|
Addgene inc
s 463848 f pbabe puro plasmid morgenstern S 463848 F Pbabe Puro Plasmid Morgenstern, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/s 463848 f pbabe puro plasmid morgenstern/product/Addgene inc Average 90 stars, based on 1 article reviews
s 463848 f pbabe puro plasmid morgenstern - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex sesn2 Pgex Sesn2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex sesn2/product/Addgene inc Average 90 stars, based on 1 article reviews
pgex sesn2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
pgex 6p 2 Pgex 6p 2, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 2/product/Danaher Inc Average 94 stars, based on 1 article reviews
pgex 6p 2 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Danaher Inc
pgex 6p 1 vector Pgex 6p 1 Vector, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1 vector/product/Danaher Inc Average 96 stars, based on 1 article reviews
pgex 6p 1 vector - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Addgene inc
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc Ttgaacctgatctccatcca N A N A Recombinant Dna Pca24n Nbrp Rrid Ncbitaxon 146876 Pcp20 Cgsc Cgsc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc/product/Addgene inc Average 93 stars, based on 1 article reviews
ttgaacctgatctccatcca n a n a recombinant dna pca24n nbrp rrid ncbitaxon 146876 pcp20 cgsc cgsc - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p hdcp2 plasmid Pgex 6p Hdcp2 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p hdcp2 plasmid/product/Addgene inc Average 94 stars, based on 1 article reviews
pgex 6p hdcp2 plasmid - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Addgene inc
human p300 ![]() Human P300, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human p300/product/Addgene inc Average 93 stars, based on 1 article reviews
human p300 - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Danaher Inc
pgex 6p3 ![]() Pgex 6p3, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p3/product/Danaher Inc Average 94 stars, based on 1 article reviews
pgex 6p3 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Addgene inc
m korte ![]() M Korte, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m korte/product/Addgene inc Average 91 stars, based on 1 article reviews
m korte - by Bioz Stars,
2026-04
91/100 stars
|
Buy from Supplier |
|
Addgene inc
jonathon pines ![]() Jonathon Pines, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/jonathon pines/product/Addgene inc Average 92 stars, based on 1 article reviews
jonathon pines - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p 1 ![]() Pgex 6p 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1/product/Addgene inc Average 92 stars, based on 1 article reviews
pgex 6p 1 - by Bioz Stars,
2026-04
92/100 stars
|
Buy from Supplier |
|
Addgene inc
pgex 6p 1 gst plasmid ![]() Pgex 6p 1 Gst Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgex 6p 1 gst plasmid/product/Addgene inc Average 93 stars, based on 1 article reviews
pgex 6p 1 gst plasmid - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 1 | Generation of a p300 construct with improved yield. (A) Representative expression and purification gel of p300 KAT from pETdu- et+p300 KAT suggests a total yield of ~1 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution alongside the protein standard ladder lane (L) (ThermoFischer 26 634). p300 KAT is the faint band ~50 kDa in lane 7. (B) Schematic representation of the histone H4 (1-25)W construct used in subsequent experi- ments. This construct can be uniformly acetylated by p300 KAT on each of its five available lysine sites. (C) Demonstration of variable activity be- tween p300 KAT preparations shown by MALDI-MS spectra of identical acetylation reactions using presumably equivalent enzyme preparations. (D) Representative expression and purification gel for p300 KAT from pET His6 MBP TEV p300(1284–1669) LIC (Addgene #233587). Total yield was typ- ically > 10 mg/L of media. Lanes show (1) Whole cell lysate (2) Insoluble pellet (3) Soluble supernatant (4) NiNTA flowthrough 1 (5) Low salt (150 mM) wash (6) High salt (1 M) wash (7) NiNTA elution 1 (8) TEV protease dialysate (9) NiNTA flowthrough 2 (10) NiNTA wash 2 (11) NiNTA elution 2 (12) Protein ladder (NEB P7719S). Cleaved p300 KAT is the band ~43 kDa in lanes 9 and 10 (expected molecular weight once cleaved is 44 684 Da). Note this is very close to the expected molecular weight of 41 584 Da for the cleaved MBP solubility tag.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Construct, Expressing, Purification, Activity Assay, Molecular Weight, Solubility
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 2 | Pre-acetylation of p300 does not meaningfully alter acetyltransferase activity. (A) Overlaid 13C, 1H-HSQC NMR spectra showing re- action products after 1 h treatment of histone H4 (1-25)W with native p300 (teal) or p300 prescribed to a 2-h incubation with acetyl-CoA (purple). (B) overlaid 1D projections of the 13C, 1H-HSQC experiments demonstrate nearly equivalent peak heights for the acetyl-CoA (2.25 ppm) and acetyllysine (1.87 ppm 1H) products. (C) MALDI-MS spectra showing the distributions of reaction products.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Activity Assay, Incubation
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 3 | Comparison of p300 and p300Δ acetyltransferase activity towards the histone H4 tail. (A) Circular dichroism spectra for p300 (teal) and p300Δ (pink) used to estimate secondary structure content with BestSel. (B) MALDI-MS time courses comparing relative acetyltransferase ef- ficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (C) Mono-exponential fit of acetyltransferase reaction curves from a 1H-13C, HSQC based NMR time course for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail. Progress curves show the increase in intensity for the acetyllysine resonance centered at 1.86 ppm 1H, 22.1 ppm 13C over time, each data point represents the maximum acetyllysine peak intensity from a 3 min and 36 s experiment. Progress curves were fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (D) Progress curves for p300 (teal) and p300Δ (pink) acetyltransferase reactions with the histone H4 tail fit with a bi-exponential kinetic model to estimate relative turnover rates (k1 and k2) and relative contributions to the maximum intensity (A1 and A2). R2 values are included in C and D to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Comparison, Activity Assay, Circular Dichroism
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 4 | Validation of 12C propionyl-CoA synthesis and con- trol reactions to enable 13C propionylation resonance assignments. (A) Proton 1D NMR spectra showing the reaction product of the propionyl- CoA (green) synthesis reaction from propionic anhydride precursor (gray). The peaks at 1.06 and 2.56 ppm, respectively, were assigned to the methyl and methylene protons of the CoA conjugated propionyl moiety based on comparison to reference proton 1D spectra provided by CoALA Biosciences (SKU PC01). (B) Overlaid 13C, 1H-HSQC NMR spectra of the propionyltransferase reaction mixture (without enzyme) before adding 13C propionyl-CoA (gray) and after adding 13C propionyl- CoA (green). (C) Overlaid 13C, 1H-HSQC NMR spectra for p300 cata- lyzed propionylation of the histone H4 tail (green) overlaid with the ap- propriate no enzyme control (gray).
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Biomarker Discovery, Comparison, Control
Journal: Proteins
Article Title: Probing Enzymatic Acetylation Events in Real Time With NMR Spectroscopy: Insights Into Acyl-Cofactor Dependent p300 Modification of Histone H4.
doi: 10.1002/prot.26848
Figure Lengend Snippet: FIGURE 5 | Comparison of p300 and p300Δ propionyltransferase activity towards the histone H4 tail. (A) MALDI-MS time course com- paring relative propionyltransferase efficiency of p300 (teal) and p300Δ (pink) using the histone H4 tail as a substrate. (B) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a mono-exponential kinetic model to estimate relative turnover rates (k) and maximum intensity (Imax). (C) Progress curves for p300 (teal) and p300Δ (pink) propionyltransferase reactions with the histone H4 tail fit with a lagged mono-exponential kinetic model to estimate relative turnover rate (k1), amplitude (A), lag time (t0), and slope around t0 (α). R2 values are included in B and C to indicate the goodness of fit, and fit residuals for each data point are displayed at scale relative to 20% of the maximum data intensity.
Article Snippet: p300 KAT was originally obtained from pETduet+p300 KAT, a gift from Michael Rosen (
Techniques: Comparison, Activity Assay