Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Protein expression levels of Cav1.2, Piezo1, CaM, and Src in human LAA tissues. (A) Representative western blots and densitometric analysis of Cav1.2 and Piezo1 proteins in LA tissues of AF patients and those with SR. (B) Representative western blots and densitometric analysis of CaM and Src protein in LA tissues of AF patients and those with SR. GAPDH was the internal control. ** p < 0.01. Values are presented as the mean ± standard error of the mean (SEM).

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effects of hypertension on the incidence of AF, I Ca,L , and Piezo1 expression in Wistar rats and SHRs with and without Val treatment. (A) Representative baseline surface ECG and intra-atrial electrocardiogram (IAEG); (B) The incidence AF in Wistar rats and SHRs treated with and without Val treatment ( n = 8). ** p < 0.01 vs. Wistar rat; ## p < < 0.01 vs. SHRs. (C) Typical surface ECG recordings of rats with AF that spontaneously reverted to SR and typical disorganized amplification of atrial waves (f wave). (D) Representative traces of AP in atrial myocytes from Wistar rats, SHRs, and SHR + Val groups and a histogram of APD in atrial myocytes from each group ( n = 12–15 myocytes from 3–4 rats). * p < 0.05 vs. Wistar rat; # p < 0.05 vs. SHRs. (E) Representative traces of I Ca,L (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in atrial myocytes of each group ( n = 8–14 myocytes from 3–4 rats). (F) Representative examples of immunohistochemical analysis of LA tissues from Wistar rats and SHRs treated with and without Val using Ab against Piezo1. Scale bar, 20 μm. (G) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in LA tissues of Wistar rats and SHRs. GAPDH was the internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Expressing, Amplification, Activation Assay, Immunohistochemical staining, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of HHP on the depression of I Ca,L in HL-1 cells. (A) Representative traces of AP in HL-1 cells under various hydrostatic pressures (0, 20, and 40 mmHg) for 24 h. APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 10, and 7 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (B) Representative traces (pulse protocol, inset), corresponding current-voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L ( n = 8–18 at 0, 20, and 40 mmHg, respectively). * p < 0.05, ** p < 0.01 vs. 0 mmHg. (C) Representative western blots and densitometric analysis of Cav1.2, Piezo1, CaM, and Src in HL-1 cells under various hydrostatic pressure (0, 20, and 40 mmHg) for 24 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: The effects of Piezo1 on perceiving HHP and mediating the decrease of I Ca,L . (A,B) Representative Ca 2+ traces and Δ Ca i 2 + (ΔF/F) are shown. Ca 2+ entry was evoked by 10 μm Yoda1 in HL-1 cells stimulated by HHP in the presence or absence of the Piezo1 inhibitor GsmTx4 ( n = 50) or siRNA specifically knockdown Piezo1 ( n = 53–58). si-C, scrambled (control) siRNA; si-P, siRNA directed against Piezo1. (C) Representative traces of AP in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment (3.0 μM) and APD 50 , APD 70 , and APD 90 of HL-1 cells were calculated ( n = 9, 7, and 11 at 0, 40, and 40 mmHg + GsmTx4). * p < 0.05, ** p < 0.01 vs. 0 mmHg; # p < 0.05 vs. 40 mmHg. (D) Representative traces (pulse protocol, inset), corresponding current–voltage relationship, mean data for voltage dependence activation, inactivation, and time course of recovery current for I Ca,L in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment ( n = 9–15). ** p < 0.01 vs. 0 mmHg; ## p < 0.01 vs. 40 mmHg. (E) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (F) Representative blots and densitometry analysis of Cav1.2 in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Activation Assay

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Effect of CaM/Src on the decrease of I Ca,L induced by HHP or Yoda1 stimulation. (A) Representative blots and densitometry analysis of CaM and Src in HL-1 cells stimulated by 40 mmHg pressure with and without GsmTx4 treatment. (B) Representative blots and densitometry analysis of CaM and Src in Yoda1 stimulation at different dosages (1, 3, and 10 μM) for 48 h. (C) Representative blots and densitometry analysis of Src and p-Src ( n = 4) in HL-1 cells transfected with scrambled (control) siRNA or siRNA directed against Piezo1 for 48 h, then treated with Yoda1 at different dosages (0, 1, and 3 μM) for 15 min. (D) Representative traces of AP and histogram of APD in HL-1 cells ( n = 7–8). * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (E) Current–voltage relationship for I Ca,L ( n = 9–17) in HL-1 cells stimulated by 40 mmHg pressure treated with 15 μM PP1 or W7. * p < 0.05 vs. 0 mmHg + DMSO. # p < 0.05 vs. 40 mmHg + DMSO. (F) Representative blots and densitometry analysis of Cav1.2 and Src in HL-1 cells stimulated by 40 mmHg pressure treated with W7 under different concentrations (5, 10, 15, and 20 μM). (G) Representative blots and densitometry analysis of Cav1.2 in HL-1 cells stimulated by 40 mmHg pressure treated with PP1 (15 μM). (H) Current-voltage relationship for I Ca,L ( n = 8–10) in HL-1 cells stimulated by Yoda1(3 μM) treated with PP1. * p < 0.05, ** p < 0.01 vs. DMSO. # p < 0.05, ## p < 0.01 vs. Yoda1. (I) Representative blots and densitometry analysis of Cav1.2 in Yoda1(3μM) -stimulated HL-1 cells treated with PP1 (15 μM). GAPDH was used as an internal control. Values are presented as the mean ± SEM.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques: Transfection

Journal: Frontiers in Cardiovascular Medicine

Article Title: Piezo1 Participated in Decreased L-Type Calcium Current Induced by High Hydrostatic Pressure via . CaM/Src/Pitx2 Activation in Atrial Myocytes

doi: 10.3389/fcvm.2022.842885

Figure Lengend Snippet: Schematic representation of the mechanism for the decrease of I Ca,L induced by HHP. Piezo1 activated by HHP depressed I Ca,L contributing to increased AF susceptibility through the CaM/Src/Pitx2 pathway.

Article Snippet: According to standard protocols, the treated protein samples (15–30 μg) were separated by electrophoresis with 10% SDS–polyacrylamide gels and transferred to PVDF membranes, which were blocked with 5% non-fat milk for 1 h at room temperature and then incubated overnight at 4°C with primary rabbit polyclonal Abs against Piezo1, Cav1.2 (dilution, 1:1000; Alomone Labs, Jerusalem, Israel); and Src (1:1000; Abcam, Waltham, MA, USA;) and mouse polyclonal Abs against Pitx2 (1:1000; Cloud-Clone Corp., Wuhan, Hubei, China) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or β-actin (1:5000; Cell Signaling Technology, Inc., Beverly, MA, USA).

Techniques:

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Applying Ultrasound to Mechanically and Noninvasively Sensitize Prostate Tumors to TRAIL-Mediated Apoptosis.

doi: 10.1002/advs.202412995

Figure Lengend Snippet: Figure 4. Piezo1 inhibition and knockdown reduces the effects of TRAIL sensitization. PC3 and LNCaP cells were exposed to 60 s of ultrasound at 944 kPa and treated with GsMTx-4, TRAIL and ultrasound at 944 kPa for 60 s. PC3 summary data showing the mean percentage of A) late-stage apoptosis, B) mitochondrial depolarization, and C) TRAIL sensitization (Equations (2)–(4)). D) Representative AV/PI flow cytometry plots for the PC3 cells. LNCaP summary data showing the mean percentage of E) late-stage apoptosis, (F) mitochondrial depolarization, and G) TRAIL sensitization (Equations (2)– (4)). H) Representative JC-1 flow cytometry plots showing the PC3 cells. Summary data for the knockdown of PIEZO1 in the PC3 cells showing the mean percentage of I) viable cells, J) late-stage apoptosis, K) TRAIL sensitization (Equations (2) and (3)), and L) mitochondrial depolarization for the parental, control (shC) and PIEZO1 KD (shPiezo1) conditions. n = 4 (A–C), n = 5 (E–G), and n = 3–4 independent experiments (I–L); two-way ANOVA (A–C, E–G, I–L). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.0001. Error bars represent mean ± SEM.

Article Snippet: [129] Generation of the Piezo1 shRNA Knockdown Cell Line: To knockdown PIEZO1, shRNA lentiviral particle transduction from Santa Cruz Biotechnology was used.

Techniques: Inhibition, Knockdown, Cytometry, Control

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Applying Ultrasound to Mechanically and Noninvasively Sensitize Prostate Tumors to TRAIL-Mediated Apoptosis.

doi: 10.1002/advs.202412995

Figure Lengend Snippet: Figure 6. Mechanotherapy reduces tumor burden. A) In vivo ultrasound apparatus. B) Treatment timeline, C) mean tumor volume (Equation (7)), and D) mean tumor growth rate (Equation (8)) for PC3 flank tumors receiving two treatments on day 0 and day 6 post-tumor inoculation (day −14). Red arrows indicate treatment days. E) Individual tumor curves with tumor photographs (ruler showing cm) and corresponding H&E staining shown below. Percent positive IHC stains for F) DR4, G) DR5, H) Piezo1, I) CC3, J) TUNEL, and K) Ki67 for the tumors following resection. L) Representative IHC micrographs (scale bar = 100 μm). n = 5–6 tumors per condition; two-way ANOVA (C, D) and one-way ANOVA (F–K). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.0001. Simple linear regression to confirm significant deviation from zero (C), ####p < 0.0001. Error bars represent mean ± SEM (C, D). Box and whisker plots show individual data points outside of the 10–90th percentile with mean indicated as (+), median indicated as the solid horizontal line and outliers indicated as individual points (F–K).

Article Snippet: [129] Generation of the Piezo1 shRNA Knockdown Cell Line: To knockdown PIEZO1, shRNA lentiviral particle transduction from Santa Cruz Biotechnology was used.

Techniques: In Vivo, Staining, TUNEL Assay, Whisker Assay

Journal: Advanced science (Weinheim, Baden-Wurttemberg, Germany)

Article Title: Applying Ultrasound to Mechanically and Noninvasively Sensitize Prostate Tumors to TRAIL-Mediated Apoptosis.

doi: 10.1002/advs.202412995

Figure Lengend Snippet: Figure 7. Effects of varied timepoints between treatments. A) Treatment timeline, B) mean tumor volume (Equation (7)), and C) mean tumor growth rate (Equation (8)) for PC3 flank tumors receiving two treatments on day 0 and day 8 post-tumor inoculation (day −13). Red arrows indicate treatment days. D) Individual tumor curves. E) Representative IHC micrographs (scale bar = 100 μm). Percent positive IHC stains for F) DR4, G) DR5, H) Piezo1, I) CC3, J) TUNEL, and K) Ki67 for the tumors following resection. L) Comparison of final mean tumor volumes for tumors in (B) and (Figure 6C). M) Correlation between mean Piezo1 expression and mean final tumor volume with best fit line. N) Representative tumor images with ruler showing cm. The 0 h treatment group is the same as the FUS+TRAIL treatment group in Figure 6, shown for comparison. n = 3–5 tumors per condition; two-way ANOVA (B, C, E) and one-way ANOVA (F–K). *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.0001. Linear regression to confirm significant deviation from zero (B, M), #p < 0.05, ####p < 0.0001. Error bars represent mean ± SEM (B, C, L, M). Box and whisker plots show individual data points outside of the 10–90th percentile with mean indicated as (+), median indicated as the solid horizontal line and outliers indicated as individual points (F–K).

Article Snippet: [129] Generation of the Piezo1 shRNA Knockdown Cell Line: To knockdown PIEZO1, shRNA lentiviral particle transduction from Santa Cruz Biotechnology was used.

Techniques: TUNEL Assay, Comparison, Expressing, Whisker Assay

Journal: Aging Cell

Article Title: Piezo1 opposes age‐associated cortical bone loss

doi: 10.1111/acel.13846

Figure Lengend Snippet: Piezo1 expression decreases with age. (a) mRNA levels of Piezo1 in 6‐ and 24‐month‐old C57BL/6J and DBA mice ( n = 9–11, here and throughout, values are mean ± SD). (b) qPCR of Piezo1 mRNA in human cortical bone isolated from human femoral neck removed during hip replacement surgeries from young ( n = 9 with mean age of 47.1 ± 7.01 years old) and aged patients ( n = 13 with mean age of 73.8 ± 3.2 years old). (c) Quantification and representative images of Piezo1 mRNA in situ hybridization using RNAscope on femoral cortical bone of 6‐ and 24‐month‐old C57BL/6J mice. Red dots indicate positive Piezo1 signals. Scale bar, 100 μm. (d) Quantification and representative images of Piezo1 mRNA in situ hybridization on human cortical bone of femoral neck from young and old individuals. Red dots indicate positive Piezo1 signals. * p < 0.05 using Student's t test.

Article Snippet: We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 ( Mrps2 ) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1).

Techniques: Expressing, Isolation, In Situ Hybridization, RNAscope

Journal: Aging Cell

Article Title: Piezo1 opposes age‐associated cortical bone loss

doi: 10.1111/acel.13846

Figure Lengend Snippet: Deletion of Piezo1 in osteoblasts and osteocytes exacerbates the cortical bone loss with age. (a) Cancellous bone volume per tissue volume (BV/TV) and the representative μCT images measured in the L4 vertebra of 6‐ and 24‐month‐old female Piezo1 f/f ( n = 8, 10) and Dmp1‐Cre; Piezo1 f/f ( n = 8, 12) mice. (b) Cortical thickness and the representative μCT images (scale bar, 1 mm) measured in the femoral diaphysis of 6‐ and 24‐month‐old female Piezo1 f/f ( n = 8, 10) and Dmp1‐Cre; Piezo1 f/f ( n = 8, 12) mice. (c) X‐ray images of tibia from 24‐month‐old Piezo1 f/f and Dmp1‐Cre; Piezo1 f/f littermate. Fractions represent 0 and 4 mice displayed tibia facture out of 10 and 12 mice, respectively. Arrow indicates the location of fracture. (d–f) Periosteal circumference (d), endocortical circumference (e), and moment of inertia (f) analysis of the femoral diaphysis by micro‐CT from 6‐ and 24‐month‐old female Piezo1 f/f ( n = 8, 10) and Dmp1‐Cre; Piezo1 f/f ( n = 8, 12) mice. (g) Representative histological longitudinal section images of cortical bone showing cortical porosity in 6‐ and 24‐month‐old female Piezo1 f/f and Dmp1‐Cre; Piezo1 f/f mice. Red arrow heads indicate pores in cortical bone. Scale bar, 50 μm. (h) Cortical porosity measured by μCT in femur from 6‐ and 24‐month‐old female Piezo1 f/f ( n = 8, 10) and Dmp1‐Cre; Piezo1 f/f ( n = 8, 12) mice. * p < 0.05 with the comparisons indicated by the brackets using 2‐way ANOVA. #, p < 0.05 for interaction using 2‐way ANOVA. ns, nonsignificant.

Article Snippet: We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 ( Mrps2 ) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1).

Techniques: Micro-CT

Journal: Aging Cell

Article Title: Piezo1 opposes age‐associated cortical bone loss

doi: 10.1111/acel.13846

Figure Lengend Snippet: Deletion of Piezo1 in osteoblasts and osteocytes increases osteoclast formation at endocortical surface. (a) Representative images of TRAP staining at the endocortical surface of 6‐ and 24‐month‐old female Piezo1 f/f and Dmp1‐Cre; Piezo1 f/f mice. Scale bar, 50 μm. (b) Osteoclast number (N.Oc/B.Pm, left) and osteoclast surface (Oc.S/BS, right) measured at femoral endocortical surface of 6‐ and 24‐month‐old female Piezo1 f/f ( n = 5, 5) and Dmp1‐Cre; Piezo1 f/f ( n = 5, 5) mice. * p < 0.05 with the comparisons indicated by the brackets using 2‐way ANOVA. #, p < 0.05 for interaction using 2‐way ANOVA. (c) Representative images of TRAP staining and quantification of TRAP + osteoclasts in cocultures of bone marrow derived macrophages with MLO‐Y4 cells with or without Piezo1 knocked down. (d) mRNA of osteoclastic genes Ctsk and Acp5 in cocultures of bone marrow derived macrophages with MLO‐Y4 cells with or without Piezo1 knocked down. (e) mRNA of Acp5 in cocultures of bone marrow derived macrophages with MLO‐Y4 cells in the presence of Piezo1 agonist Yoda1. (f) Acp5 expression in femoral cortical bone cultured ex vivo in the presence of Piezo1 agonist Yoda1. * p < 0.05 using Student's t test.

Article Snippet: We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 ( Mrps2 ) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1).

Techniques: Staining, Derivative Assay, Expressing, Cell Culture, Ex Vivo

Journal: Aging Cell

Article Title: Piezo1 opposes age‐associated cortical bone loss

doi: 10.1111/acel.13846

Figure Lengend Snippet: Deletion of Piezo1 in osteoblasts and osteocytes suppresses Tnfrsf11b expression. (a) qPCR of Piezo1 and Tnfrsf11b mRNA in control or Piezo1 knock‐down MLO‐Y4 cells. * p < 0.05 using Student's t test. (b) Relative mRNA levels of Piezo1 and Tnfrsf11b in MLO‐Y4 cells treated with 10 μM Yoda1 for 2 h. * p < 0.05 using Student's t test. (c) Piezo1 and Tnfrsf11b mRNA levels measured in tibia of 3‐month‐old female C57BL/6J ( n = 7) mice loaded with one bout of compressive loading. Mice were harvested 4 h after loading. * p < 0.05 using Student's t test. (d) Tnfrsf11b mRNA levels in femoral cortical bone of 6‐ and 24‐month‐old female C57BL/6J mice ( n = 6). * p < 0.05 using Student's t test. (e) Tnfrsf11b mRNA levels in Veh or Yoda1 treated bone marrow stromal cells isolated from 6‐ and 24‐month‐old female C57BL/6J mice. * p < 0.05 with the comparisons indicated by the brackets using 2‐way ANOVA. #, p < 0.05 for interaction using 2‐way ANOVA. (f) Representative images and quantification of Tnfrsf11b mRNA in situ hybridization using RNAscope on femoral cortical bone of 3‐month‐old female Piezo1 f/f and Dmp1‐Cre; Piezo1 f/f mice ( n = 3). Red dots indicate positive Tnfrsf11b signals. Scale bar, 100 μm. (g) Tnfrsf11b mRNA levels in osteocyte‐enriched femoral cortical bone of 4‐month‐old male Piezo1 f/f and Dmp1‐Cre; Piezo1 f/f mice ( n = 5). * p < 0.05 using Student's t test.

Article Snippet: We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 ( Mrps2 ) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1).

Techniques: Expressing, Control, Knockdown, Isolation, In Situ Hybridization, RNAscope

Journal: Aging Cell

Article Title: Piezo1 opposes age‐associated cortical bone loss

doi: 10.1111/acel.13846

Figure Lengend Snippet: Piezo1 controls Tnfrsf11b expression via Ca 2+ /CaM/mTOR signaling pathway. (a) qPCR of Tnfrsf11b mRNA in MLO‐Y4 cells treated with Veh or 10 μM Yoda1 for 2 h. Cells were cultured in αMEM either with or without calcium. (b) Relative mRNA levels of Tnfrsf11b in MLO‐Y4 cells treated with Veh or 10 μM Yoda1 for 2 h in the presence of 5 μM intracellular calcium chelator BAPTA. (c) Relative mRNA levels of Tnfrsf11b in MLO‐Y4 cells treated with 10 μM Yoda1 for 2 h in the presence of 1.5 μM calmidazolium (CMZ), a membrane‐permeable CaM antagonist. (d) Relative mRNA levels of Tnfrsf11b in MLO‐Y4 cells treated with Veh or 10 μM Yoda1 for 2 h in the presence of 2.5 μM mTOR inhibitor PP242. (e) Relative mRNA levels of Tnfrsf11b in MLO‐Y4 cells treated with Veh or 10 μM Yoda1 for 2 h in the presence of 10 μM SB203590 (p38/MAPK inhibitor), 50 μM PD98059 (MEK/ERK inhibitor), and 200 μM L‐NAME (eNOS inhibitor). (f) Schematic illustration of the pathway by which Piezo1 controls Tnfrsf11b expression. n = 3 per group. Each experiment was repeated at least two times. * p < 0.05 with the comparisons indicated by the brackets using 2‐way ANOVA. #, p < 0.05 for interaction using 2‐way ANOVA.

Article Snippet: We performed quantitative RT‐PCR using the following Taqman assays from Applied Biosystems: Piezo1 (Mm01241549_m1); Tnfsf11 Mm00441906_m1; Tnfrsf11b (Mm00435452_m1); and ribosomal protein S2 ( Mrps2 ) (for, 5′‐CCCAGGATGGCGACGAT‐3′, rev, 5′‐CCGAATGCTGTAATGGCGTAT‐3′, probe, 5′‐FAM‐TCCAGAGCAGGATCC‐NFQ‐3′); human Piezo1 (Hs00207230_m1); human Mrps2 (Hs00211334_m1); and human Actb (Hs03023943_g1).

Techniques: Expressing, Cell Culture, Membrane

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: (A) Representative tracing of contractile response to cumulative additions of the Piezo1 agonist Yoda1 to thoracic aorta ring with PVAT. Piezo1 agonists did not cause a concentration dependent contraction. Quantification of multiple experiments using Yoda1 (B) and Jedi2 (C) as agonists (grey) vs Vehicle (white, same vehicle for B and C). (A) Arrows indicate each cumulative step with PE maximal contraction at the end. (B, C) Symbols represent mean±SEM for N reported, −P = without PVAT (open) +P = with PVAT (filled).

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: Concentration Assay

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: (A) Representative tracing of relaxant response to cumulative additions of the Piezo1 agonist Yoda1 in half-maximally PE contracted thoracic aorta ring with PVAT. Neither the Piezo1 agonist Yoda1 (B) nor Jedi2 (C) (grey) caused concentration dependent relaxation vs Vehicle (black). (A) Arrows indicate each cumulative step. (B, C) Symbols represent mean±SEM for N reported, −P = without PVAT (open) +P = with PVAT (filled).

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: Concentration Assay

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: Piezo1 mRNA is present in vessels and PVAT of the male Sprague Dawley rat aorta (A) and mesenteric vessel (B) as well as in the adipocytes and SVF of the mesenteric PVAT(C). Piezo1, Piezo2, TRPV4, TMEM16, and Panx1 mRNA were measured using RT-PCR and beta actin as a calibrator control. Bars are mean+SEM with scattered individual points for an N = 4–5. Stat test was a one-way ANOVA, *p < 0.05.

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: Reverse Transcription Polymerase Chain Reaction, Control

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: Detection of Piezo1 in distinct layers (endothelium [E], media [M], and PVAT [P]) of isolated rat thoracic aorta (A), superior mesenteric artery (B), mesenteric resistance vessels (artery [A] and vein [V]) (C), and positive control rat kidney (D). L = lumen. Top panel for each set of images shows DAPI as a nuclei marker and FITC indicating Piezo1 signal, while bottom panel shows tissue without primary antibody (no 1°). White arrows indicate staining of interest. Images are representative of N = 5 taken at 20x with 100 μm scale bars bottom right.

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: Isolation, Positive Control, Marker, Staining

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: Piezo1 agonist Yoda1 induced relaxation of the longitudinal strip of thoracic aorta with endothelium in mouse (A) but not rat (B). (A,B) +E = Endothelium intact (ACh caused >40% PE relaxation), PVAT removed, thoracic aorta in strips. Points shown as mean±SEM for N reported. Star is significance from two-way ANOVA p < 0.05.

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: Stripping Membranes

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: (A) Isometric tracing for Yoda1 CRC representing (B) quantification of Piezo1 agonist Yoda1 in rat thoracic aorta rings without PVAT, with and without endothelium (+E [78.22 ± 1.63% relaxation to ACh], −E [0.25 ± 0.57% relaxation to ACh], filled, open respectively) and without potassium (−K, circles) and with potassium (+K, triangles). (A) Arrows indicate each cumulative step with PE maximal contraction at the end. (B) Symbols represent mean±SEM for N reported.

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques:

Journal: Pharmacological research

Article Title: Identification of Piezo1 channels in perivascular adipose tissue (PVAT) and their potential role in vascular function

doi: 10.1016/j.phrs.2021.105995

Figure Lengend Snippet: Effect of vehicle (DMSO, black) or Piezo1 agonist Yoda1 (grey) on rat superior mesenteric artery contraction (A) or relaxation (B; half-maximally contracted with PE) with or without PVAT (filled or open symbols, respectively). Points represent mean±SEM for N reported.

Article Snippet: Taq-Man PCR primers were purchased from ThermoFisher Scientific (Piezo-type mechanosensitive ion channel component 1 ( Piezo1 ), catalog # Rn01432593_m1; Piezo-type mechanosensitive ion channel component 2 ( Piezo2 ), catalog # Rn01491821_m1; transient receptor potential cation channel, subfamily V, member 4 ( TRPV4 ), catalog # Rn00576745_m1; anoctamin 1, calcium activated chloride channel ( TMEM16A/ANO1 ), catalog # Rn01474520_m1; Pannexin 1 ( Panx1 ), catalog # Rn01447976_m1; actin, beta ( Actb ), catalog # Rn00667869_m1).

Techniques: