pgex-6p-1 Search Results


95
Cytiva Europe arginines 8r
Loss <t>of</t> <t>Cited2</t> Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant <t>8R-CITED2</t> protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.
Arginines 8r, supplied by Cytiva Europe, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pmc05161512-165-9-17?v=Cytiva+Europe
Average 95 stars, based on 1 article reviews
arginines 8r - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

95
Addgene inc pgex6p1 gfp nanobody
Loss <t>of</t> <t>Cited2</t> Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant <t>8R-CITED2</t> protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.
Pgex6p1 Gfp Nanobody, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pmc12256297-32-0-6?v=Addgene+inc
Average 95 stars, based on 1 article reviews
pgex6p1 gfp nanobody - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

93
Addgene inc human p300
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pm40452297-31-17-13?v=Addgene+inc
Average 93 stars, based on 1 article reviews
human p300 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

94
Addgene inc t75 flasks
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
T75 Flasks, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pmc11541841__mmc2-225-5-20?v=Addgene+inc
Average 94 stars, based on 1 article reviews
t75 flasks - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

90
Addgene inc plasmids
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/10__1091_slash_mbc__e20___04___0250-134-1-6?v=Addgene+inc
Average 90 stars, based on 1 article reviews
plasmids - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Addgene inc ron vale
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Ron Vale, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pmc07802366-190-77-79?v=Addgene+inc
Average 90 stars, based on 1 article reviews
ron vale - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

96
Danaher Inc vector pgex 6p1
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Vector Pgex 6p1, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/10__1074_slash_jbc__c600051200-19-22-24?v=Danaher+Inc
Average 96 stars, based on 1 article reviews
vector pgex 6p1 - by Bioz Stars, 2026-07
96/100 stars
  Buy from Supplier

93
Addgene inc anti mcherry nanobody sequence lam4
(A) Schematic representation of the functionalized nanobodies. The standard <t>nanobody</t> (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).
Anti Mcherry Nanobody Sequence Lam4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pmc08961009-261-1-20?v=Addgene+inc
Average 93 stars, based on 1 article reviews
anti mcherry nanobody sequence lam4 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Addgene inc spergel
(A) Schematic representation of the functionalized nanobodies. The standard <t>nanobody</t> (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).
Spergel, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/10__7554_slash_elife__53945-161-44-59?v=Addgene+inc
Average 90 stars, based on 1 article reviews
spergel - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

91
Addgene inc m korte
(A) Schematic representation of the functionalized nanobodies. The standard <t>nanobody</t> (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).
M Korte, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pm38493476-240-279-288?v=Addgene+inc
Average 91 stars, based on 1 article reviews
m korte - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

93
Addgene inc kalle gehring
(A) Schematic representation of the functionalized nanobodies. The standard <t>nanobody</t> (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).
Kalle Gehring, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/bio_rxiv__64898__2025__12__18__694329-113-42-44?v=Addgene+inc
Average 93 stars, based on 1 article reviews
kalle gehring - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
(A) Schematic representation of the functionalized nanobodies. The standard <t>nanobody</t> (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).
Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgex-6p-1/pm40934913-322-181-195?v=Addgene+inc
Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


Loss of Cited2 Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant 8R-CITED2 protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.

Journal: Stem Cell Reports

Article Title: CITED2 Cooperates with ISL1 and Promotes Cardiac Differentiation of Mouse Embryonic Stem Cells

doi: 10.1016/j.stemcr.2016.10.002

Figure Lengend Snippet: Loss of Cited2 Impairs Expression of Genes Specifying Cardiac Mesoderm (A) Percentage of colonies with beating foci derived from C2 fl/fl and C2 Δ/Δ [LA11] ESC at D8 and D10 of differentiation. (B) Percentage of colonies with beating foci counted at 8 and 10 days after the initiation of differentiation in cell cultures derived from C2 fl/fl [Cre] ESC treated with ethanol or 4HT at D0 of differentiation, and with 4HT at D0 of differentiation and supplemented with recombinant 8R-CITED2 protein at D2 of differentiation (4HT + 8R-CITED2). (C) Expression of Activin A and Nodal determined by qPCR at D2 and D3 of differentiation in cultures derived from C2 fl/fl [Cre] ESC treated with 4HT or ethanol at D0 for 48 hr. (D) Expression of mesoderm markers ( Brachyury and Mesp1 ) at D2, D3, D5, and D12 of differentiation in cells generated from C2 fl/fl [Cre] ESC treated as described in ( B). (E) Expression of Isl1 , Gata4 , Nkx2.5 , and Tbx5 in cell cultures as described in (D). The inserts for Isl1 and Tbx5 detail the expression of these genes at D5 and D3, respectively. (F) Relative expression of Brachyury , Mesp1 , Isl1 , Gata4 , Nkx2.5 , and Tbx5 determined by qPCR at D5 of differentiation in cultures derived from untreated C2 fl/fl and C2 Δ/Δ [LA11] ESC, and C2 Δ/Δ [LA11] ESC supplemented with the recombinant 8R-CITED2 protein (C2 Δ/Δ [LA11] + 8R-CITED2) at D2 of differentiation for 48 hr. Gene expression in C2 fl/fl ESC was set to 1. (G) Enrichment of Isl1 genomic regions in extracts of E14/T ESC-derived cells at D5 by ChIP assays with anti-CITED2 or control (immunoglobulin G) polyclonal antibodies. Results are presented as the mean ± SEM of three independent biological experiments.

Article Snippet: Full-length human CITED2 cDNA and an oligonucleotide encoding eight arginines (8R) were cloned into the pGEX6P1 vector (GE Healthcare Life Sciences) to express a chimeric protein consisting of the GST in fusion with the 8R domain and CITED2 (termed GST-8R-CITED2, ).

Techniques: Expressing, Derivative Assay, Recombinant, Generated, Gene Expression, Control

FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility

FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Activity Assay, Incubation

FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay, Circular Dichroism

FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Biomarker Discovery, Comparison, Control

FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay

(A) Schematic representation of the functionalized nanobodies. The standard nanobody (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).

Journal: Life Science Alliance

Article Title: Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies

doi: 10.26508/lsa.202101269

Figure Lengend Snippet: (A) Schematic representation of the functionalized nanobodies. The standard nanobody (VHH-std) consists of the GFP-specific VHH domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain two tyrosine sulfation sequences (VHH-2xTS) or mCherry (VHH-mCherry). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, T7, or mCherry epitopes, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. As previously reported ( ; ), mCherry-containing nanobodies are slightly susceptible to clipping between the VHH and mCherry domains. (C) HeLa cells were transfected with non-targeting siRNA or siRNAs targeting μ1A-adaptin, Vps26, TIP47, or Rab9a. 3 d after transfection, the cells were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) To determine the knockdown (kd) efficiency, the residual protein was quantified in percent of the value after control-kd (mean and SD of three independent experiments). (E) HeLa cells stably expressing EGFP-CDMPR were depleted of μ1A-adaptin, Vps26, TIP47, or Rab9a as in (C). Cells were incubated for 1 h at 37°C with full medium containing 5 μg/ml VHH-mCherry (∼0.1 μM), fixed, stained for EEA1 and nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm. (F) Quantitation of the percentage of cells displaying the CDMPR localization phenotypes “mainly TGN,” “mainly peripheral,” or “fully peripheral” as in and . For each condition, random frames with a total of 136–140 cells were scored from three independent experiments. (G, H) Total and surface EGFP-CDMPR levels in RNAi-silenced cells were quantified by flow cytometry. Cells were incubated for 30 min at 4°C with VHH-mCherry for exclusive binding to EGFP-CDMPR at the cell surface, washed, dissociated and analyzed for GFP and mCherry fluorescence to determine the levels of total (G) and surface EGFP-CDMPR (H), respectively. Median fluorescence intensities above background of parental HeLa cells without EGFP-CDMPR of each condition were normalized to the average of cells treated with non-targeting control siRNA. For each condition, 50,000 cells were analyzed in each experiment (mean and SD of three independent experiments).

Article Snippet: The anti-mCherry nanobody sequence (LaM4) based on Rout and colleagues ( ) was a kind gift from Kazuhisa Nakayama (#70696; Addgene).

Techniques: Purification, SDS-Gel, Electrophoresis, Staining, Western Blot, Marker, Transfection, Knockdown, Control, Stable Transfection, Expressing, Incubation, Fluorescence, Microscopy, Quantitation Assay, Flow Cytometry, Binding Assay

HeLa cells stably expressing EGFP-CDMPR were transiently transfected with non-targeting siRNA (Control-kd) or siRNAs targeting TIP47, Rab9a, Vps26, μ1A, epsinR, GGA1–3, AP-2α, or clathrin CHC17. 3 d after transfection, cells were incubated with 2 μg/ml VHH-2xTS in PBS at 4°C for 1 h to label the surface fraction of EGFP-CDMPR. Subsequently, cells were washed and lysed, and endogenous protein levels were analyzed by immunoblotting with antibodies against the indicated proteins (VHH-2xTS was detected with anti-His6). Only knockdown of CHC17 influenced surface levels of EGFP-CDMPR (monitored by bound nanobody). Total EGFP-CDMPR remained unaffected in all knockdowns.

Journal: Life Science Alliance

Article Title: Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies

doi: 10.26508/lsa.202101269

Figure Lengend Snippet: HeLa cells stably expressing EGFP-CDMPR were transiently transfected with non-targeting siRNA (Control-kd) or siRNAs targeting TIP47, Rab9a, Vps26, μ1A, epsinR, GGA1–3, AP-2α, or clathrin CHC17. 3 d after transfection, cells were incubated with 2 μg/ml VHH-2xTS in PBS at 4°C for 1 h to label the surface fraction of EGFP-CDMPR. Subsequently, cells were washed and lysed, and endogenous protein levels were analyzed by immunoblotting with antibodies against the indicated proteins (VHH-2xTS was detected with anti-His6). Only knockdown of CHC17 influenced surface levels of EGFP-CDMPR (monitored by bound nanobody). Total EGFP-CDMPR remained unaffected in all knockdowns.

Article Snippet: The anti-mCherry nanobody sequence (LaM4) based on Rout and colleagues ( ) was a kind gift from Kazuhisa Nakayama (#70696; Addgene).

Techniques: Stable Transfection, Expressing, Transfection, Control, Incubation, Western Blot, Knockdown

(A) Schematic representation of the functionalized anti-mCherry nanobodies. The standard nanobody (LaM4-std) consists of the mCherry-specific LaM4 domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain one to three tyrosine sulfation sequences (TS). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, or T7, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. (C) Parental HeLaM cells and HeLaM-GGA2ks cells stably expressing mCherry-CDMPR were transfected with non-targeting siRNA (−) or siRNAs silencing endogenous GGA1–3 (+). Cell lysates were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) HeLaM-GGA2ks cells stably expressing mCherry-CDMPR were transfected with siRNAs targeting endogenous GGA1–3. These cells were transfected with a plasmid expressing His6/myc-tagged procathepsin D 24–36 h before analysis. Media of cells incubated for 2 h in serum-free medium supplemented with 5 mM mannose-6-phosphate to prevent cathepsin D binding to surface MPRs, and with or without rapamycin (+ or − Rapa, respectively) were analyzed by collecting procathepsin D (pCatD) with Ni/NTA beads and immunoblotting with anti-myc antibodies. Cell lysates were immunoblotted for actin as a control. (E) Procathepsin D missorted upon knocksideways of GGA2 (+Rapa) was quantified from immunoblots as shown in panel (D), normalized to the DMSO-treated (−Rapa) control (mean and SD of four independent experiments). (F) HeLa-GGA2ks cells stably expressing mCherry-CDMPR after silencing endogenous GGA1–3 were treated with or without 500 nM rapamycin for 1 h and processed for fluorescence microscopy to detect mCherry-CDMPR and recombinant GGA2-FKBP. Bar: 10 μm.

Journal: Life Science Alliance

Article Title: Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies

doi: 10.26508/lsa.202101269

Figure Lengend Snippet: (A) Schematic representation of the functionalized anti-mCherry nanobodies. The standard nanobody (LaM4-std) consists of the mCherry-specific LaM4 domain, T7 and HA epitope tags, a biotin acceptor peptide (BAP), and a hexahistidine (His6) purification tag. Other nanobodies in addition contain one to three tyrosine sulfation sequences (TS). Scale bar in aa. (B) Bacterially expressed and purified nanobodies (30 μg) were analyzed by SDS-gel electrophoresis and Coomassie staining (left). Immunoblot analysis of nanobodies (10 ng) with antibodies against the HA, His6, or T7, or with streptavidin-HRP (SA-HRP). Marker proteins with molecular weights in kilodalton are shown on the left. (C) Parental HeLaM cells and HeLaM-GGA2ks cells stably expressing mCherry-CDMPR were transfected with non-targeting siRNA (−) or siRNAs silencing endogenous GGA1–3 (+). Cell lysates were subjected to immunoblot analysis with antibodies against the indicated proteins. (D) HeLaM-GGA2ks cells stably expressing mCherry-CDMPR were transfected with siRNAs targeting endogenous GGA1–3. These cells were transfected with a plasmid expressing His6/myc-tagged procathepsin D 24–36 h before analysis. Media of cells incubated for 2 h in serum-free medium supplemented with 5 mM mannose-6-phosphate to prevent cathepsin D binding to surface MPRs, and with or without rapamycin (+ or − Rapa, respectively) were analyzed by collecting procathepsin D (pCatD) with Ni/NTA beads and immunoblotting with anti-myc antibodies. Cell lysates were immunoblotted for actin as a control. (E) Procathepsin D missorted upon knocksideways of GGA2 (+Rapa) was quantified from immunoblots as shown in panel (D), normalized to the DMSO-treated (−Rapa) control (mean and SD of four independent experiments). (F) HeLa-GGA2ks cells stably expressing mCherry-CDMPR after silencing endogenous GGA1–3 were treated with or without 500 nM rapamycin for 1 h and processed for fluorescence microscopy to detect mCherry-CDMPR and recombinant GGA2-FKBP. Bar: 10 μm.

Article Snippet: The anti-mCherry nanobody sequence (LaM4) based on Rout and colleagues ( ) was a kind gift from Kazuhisa Nakayama (#70696; Addgene).

Techniques: Purification, SDS-Gel, Electrophoresis, Staining, Western Blot, Marker, Stable Transfection, Expressing, Transfection, Plasmid Preparation, Incubation, Binding Assay, Control, Fluorescence, Microscopy, Recombinant

HeLa cells transiently expressing mCherry-CDMPR or TfR-mCherry were incubated for 1 h at 37°C with full medium containing 5 μg/ml LaM4-EGFP (∼0.1 μM), fixed, stained for nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm.

Journal: Life Science Alliance

Article Title: Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies

doi: 10.26508/lsa.202101269

Figure Lengend Snippet: HeLa cells transiently expressing mCherry-CDMPR or TfR-mCherry were incubated for 1 h at 37°C with full medium containing 5 μg/ml LaM4-EGFP (∼0.1 μM), fixed, stained for nuclei (DAPI, blue), and imaged by fluorescence microscopy. Bar: 10 μm.

Article Snippet: The anti-mCherry nanobody sequence (LaM4) based on Rout and colleagues ( ) was a kind gift from Kazuhisa Nakayama (#70696; Addgene).

Techniques: Expressing, Incubation, Staining, Fluorescence, Microscopy

(A, D) Schematic outline of the retrograde (A) anterograde (D) transport sulfation assays, respectively, with HeLa-GGA2ks/mCherry-CDMPR cells. (B) HeLa-GGA2ks cells stably expressing mCherry-CDMPR were siRNA-silenced for endogenous GGA1–3. The cells were starved for sulfate for 1 h, and then labeled for up to 75 min with [ 35 S]sulfate in the presence of LaM4-3xTS nanobodies either in the absence (−) or presence of 500 nM rapamycin to inactivate GGA2-FKBP (+Rapa). The nanobodies were isolated by Ni/NTA beads and subjected to SDS-gel electrophoresis followed by immunoblot analysis (anti-His6) and autoradiography ([ 35 S]). In parallel, aliquots of the cell lysates were immunoblotted for actin as a control for the amount of cells used. (C) Experiments as shown in panel B were quantified and presented as the percentage of the value in the absence of rapamycin after 75 min (mean and SD of three independent experiments). Without rapamycin is shown as black squares, with rapamycin as gray circles; uptake as open symbols, sulfation as filled symbols. (E) HeLa-GGA2ks cells stably expressing mCherry-CDMPR were siRNA-silenced for endogenous GGA1–3, followed by starvation for sulfate in the presence of LaM4-3xTS to preload mCherry-CDMPR in the surface/endosome/TGN pool. The cells were then labeled with [ 35 S]sulfate for up to 75 min in the continued presence of LaM4-3xTS, without or with addition of 500 nM rapamycin after 15 min (arrow) to inactivate GGA2 (+Rapa). (B) Nanobody analysis was performed as above (B). (F) Experiments as shown in panel E were quantified and presented as the percentage of the value in the absence of rapamycin after 75 min (mean and SD of three independent experiments). Without rapamycin is shown as black squares, with rapamycin as gray circles; uptake as open symbols, sulfation as filled symbols.

Journal: Life Science Alliance

Article Title: Retrograde transport of CDMPR depends on several machineries as analyzed by sulfatable nanobodies

doi: 10.26508/lsa.202101269

Figure Lengend Snippet: (A, D) Schematic outline of the retrograde (A) anterograde (D) transport sulfation assays, respectively, with HeLa-GGA2ks/mCherry-CDMPR cells. (B) HeLa-GGA2ks cells stably expressing mCherry-CDMPR were siRNA-silenced for endogenous GGA1–3. The cells were starved for sulfate for 1 h, and then labeled for up to 75 min with [ 35 S]sulfate in the presence of LaM4-3xTS nanobodies either in the absence (−) or presence of 500 nM rapamycin to inactivate GGA2-FKBP (+Rapa). The nanobodies were isolated by Ni/NTA beads and subjected to SDS-gel electrophoresis followed by immunoblot analysis (anti-His6) and autoradiography ([ 35 S]). In parallel, aliquots of the cell lysates were immunoblotted for actin as a control for the amount of cells used. (C) Experiments as shown in panel B were quantified and presented as the percentage of the value in the absence of rapamycin after 75 min (mean and SD of three independent experiments). Without rapamycin is shown as black squares, with rapamycin as gray circles; uptake as open symbols, sulfation as filled symbols. (E) HeLa-GGA2ks cells stably expressing mCherry-CDMPR were siRNA-silenced for endogenous GGA1–3, followed by starvation for sulfate in the presence of LaM4-3xTS to preload mCherry-CDMPR in the surface/endosome/TGN pool. The cells were then labeled with [ 35 S]sulfate for up to 75 min in the continued presence of LaM4-3xTS, without or with addition of 500 nM rapamycin after 15 min (arrow) to inactivate GGA2 (+Rapa). (B) Nanobody analysis was performed as above (B). (F) Experiments as shown in panel E were quantified and presented as the percentage of the value in the absence of rapamycin after 75 min (mean and SD of three independent experiments). Without rapamycin is shown as black squares, with rapamycin as gray circles; uptake as open symbols, sulfation as filled symbols.

Article Snippet: The anti-mCherry nanobody sequence (LaM4) based on Rout and colleagues ( ) was a kind gift from Kazuhisa Nakayama (#70696; Addgene).

Techniques: Stable Transfection, Expressing, Labeling, Isolation, SDS-Gel, Electrophoresis, Western Blot, Autoradiography, Control