hisG-URA3-hisG . b +, presence of XYL2 ; −, absence of XYL2 .

Techniques: Mutagenesis, Concentration Assay, Produced