Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: Klp9 is a processive plus end-directed motor. ( A ) Photobleaching behaviour of a surface-bound spot of full-length Klp9-EGFP. ( B ) Histograms of initial intensities of surface-bound Klp9-EGFP (n = 933), dimeric kinesin-1-EGFP (n = 1007) and tetrameric Eg5-EGFP (n = 1111). The histograms were normalised by dividing the individual bins by the total number of fluorescence spots analysed. The upper-right inset shows cumulative probability of the same data. ( C ) Scheme of the in vitro microtubule gliding assay. ( D ) Representative time lapse images of the microtubule gliding assay. Paclitaxel-stabilised, polarity-marked microtubules were added to slides coated with purified full-length Klp9 proteins in the presence of 1 mM ATP. Microtubule gliding was viewed by TIRFM. Images were taken every 1 s, and the time in the panels, in seconds, is shown on the top right. Two microtubule ends moving towards the minus ends are shown with arrowheads and asterisks. Scale bar, 10 μm. ( E ) Distribution and the average value of gliding velocity. ( F ) Scheme of the single-molecule assay. ( G ) Processive motility of single full-length Klp9-EGFP molecules towards the plus end of paclitaxel-stabilised microtubules. Representative TIRFM kymograph depicting the movement of 0.3 nM Klp9-EGFP (orange) on a microtubule (blue) in the presence of 1 mM ATP is shown. Scale bar, 5 μm. ( H , I ) Velocity histogram ( H ) and cumulative probability ( I ) of single Klp9-EGFP molecules. The average value and the standard error of the mean values from the three independent experiments are shown (n = 50, 101 and 65). The mean run length value for each experiment was obtained by fitting each data set to 1−cumulative probability, Y = 1 − [1 − exp{(X 0 − X)/λ}], where λ represents the mean run length.

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Fluorescence, In Vitro, Gliding Assay, Purification

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: The Klp9 motor is an important determinant for spindle elongation rate during anaphase B. ( A ) Klp9-YFP becomes dispersed along the mitotic spindle in the klp9 motor mutants. Representative images showing mitotic localisation of Klp9-YFP in the indicated strains are presented. Cells of wild type, klp9 rigor and klp9-2 (carrying Klp9-YFP and mCherry-Atb2) were shifted from 27 °C to 36 °C, and incubated for 2 h. Scale bar, 10 μm. Lines used for quantification of Klp9-YFP signals in ( B ) are shown on the left panels. ( B ) Representative line scans of Klp9-YFP in wild type (grey line), klp9 rigor (dark blue line) and klp9-2 (blue line) taken along the spindle axis and between the two SPBs (dotted lines) as shown in ( A ). ( C ) Profiles of mitotic progression in klp9∆ (light blue line, n = 14), klp9 rigor (dark blue line, n = 15) or klp9-2 cells (blue line, n = 22). Each strain contains a tubulin marker (mCherry-Atb2) and an SPB marker (Cut12-GFP). Cells were grown at 36 °C for 4 h and live imaging performed thereafter. Changes of the inter-SPB distance were plotted against time. In each panel, patterns of wild type cells are plotted for comparison (grey line, n = 20). ( D ) Spindle growth rate during anaphase B. ( E ) The time between the initiation of SPB separation and onset of anaphase B. Data are given as means ± SD; **P < 0.01; ****P < 0.0001; n.s., not significant (two-tailed unpaired Student’s t -test).

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Incubation, Marker, Imaging, Comparison, Two Tailed Test

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: Klp9 plays an additional role during anaphase B independent of its motor activity in collaboration with Ase1. ( A ) Tetrad analysis. Spores were dissected upon crosses between klp9∆ and ase1∆ strains (top) or between klp9 rigor and ase1∆ strains (bottom), respectively. Individual spores (a–d) in each ascus (1–8) were dissected on YE5S plates and incubated for 3 d at 27 °C. Representative tetrad patterns are shown. Circles, triangles and squares with green lines indicate wild type, ase1∆ single mutants and klp9 single mutants, respectively. Assuming 2:2 segregation of individual markers allows the identification of lethal klp9∆ase1∆ double mutants (indicated by dashed magenta circles). Circles with magenta lines indicate klp9 rigor ase1∆ double mutants. ( B ) Spot test. Indicated strains were serially (10-fold) diluted, spotted onto rich YE5S plates and incubated at 27 °C or 36 °C for 2 d. cell conc ., cell concentration, temp ., temperature. ( C ) Summary of genetic interactions between the klp9 mutants ( klp9∆ , klp9 rigor or klp9-2 ) and cut7∆pkl1∆ or between the klp9 mutants and ase1∆ . SL, synthetic lethal. V, viable. ts, temperature sensitive.

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Activity Assay, Incubation, Spot Test, Concentration Assay

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: Systematic truncation and mutation analysis of Klp9 highlights the importance of NLS in the C-terminal non-motor region. ( A ) Schematic representation of full-length Klp9 (Klp9-FL), C-terminal truncation mutants ( ∆ 38C, ∆ 92C, ∆ 133C, ∆ 172C and ∆ 234C), an NLS mutant (KARAKA) and N-terminal truncation mutant ( ∆ Motor). The table on the right indicates a summary of the cellular localisation and the synthetic lethality of each klp9 mutant. ++, +, ± and − indicate normal, low, very low and invisible levels of Klp9-GFP localisation in the nucleus or the spindle midzone, respectively. SL, synthetic lethal. V, viable. ( B ) Representative images showing Klp9-GFP localisation during interphase (I) and mitosis (M) in the indicated strains are presented. Scale bar, 10 μm. ( C ) Quantification of Klp9-GFP levels at the midzone of spindle microtubules during anaphase B. Data are given as means ± SD; *P < 0.05; ****P < 0.0001 (two-tailed unpaired Student’s t -test). ( D ) Substituted amino acid residues in klp9 KARAKA mutant. These point mutations (K573AR574AK575A) were introduced upon site-directed mutagenesis and confirmed by nucleotide sequencing of the klp9 gene on the selected clone. ( E ) Spindle growth rate during anaphase B. Data are given as means ± SD; *P < 0.05; ****P < 0.0001 (two-tailed unpaired Student’s t -test).

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Mutagenesis, Two Tailed Test, Sequencing

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: Two internal coiled coil regions are crucial for Klp9 function in collaboration with Ase1. ( A ) Schematic representation of full-length Klp9 (Klp9-FL) and two internal deletion mutants. Each of coiled coil domains (Klp9-∆CC1: ∆421-461 and Klp9-∆CC2: ∆501-541) is deleted. The table on the right indicates a summary of the cellular localisation and the synthetic lethality of each klp9 mutant. ++ and − indicate normal and invisible levels of Klp9-GFP localisation in the nucleus or the spindle midzone, respectively. SL, synthetic lethal. V, viable. ( B ) Representative images showing Klp9-GFP localisation in the indicated strains during interphase (I) and mitosis (M) are presented. Scale bar, 10 μm. ( C ) Quantification of Klp9-GFP levels at the midzone of spindle microtubules during anaphase B. Data are given as means ± SD; ****P < 0.0001 (two-tailed unpaired Student’s t -test). ( D ) Tetrad analysis. Spores were dissected upon crosses between klp9 ∆CC1 and ase1∆ strains or between klp9 ∆CC2 and ase1∆ strains respectively. Individual spores (a–d) in each ascus (1–6) were dissected on YE5S plates and incubated for 3 d at 27 °C. Representative tetrad patterns are shown. Circles, triangles and squares with green lines indicate wild type, ase1∆ single mutants and klp9 ∆CC single mutants, respectively. Assuming 2:2 segregation of individual markers allows the identification of lethal klp9 ∆CC ase1∆ double mutants (indicated by dashed magenta circles). ( E ) Spindle growth rate during anaphase B. Data are given as means ± SD; ****P < 0.0001 (two-tailed unpaired Student’s t -test). ( F ) A positive correlation between Klp9 localisation on spindle midzone and spindle elongation rate. Data shown in Figs and 5C,E are plotted with regards to spindle growth rate (the vertical axis) and Klp9-GFP fluorescence intensities (the horizontal axis).

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Mutagenesis, Two Tailed Test, Incubation, Fluorescence

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: Kinesin-5 Cut7 collaborates with Klp9 in spindle elongation during anaphase B. ( A ) Spot test. Indicated strains were serially (10-fold) diluted, spotted onto rich YE5S plates and incubated at 27 °C or 36 °C for 2 d. cell conc ., cell concentration, temp ., temperature. ( B ) Mutation sites in the cut7-122 mutant. Cut7-122 contained two mutations (M134T and T290K) in the C-terminal motor domain. ( C ) Time-lapse images of mitotic wild type and cut7-122klp9Δ cells. Spindle microtubules (mCherry-Atb2; red) were visualised. Images were taken at 2 min intervals after incubation of cultures at 36 °C for 4 h. The cell peripheries are outlined with dotted lines. Scale bar, 10 μm. ( D ) Profiles of mitotic progression in cut7-122 (dark magenta line, n = 16) or cut7-122klp9Δ cells (light magenta line, n = 20). Each strain contains a tubulin marker (mCherry-Atb2). Cells were grown at 36 °C for 4 h and live imaging performed thereafter. Changes of the inter-SPB distance were plotted against time. Data for wild type (grey line, n = 20) and klp9Δ (light blue line, n = 14) are plotted for comparison and these are the same as those presented in Fig. . ( E ) Spindle growth rate during anaphase B. ( F ) The time between the initiation of SPB separation and onset of anaphase B. Data for wild type and klp9Δ are shown for comparison; these are the same as those presented in Fig. . Data are given as means ± SD; *P < 0.05; **P < 0.01; ****P < 0.0001; n.s., not significant (two-tailed unpaired Student’s t -test). ( G ) Summary of genetic interactions between cut7-122 and klp9 mutants or ase1Δ . V, viable. ts, temperature sensitive.

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Spot Test, Incubation, Concentration Assay, Mutagenesis, Marker, Imaging, Comparison, Two Tailed Test

Journal: Scientific Reports

Article Title: Kinesin-6 Klp9 plays motor-dependent and -independent roles in collaboration with Kinesin-5 Cut7 and the microtubule crosslinker Ase1 in fission yeast

doi: 10.1038/s41598-019-43774-7

Figure Lengend Snippet: A model of spindle elongation during anaphase B. Spindle elongation during late mitosis is executed by three MAPs, Kinesin-6 Klp9, Kinesin-5 Cut7 and the microtubule crosslinker Ase1. Klp9 plays dual roles in this process; one is motor-dependent and the other is motor-independent. Klp9 motor activity generates outward force, thereby inducing the sliding away of antiparallel microtubules at the spindle midzone (bottom left). Cut7 also generates outward force in an additive manner. This force-generating process collaborates with Ase1 to maintain microtubule bundling of anaphase B spindles and that Klp9 plays a role in this branch independently of its motility (bottom right). The motor-independent role of Klp9 requires the NLS and two coiled coil domains locating at the C-terminal non-motor region. Cut7 may not be involved in this microtubule crosslinking; or at least its role is less important compared with that played by Klp9.

Article Snippet: To construct a full-length Klp9 expressing vector (pcDNA3.4/SpKlp9FL-EGFP-FLAG-His8), the full-length klp9 cDNA was PCR amplified from a cDNA library (National BioResource Project, pTN-RC5) with a forward primer, ATGATACAGATTTTTCTGCGTGT and a reverse primer, AATTCATTAATATCGATATCAGTTG, and inserted into a modified pcDNA3.4 vector (pcDNA3.4/EGFP-FLAG-His8) via appropriate oligo nucleotide adaptors for the acceptor vector using the Gibson Assembly method.

Techniques: Activity Assay

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: A Luciferase Immunoprecipitation System (LIPS) assay was used to screen the IgG reactivity to the twelve identified antigens for reactivity with pooled sera from filaria infected and uninfected individuals. Reactivity of the antigens was tested using pooled sera from patients infected with W. bancrofti (Wb), O. volvulus (Ov), L. loa (Ll), and uninfected blood bank donors (Bb). Pooled Wb sera had high levels of anti-Wb5 IgG, while pools of Ov, Ll, and Bb sera had minimal anti-Wb5 reactivity. Cut-off values were based on 2.5x the average of blank controls.

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Luciferase, Immunoprecipitation, Lips Assay, Infection

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: Individual samples positive for W. bancrofti (Wb), L. loa (Ll), O. volvulus (Ov), S. stercoralis (Ss), and uninfected blood bank donors (Bb) were tested for anti-Wb5 IgG levels using a LIPS assay. W. bancrofti samples were from two locations: Cook Islands (red) and India (blue). The horizontal bar within each data set represents the geometric mean. W. bancrofti from Cook Islands (n = 24), W. bancrofti from India (n = 24), O. volvulus (n = 11), L. loa (n = 24), S. stercoralis (n = 12), uninfected controls (n = 12).

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Lips Assay

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: The monomeric structure of Wb5 was predicted by AlphaFold2 (a) and the multimeric form by AlphaFold2-multimer (ipTM: 0.524) (b, c). The model coloring is based on the pLDDT confidence measure in the B-factor field of AlphaFold predictions.

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques:

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: The reactivity of Wb5 constructs made in different expression systems ( E. coli , mammalian, baculoviral) and with different purification steps (Fc-tag and His-tag cleaved and uncleaved) was compared in ELISA using a pool of. W. bancrofti samples (Wb) and a pool of uninfected blood bank controls (Bb).

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Construct, Expressing, Purification, Enzyme-linked Immunosorbent Assay

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: Individual samples infected with W. bancrofti (Wb) and O. volvulus , L. loa , S. stercoralis , M. perstans (Other Helminths) and filaria uninfected samples were used to compare the IgG4 reactivity of Wb5 (a) and Wb123 (b) in Luminex assays. W. bancrofti samples were characterized as either positive (red) or negative (blue) using the cut-offs established by the ROC curves for Wb5 and Wb123 (c). A subset of these samples (n = 12) was negative for anti-Wb123 IgG4 antibodies, but positive for anti-Wb5 IgG4 antibodies. W. bancrofti (n = 231), O. volvulus (n = 21), L. loa (n = 22), S. stercoralis (n = 22), M. perstans (n = 22), uninfected donors (n = 148).

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Infection, Luminex

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: A LIPS assay was used to see the trend in IgG4 reactivity of Wb5 and Wb123 to samples over time from a W. bancrofti positive individual following definitive treatment (a) and in separate samples (n = 10) prior to and six months following treatment (Wb5: p = 0.0039, b; Wb123: p = 0.0020, c).

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Lips Assay

Journal: PLOS Neglected Tropical Diseases

Article Title: Wb5, a novel biomarker for monitoring efficacy and success of mass drug administration programs for Wuchereria bancrofti elimination

doi: 10.1371/journal.pntd.0013146

Figure Lengend Snippet: A LIPS assay was used to screen the IgG reactivity of Wb5 with B. malayi (n = 18) and B. timori (n = 20) samples (a). The IgG4 reactivity of Wb5 was also screened using B. timori samples (n = 19) (b).

Article Snippet: Wb5 was expressed recombinantly (Genscript, Piscataway, NJ) in a variety of expression systems - bacterial (pET30A vector; BL21 Star TM (DE3)), baculoviral (pFastBac1 vector; Sf9 cells), mammalian (pcDNA3.4 vector; CHO and 293-F cells).

Techniques: Lips Assay