|
Thermo Fisher
gene exp pde1a hs00897273 m1 ![]() Gene Exp Pde1a Hs00897273 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp pde1a hs00897273 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp pde1a hs00897273 m1 - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Novus Biologicals
anti pde1a ![]() Anti Pde1a, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti pde1a/product/Novus Biologicals Average 90 stars, based on 1 article reviews
anti pde1a - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Proteintech
pde1a ![]() Pde1a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pde1a/product/Proteintech Average 93 stars, based on 1 article reviews
pde1a - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
pde1a ![]() Pde1a, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pde1a/product/Santa Cruz Biotechnology Average 92 stars, based on 1 article reviews
pde1a - by Bioz Stars,
2026-02
92/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pde1a rn00578422 m1 ![]() Gene Exp Pde1a Rn00578422 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp pde1a rn00578422 m1/product/Thermo Fisher Average 85 stars, based on 1 article reviews
gene exp pde1a rn00578422 m1 - by Bioz Stars,
2026-02
85/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pde1a mm00450244 m1 ![]() Gene Exp Pde1a Mm00450244 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp pde1a mm00450244 m1/product/Thermo Fisher Average 90 stars, based on 1 article reviews
gene exp pde1a mm00450244 m1 - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
BPS Bioscience
insect cells ![]() Insect Cells, supplied by BPS Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/insect cells/product/BPS Bioscience Average 94 stars, based on 1 article reviews
insect cells - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp pde1a rn01515459 m1 ![]() Gene Exp Pde1a Rn01515459 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp pde1a rn01515459 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp pde1a rn01515459 m1 - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
Bayer HealthCare Pharmaceuticals Inc
diagnostics and therapeutics for diseases associated with phosphodiesterase 1a (pde1a) ![]() Diagnostics And Therapeutics For Diseases Associated With Phosphodiesterase 1a (Pde1a), supplied by Bayer HealthCare Pharmaceuticals Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/diagnostics and therapeutics for diseases associated with phosphodiesterase 1a (pde1a)/product/Bayer HealthCare Pharmaceuticals Inc Average 90 stars, based on 1 article reviews
diagnostics and therapeutics for diseases associated with phosphodiesterase 1a (pde1a) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
GeneTex
pde1a gtx145 99 antibody ![]() Pde1a Gtx145 99 Antibody, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pde1a gtx145 99 antibody/product/GeneTex Average 90 stars, based on 1 article reviews
pde1a gtx145 99 antibody - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
EZBiolab Inc
pde1a v7 c-terminal peptide fknnlvdiiqqnkerwkelaaqgcc ![]() Pde1a V7 C Terminal Peptide Fknnlvdiiqqnkerwkelaaqgcc, supplied by EZBiolab Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pde1a v7 c-terminal peptide fknnlvdiiqqnkerwkelaaqgcc/product/EZBiolab Inc Average 90 stars, based on 1 article reviews
pde1a v7 c-terminal peptide fknnlvdiiqqnkerwkelaaqgcc - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
dual-luciferase reporter gene assay human pde1a 3’-utr sequence (ugcauuuauuguauuuuaagauau) ![]() Dual Luciferase Reporter Gene Assay Human Pde1a 3’ Utr Sequence (Ugcauuuauuguauuuuaagauau), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dual-luciferase reporter gene assay human pde1a 3’-utr sequence (ugcauuuauuguauuuuaagauau)/product/GenScript corporation Average 90 stars, based on 1 article reviews
dual-luciferase reporter gene assay human pde1a 3’-utr sequence (ugcauuuauuguauuuuaagauau) - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Philosophical Transactions of the Royal Society B: Biological Sciences
Article Title: Phosphodiesterase-induced cAMP degradation restricts hepatitis B virus infection
doi: 10.1098/rstb.2018.0292
Figure Lengend Snippet: PDE4 and PDE12 restrict human NTCP expression in HepG2/NTCP cells. ( a ) mRNA expression of PDE1A, PDE1C, PDE4D and PDE12 in HepG2–NTCP cells. ( b ) Silencing efficiency of PDE1A, PDE1C, PDE4D and PDE12 in HepG2/NTCP cells, as determined by quantitative PCR. ( c ) Impact of lack of PDE1A, PDE1C, PDE4D and PDE12 expression on NTCP levels, either in the presence or absence of 2% DMSO treatment, as determined by western blot. ( d ) Immunofluorescence of NTCP and actin following treatment of HepG2–NTCP cells with DMSO, and/or Caffeine or Roflumilast. Data shown are mean (s.d.) of three independent experiments.
Article Snippet: Taqman ® Gene Expression assays against NTCP (human NTCP Hs00161820_m1) and PDEs 1A, 1C, 4D and 12 (
Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Immunofluorescence
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: A) Left and right TALENs designed to disrupt exon 7 of mPde1a (active site). B) Recovered mutations include an in-frame 15bp deletion and insertion of a single A. C) Effect on mPde1a protein, the 15bp in frame deletion (760_774) removes amino acids FAAAI and the insertion of an A (765_766) truncates mPde1a after four out of frame amino acids. D) Western blot of N-terminal V5-tagged wild-type and mutant mPde1a expressed in Xenopus oocytes detected with V5 antibody. E) PDE1 activity (Ca 2+ /calmodulin dependent hydrolysis of cAMP) in Xenopus oocytes injected with water, wild-type RNA or mutated RNAs. F) Western blot of kidney lysates showing a 64 kDa protein in wild-type mice (arrow) detected with a rabbit polyclonal antibody raised against recombinant human PDE1A (360 C-terminal amino acids); this band was markedly reduced in Pde1a Del15 and absent in Pde1a InsA homozygous mice. G) Reverse transcription of kidney RNA, PCR amplification and PvuII-HF restriction endonuclease digestion of a 485 bp PCR product, showing a 327 bp fragment in the wild-type and a 420 bp fragment in the mutants (smaller digest fragments are not resolved).
Article Snippet: Antibodies used were:
Techniques: TALENs, Western Blot, Mutagenesis, Activity Assay, Injection, Recombinant, Reverse Transcription, Amplification
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: Body and organ weights and laboratory parameters at 12 months of age.
Article Snippet: Antibodies used were:
Techniques:
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: A) Total PDE, PDE1, PDE3 and PDE4 activities in kidney and heart lysates from wild-type mice and from Pde1aDel15 and Pde1aInsA homozygous mice or results of both combined. B) Western blots of kidney and heart lysates from six wild-type mice detected with PDE1A, PDE1B and PDE1C antibodies; total protein stain with Coomassie Blue is used as a loading control. C) Cyclic AMP and cGMP levels in kidney and heart lysates from wild-type mice and from Pde1a Del15 and Pde1a InsA homozygous mice or results of both combined. D) Western blot of kidney, heart, aorta, liver, spleen and brain lysates from wild-type and Pde1a InsA homozygous mice detected with a PDE1A antibody; a weak cardiac band can be seen in wild-type with longer exposure (data not shown). One-way ANOVA with post-hoc Tukey test was used for the statistical analysis.
Article Snippet: Antibodies used were:
Techniques: Western Blot, Staining, Control
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: A) Body weight and kidney weight as percent of body weight (%KW/BW) in wild-type mice and in Pde1a Del15 and Pde1a InsA homozygous mice or data from both combined. B) Axial and coronal MR images of Pde1a mutant mice at 6 and 12 months of age showing small renal cysts (arrows; this panel is also shown as a larger figure in Fig B in ). C) Kidney sections from Pde1a Del15 and Pde1a InsA homozygous mice showing multiple small cysts staining positively for Tamm-Horsfall protein and epithelial membrane antigen, less consistently for aquaporin-2, and not staining for lysozyme. D) Reduced urine osmolality after 24 hours of dehydration, faster excretion of an acute water load, and E) reduced expression of glycosylated (upper band) and unglycosylated (lower band) pSer269-AQP2 in Pde1a Del15 and Pde1a InsA homozygotes compared to wild-type mice. One-way ANOVA with post-hoc Tukey test was used for the statistical analysis.
Article Snippet: Antibodies used were:
Techniques: Mutagenesis, Staining, Membrane, Expressing
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: Proliferative indices were significantly higher in the Pde1a mutants compared to the wild type mice. One-way ANOVA with post-hoc Tukey test was used for the statistical analysis.
Article Snippet: Antibodies used were:
Techniques:
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: A) Upper panels: Kidney weights as percent of body weights (%KW/BW) and renal cAMP levels in untreated or desmopressin treated wild-type and Pde1a InsA homozygous mice (upper panels); One-way ANOVA with post-hoc Tukey test was used for the statistical analysis; using a two-way ANOVA, both Pde1a null genotype P<0.001) and desmopressin treatment (P = 0.004) were associated with higher kidney to body weight ratios. Lower panels: Kidney sections stained with hematoxylin-eosin or immunostained with Tamm-Horsfall protein, epithelial membrane antigen or aquaporin-2 antibodies, and coronal MR image showing small cysts (arrows) in desmopressin treated Pde1a InsA homozygous mice. B) %KW/BW, kidney cystic indices, renal cAMP levels, and kidney sections stained with hematoxylin-eosin in untreated or desmopressin treated Pkd2 -/WS25 and Pkd2 -/WS25 ; Pde1a Del15/Del15 mice. One-way ANOVA with post-hoc Tukey test was used for the statistical analysis.
Article Snippet: Antibodies used were:
Techniques: Staining, Membrane
Journal: PLoS ONE
Article Title: Generation and phenotypic characterization of Pde1a mutant mice
doi: 10.1371/journal.pone.0181087
Figure Lengend Snippet: A) Aortic blood pressures were lower in Pde1a Del15 and Pde1a InsA homozygous mice compared to wild-type mice. B) Echocardiographic studies showing increased LV ejection fractions in Pde1a Del15 and Pde1a InsA homozygous mice compared to wild-types; RV: Right ventricle; LV: Left ventricle; IVS: Interventricular septum; PW: Posterior wall C) Measurements of LV mass index using MRI show no significant difference between wild-type and Pde1a mutant mice. One-way ANOVA with post-hoc Tukey test was used for the statistical analysis.
Article Snippet: Antibodies used were:
Techniques: Mutagenesis
Journal: Frontiers in Aging
Article Title: Microvascular Sex- and Age- Dependent Phosphodiesterase Expression
doi: 10.3389/fragi.2021.719698
Figure Lengend Snippet: Expression level of PDE1-5 transcripts in adult and juvenile skeletal muscle arterioles and venules of male and female rats. Arterioles and venules were isolated from abdominal skeletal muscles of four group rats: adult males (AM), adult females (AF), juvenile males (JM), and juvenile females (JF). Microvessel PDE 1-5 mRNA expression was measured by using TaqMan real-time RT-PCR assay. (A) The fold-change relative to β-actin for PDE gene expression was calculated as 2 −ΔCt , where ΔCt = Ct target gene –Ct β-actin . PDE5A mRNA levels were the highest among ten genes in arterioles and venules in each group ( n = 4–7, # p < 0.05). The order of expression levels in PDE1 family: 1A≈1C > 1B; likely for PDE4 family, 4B ≈ 4D > 4A. Expression levels of PDE3 family were relatively low vs. other families, in which there was no significant difference between PDE3A and PDE3B although there was a trend of low expression for PDE3A. These expression patterns were similar for both arterioles and venules in four group rats. (B) Sex-specific difference in PDE 1-5 mRNA levels. The relative fold-change between males and females were calculated by 2 −ΔΔCt , where ΔΔCt = ΔCt (high expression) –ΔCt (low expression) . In arterioles, levels of PDE1C, 3A, 3B, 4B, 5A were greater in adult males compared with adult females (i) ; PDE1A level was greater in juvenile females compared with juvenile males (ii) . In venules, expression levels of PDE3A, 3B, and 5A were higher in adult males compared with adult females (iii) ; PDE1B and 3A were higher in juvenile males compared with juvenile females (iv) . (C) Reproductive maturity-specific difference in PDE 1-5 mRNA level. Using the similar analysis to sex-specific difference, the fold-change between adult and juvenile with the same sex was expressed as 2 −ΔΔCt . In arterioles, expression levels of PDE1C, 3A, 3B, 4A were greater for adult males compared with juvenile males (i) ; PDE1A and 1C expression for juvenile females exceeded the counterparts for adult females and only PDE3A level was greater for adult females relative to juvenile females (ii) . In venules, PDE4D was greater in adult males relative to juvenile males (iii) whereas adult females expressed higher levels of PDE1B, 4A, and 4D relative to juvenile females (iv) . The data are means ± SEM of fold-changes. Experimental replication was 4–7 ( n = 4–7) and * indicates p < 0.05.
Article Snippet: TaqMan® Gene Expression Assay (
Techniques: Expressing, Isolation, Quantitative RT-PCR
Journal: Journal of Cellular and Molecular Medicine
Article Title: Rosiglitazone treatment restores renal responsiveness to atrial natriuretic peptide in rats with congestive heart failure
doi: 10.1111/jcmm.14366
Figure Lengend Snippet: Probes used for validation of PPARgamma‐regulated gene targets
Article Snippet: Pde1a , Phosphodiesterase 1A, calmodulin dependent ,
Techniques: Biomarker Discovery, Membrane