pik3ip1 Search Results


94
Genecopoeia window quantitative rt pcr transfection human pik3ip1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Window Quantitative Rt Pcr Transfection Human Pik3ip1, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc10068965-106-28-38?v=Genecopoeia
Average 94 stars, based on 1 article reviews
window quantitative rt pcr transfection human pik3ip1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology glua4
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Glua4, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc04024218-212-52-55?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
glua4 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti pik3ip1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Anti Pik3ip1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc05903572__NIHMS957806___supplement___2-269-50-51?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
anti pik3ip1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

93
Proteintech pik3ip1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Pik3ip1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc10068965-96-5-7?v=Proteintech
Average 93 stars, based on 1 article reviews
pik3ip1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp pik3ip1 mm01191492 m1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Gene Exp Pik3ip1 Mm01191492 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc02753226-150-48-19?v=Thermo+Fisher
Average 85 stars, based on 1 article reviews
gene exp pik3ip1 mm01191492 m1 - by Bioz Stars, 2026-08
85/100 stars
  Buy from Supplier

86
Addgene inc pef pik3ip1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Pef Pik3ip1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc04868629-65-8-9?v=Addgene+inc
Average 86 stars, based on 1 article reviews
pef pik3ip1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

93
Shanghai Korain Biotech Co Ltd human phosphoinositide 3 kinase interacting protein 1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Human Phosphoinositide 3 Kinase Interacting Protein 1, supplied by Shanghai Korain Biotech Co Ltd, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/ppr0696923-82-7-14?v=Shanghai+Korain+Biotech+Co+Ltd
Average 93 stars, based on 1 article reviews
human phosphoinositide 3 kinase interacting protein 1 - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp pik3ip1 hs00364629 m1
A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with <t>PIK3IP1</t> cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.
Gene Exp Pik3ip1 Hs00364629 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc03597452-223-69--1?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
gene exp pik3ip1 hs00364629 m1 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Broad Institute Inc pik3ip1 trcn0000135363/trcn0000135429
Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of <t>PIK3IP1</t> . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.
Pik3ip1 Trcn0000135363/Trcn0000135429, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc03735703-142-4-15?v=Broad+Institute+Inc
Average 90 stars, based on 1 article reviews
pik3ip1 trcn0000135363/trcn0000135429 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
GenScript corporation pik3ip1-overexpressing clone
Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of <t>PIK3IP1</t> . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.
Pik3ip1 Overexpressing Clone, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pmc09322903-43-0-5?v=GenScript+corporation
Average 90 stars, based on 1 article reviews
pik3ip1-overexpressing clone - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH human pik3ip1 stable overexpression system
Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of <t>PIK3IP1</t> . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.
Human Pik3ip1 Stable Overexpression System, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/pm35852858-251-1-11?v=VectorBuilder+GmbH
Average 90 stars, based on 1 article reviews
human pik3ip1 stable overexpression system - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

94
Genecopoeia orf expression clone for pik3ip1
Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of <t>PIK3IP1</t> . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.
Orf Expression Clone For Pik3ip1, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pik3ip1/custom%40ex-t3348-m35%4036725889?v=Genecopoeia
Average 94 stars, based on 1 article reviews
orf expression clone for pik3ip1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

Image Search Results


A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques: Quantitative RT-PCR, Western Blot, Isolation, Transfection, Plasmid Preparation, Control, Colony-forming Unit Assay, Software, Infection, Two Tailed Test

A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques: Expressing, Transformation Assay

Quantitative RT-PCR

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: Quantitative RT-PCR

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques:

A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques: Quantitative RT-PCR, Western Blot, Isolation, Transfection, Plasmid Preparation, Control, Colony-forming Unit Assay, Software, Infection, Two Tailed Test

A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques: Expressing, Transformation Assay

Quantitative RT-PCR

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: Quantitative RT-PCR

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques:

Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of PIK3IP1 . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.

Journal: Cell Cycle

Article Title: Induction of prolonged early G 1 arrest by CDK4/CDK6 inhibition reprograms lymphoma cells for durable PI3Kδ inhibition through PIK3IP1

doi: 10.4161/cc.24928

Figure Lengend Snippet: Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of PIK3IP1 . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.

Article Snippet: Cells were infected with PIK3IP1 (TRCN0000135363/TRCN0000135429), or LacZ (TRCN0000072229) control shRNA (The RNAi Consortium at Broad Institute).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Culture, Infection, shRNA, Concentration Assay, Staining