Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques: Quantitative RT-PCR, Western Blot, Isolation, Transfection, Plasmid Preparation, Control, Colony-forming Unit Assay, Software, Infection, Two Tailed Test

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques: Expressing, Transformation Assay

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: Quantitative RT-PCR

Article Snippet: Mouse- Pik3ip1 -F CCATGGAGCTGGAAGAGAAG Mouse- Pik3ip1 -R AGCTCCAATAGCGAGGATGA Mouse- Gapdh -F GTGGAGTCATACTGGAACATGTAG Mouse- Gapdh -R AATGGTGAAGGTCGGTGTG Mouse- Samd9L -F CCTGGTGTCTCTCAGCCAGT Mouse- Samd9L -R CTTCATTCTGCCCTGTCTCC Open in a separate window Quantitative RT-PCR Transfection Human PIK3IP1 ( NM_052880.4 , EX-I1822-M95, Genecopoeia) was overexpressed in the mCherry + pReceiver-M95 plasmid.

Techniques:

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. Quantitative RT-PCR of the indicated genes from splenocytes collected from mice 5-7 weeks after poly I:C and doxycycline treatment. Mean ± SEM is shown for n=3-7 biological replicates per genotype. B. Representative immunoblots of splenocytes for the indicated proteins. C. Mean ± SEM quantification is shown for immunoblots of n=4-6 biological replicates per genotype. D. Kit+ cells isolated from the indicated mice were transfected with PIK3IP1 cDNA or empty-vector control plasmid and CFU assays were performed. CFU-GM colonies were enumerated on day 10 (n=3-6 biological replicates per genotype). Representative CFU images are shown on the right. E. Representative PIK3IP1 immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands quantified using ImageJ densitometry software. F. Kit+ cells isolated from indicated mice were infected with CI20-SAMD9L-lentivirus or empty vector and assayed for CFU formation (n=2-3 biological replicates per genotype). The CFU-GM colonies were enumerated on day 10. Representative CFU images are shown on the right. G. Representative SAMD9L immunoblot of cells collected after the CFU assay (n=3). The pixel density is shown for individual bands. Two-tailed Student t test was used to assess statistical significance. *p<0.05, **p<0.01, and ***p<0.001.

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques: Quantitative RT-PCR, Western Blot, Isolation, Transfection, Plasmid Preparation, Control, Colony-forming Unit Assay, Software, Infection, Two Tailed Test

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: A. We propose a model wherein CUX1 normally transcriptionally activates expression of PIK3IP1 and other RAS/PI3K inhibitors, thereby restraining RAS signaling. B. CUX1 deficiency causes decreased expression of these regulators, resulting in increased PI3K and MEK mediated-signaling and downstream proliferation and survival, accelerating transformation and promoting leukemogenesis. This aberrant signaling is responsive to PI3K or MEK blockade. C. CUX1 deficiency drives several features of MDS, including anemia, myeloid bias, and multi-lineage dysplasia. D. Oncogenic RAS exacerbates these defects further and additionally promotes HSPC self-renewal and overt AML transformation. Figures created in part usiong BioRender.com.

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques: Expressing, Transformation Assay

Journal: Oncogene

Article Title: Oncogenic RAS promotes leukemic transformation of CUX1-deficient cells

doi: 10.1038/s41388-023-02612-x

Figure Lengend Snippet: Quantitative RT-PCR

Article Snippet: Unstimulated cells were probed for PIK3IP1 (16826-1, Protein Technology), SAMD9L (PA5-25090, Thermo Fisher), and ß-ACTIN (C4, SC-47778, Santa Cruz).

Techniques:

Journal: Cell Cycle

Article Title: Induction of prolonged early G 1 arrest by CDK4/CDK6 inhibition reprograms lymphoma cells for durable PI3Kδ inhibition through PIK3IP1

doi: 10.4161/cc.24928

Figure Lengend Snippet: Figure 7. Prolonged early G 1 arrest sensitizes MCL cells to GS-1101 through induction of PIK3IP1 . ( A ) WTS analysis of PIK3IP1 mRNA abundance ( B ) q-RT-PCR analysis of PIK3IP1 mRNA expression in JEKO-1 and MAVER-1 cell cultured with sequential combination of PD 0332991 (72 h) and GS-1101 (48 h). ( C ) Cells infected with PIK3IP1 or LacZ shRNA lentivirus were treated with PD 0332991 (72 h) and GS-1101 (48 h) at indicated concentration. DNA fragmentation (Topro-3) was determined by FACS analysis (upper panel) and cell viability by Tripan blue exclusion staining in triplicate. *p < 0.05.

Article Snippet: Cells were infected with PIK3IP1 (TRCN0000135363/TRCN0000135429), or LacZ (TRCN0000072229) control shRNA (The RNAi Consortium at Broad Institute).

Techniques: Reverse Transcription Polymerase Chain Reaction, Expressing, Cell Culture, Infection, shRNA, Concentration Assay, Staining