pgex 6p Search Results


90
Addgene inc s 463848 f pbabe puro plasmid morgenstern
S 463848 F Pbabe Puro Plasmid Morgenstern, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s 463848 f pbabe puro plasmid morgenstern/product/Addgene inc
Average 90 stars, based on 1 article reviews
s 463848 f pbabe puro plasmid morgenstern - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Addgene inc pgex sesn2
Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex sesn2/product/Addgene inc
Average 90 stars, based on 1 article reviews
pgex sesn2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

94
Danaher Inc pgex 6p 2
Pgex 6p 2, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p 2/product/Danaher Inc
Average 94 stars, based on 1 article reviews
pgex 6p 2 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

96
Danaher Inc pgex 6p 1 vector
Pgex 6p 1 Vector, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p 1 vector/product/Danaher Inc
Average 96 stars, based on 1 article reviews
pgex 6p 1 vector - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

93
Addgene inc ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc
Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc
Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
Addgene inc pgex 6p hdcp2 plasmid
Pgex 6p Hdcp2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p hdcp2 plasmid/product/Addgene inc
Average 94 stars, based on 1 article reviews
pgex 6p hdcp2 plasmid - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

93
Addgene inc human p300
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human p300/product/Addgene inc
Average 93 stars, based on 1 article reviews
human p300 - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

94
Danaher Inc pgex 6p3
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Pgex 6p3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p3/product/Danaher Inc
Average 94 stars, based on 1 article reviews
pgex 6p3 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

91
Addgene inc m korte
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
M Korte, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m korte/product/Addgene inc
Average 91 stars, based on 1 article reviews
m korte - by Bioz Stars, 2026-04
91/100 stars
  Buy from Supplier

92
Addgene inc jonathon pines
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Jonathon Pines, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/jonathon pines/product/Addgene inc
Average 92 stars, based on 1 article reviews
jonathon pines - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

92
Addgene inc pgex 6p 1
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p 1/product/Addgene inc
Average 92 stars, based on 1 article reviews
pgex 6p 1 - by Bioz Stars, 2026-04
92/100 stars
  Buy from Supplier

93
Addgene inc pgex 6p 1 gst plasmid
FIGURE 1 | Generation of a <t>p300</t> construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc
Average 93 stars, based on 1 article reviews
pgex 6p 1 gst plasmid - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

Image Search Results


FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility

FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Activity Assay, Incubation

FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay, Circular Dichroism

FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Biomarker Discovery, Comparison, Control

FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Journal: Proteins

Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.

doi: 10.1002/prot.26848

Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.

Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (Addgene #157793), which coexpresses human p300 (1284–1664) with yeast Sirt2 [22].

Techniques: Comparison, Activity Assay