Journal: The FEBS journal

Article Title: Pannexin 1 crosstalk with the Hippo pathway in malignant melanoma.

doi: 10.1111/febs.17396

Figure Lengend Snippet: Fig. 7. (A) Confocal images of 131/4-5B1 melanoma cells fixed and stained with anti-PANX1 (green). DNA was stained with Hoescht (blue). Samples incubated only with Alexa fluor 488 secondary antibodies were used as control (Secondary). Scale bar, 10 lm. Data are representative of three separate experiments. (B) Equal amounts of protein lysates from livers of WT and PANX1 KO mice were resolved by SDS/PAGE. Western blotting was performed using the antibodies indicated. The data represent the mean SE (error bars) of three separate experiments (N = 3). Statistical analysis was conducted using Student’s t-test *P < 0.05 compared to WT cells set to 1. (C) Equal amounts of protein lysates from the skin of WT and PANX1/PANX3 double KO (dKO) mice, 4 separate mice (N#1–4) per genotype, were resolved by SDS/PAGE. Western blotting was performed using the antibodies indicated. The data represent the mean SE (error bars) of 4 separate mice per genotype. Statistical analysis was conducted using Student’s t-test **P < 0.01 compared to WT cells set to 1.

Article Snippet: The plasmids from Addgene were kindly provided by Feng Zhang (Addgene plasmid #48140 and #62987). shRNA knockdown of PANX1 A375-P cells were transfected with two shRNA constructs (PANX1 shRNA-B and PANX1 shRNA-D) from Origene PANX1 human 29-mer shRNA kit in pRS vector (#TR302694) (sequence: 50-CGCAATGCTACTCCTGAC AAACCTTGGCATGTCAAGAGCATGCCAAGGTTTG TCAGGAGTAGCATTGTT-30) plus a GFP shRNA cassette (50-GCCCGCAAGCTGACCCTGAAGTTCATTCAA GAGATGAACTTCAGGGTCAGCTTGCTTTTT-30) from Addgene (#30323) as a control.

Techniques: Staining, Incubation, Control, SDS Page, Western Blot

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: ( A ) PANX1 was highly expressed in breast cancer (BRCA), colon adenocarcinoma (COAD), esophageal carcinoma (ESCA), head and neck squamous cell carcinoma (HNSC), kidney chromophobe (KICH), lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), and stomach adenocarcinoma (STAD) compared with normal tissues ( p < 0.001 as significant; Student’s t test) (TCGA-BRCA data; red bar: tumor tissue; blue bar: normal tissue); ( B ) correlation between PANX1 expression and overall survival (OS) in breast cancer under PAM50 molecular intrinsic subtypes (All (n = 1083), Luminal A (n = 560), Luminal B (n = 215), HER2-enriched (n = 82), Basal (n = 186), and Normal (n = 40)); ( C , D ) PANX1 expression under different PAM50 breast cancer molecular intrinsic subtype (TCGA-BRCA (n = 1083) and METABRIC (n = 1699) data, PAM50 algorithm; Turkey’s test) (* p < 0.05; ** p < 0.01; *** p < 0.001).

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Expressing

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: ( A ) ENTPD1 and NT5E expression in basal-like breast cancer under high and low level of PANX1 expression ( p < 0.01) (TCGA-BRCA (n = 186) and METABRIC (n = 199) basal-like subtype data; Student’s t test); ( B ) ENTPD1 and NT5E expression was positively correlated with PANX1 expression in basal-like breast cancer ( p < 0.001) (TCGA-BRCA and METABRIC basal-like subtype data; Pearson’s correlation); ( C ) ENTPD1 and NT5E expression in breast cancer specimens (Basal-like PANX1 high subgroup: n = 6; basal-like PANX1 low subgroup: n = 6; Luminal subtype: n = 3) ( p < 0.05; Turkey’s test); ( D ) ENTPD1 and NT5E expression in basal-like breast cancer surgical specimens with different PANX1 expression levels by immunohistochemistry at 10× and 20× magnifications (* p < 0.05; ** p < 0.01; *** p < 0.001).

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Expressing, Immunohistochemistry

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: Clinical characteristics of the included samples for immunohistochemistry.

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Immunohistochemistry

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: ( A ) CIBERSORT evaluated tumor-infiltrating immune cell (TIIC) differences under high (top 50%)/low (bottom 50%) PANX1 expression in basal-like subtype breast cancer (The key difference immune cells are shown by star (* p < 0.05); TCGA-BRCA basal-like subtype (n = 186) and GSE103091(n = 238) data); ( B ) GO analysis of PANX1 and its coexpression immune-related genes; ( C ) TIMER analysis of PANX1 expression and TIIC correlation (TCGA-BRCA data; n = 1083; Spearman’s rank correlation); ( D ) neutrophil abundance was positively correlated with PANX1 expression in METABRIC basal-like subtype data (R 2 = 0.32; p = 0.003; Pearson’s correlation) (CIBERSORT algorithms; n = 25, outliers have been filtered); ( E ) MPO (neutrophil marker) expression was positively correlated with PANX1 expression in TCGA-BRCA basal-like subtype data (n = 186; R 2 = 0.19; p < 0.001; Pearson’s correlation); ( F ) immunofluorescence detection of PANX1/MPO coexpression in basal-like breast cancer paraffin-embedded pathological specimens (DAPI, 4′,6-diamidino-phenylindole; MPO, myeloperoxidase).

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Expressing, Marker, Immunofluorescence

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: ( A ) The proportion of infiltrating TANs in Luminal (n = 3) and basal-like subtype (High PANX1 expression: n = 6; low PANX1 expression: n = 6) surgical specimens; ( B , C ) basal-like breast cancer with high PANX1 expression had more infiltrating TANs than basal-like breast cancer with low PANX1 expression and the Luminal subtype ( p < 0.05 for TIMER; p = 0.11 for quanTIseq; Student’s t test); ( D ) the correlation between ENTPD1/NT5E expression and TAN infiltration in basal-like breast cancer (n = 25; p < 0.05; R 2 = 0.28 (ENTPD1) and 0.23 (NT5E); Pearson’s correlation; TCGA-BRCA data; CIBERSORT-LM22 algorithms; outliers have been filtered); ( E ) TIMER analysis suggested a positive correlation between ENTPD1/NT5E expression and TAN infiltration in the basal-like subtype (n = 186; p < 0.01; Rho = 0.35 (ENTPD1) and 0.26 (NT5E); Spearman’s rank correlation; TCGA-BRCA data); ( F ) heatmap of the transcriptome analysis of TANs (n = 6) and PBNs (n = 6) in basal-like breast cancer (TANs, tumor-associated neutrophils; PBNs, peripheral blood neutrophils) (* p < 0.05).

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Expressing

Journal: Cancers

Article Title: High PANX1 Expression Leads to Neutrophil Recruitment and the Formation of a High Adenosine Immunosuppressive Tumor Microenvironment in Basal-like Breast Cancer

doi: 10.3390/cancers14143369

Figure Lengend Snippet: ( A ) Levels of exATP and exADO in MDA-MB-231, HCC-1937 and MCF-7 cell culture media; PANX1 knock down and probenecid (PRB) treatment reduced the levels of exATP and exADO in the supernatant of MDA-MB-231 and HCC-1937 cells (n = 19 for each group; p < 0.05; Student’s t test); ( B ) levels of exATP and exADO in the supernatant of digested tissue from triple-negative and Luminal A breast cancer surgical specimens ( p < 0.05; n = 9 for each group; Student’s t test); ( C ) the correlation between PANX1 expression and infiltration levels of neutrophils, Tregs, M2-like macrophages, MDSC cells, CD8 + T cells, and NK cells in the tumor microenvironment for Luminal B, HER2 enriched and basal-like breast cancer by TIMER (TCGA-BRCA data; Spearman’s rank correlation). (* p < 0.05; ** p < 0.01).

Article Snippet: MDA-MB-231 and HCC-1937 cells were transfected using the PANX1 human shRNA plasmid kit (OriGene, Rockville, MD, USA) (sequence: 5′-CGCAATGCTACTCCTGACAAACCTTGGCATGTCAAGAGCATGCCAAGGTTTGTCAGGAGTAGCATTGTT-3′).

Techniques: Cell Culture, Knockdown, Expressing

Journal: Nature Communications

Article Title: cfGWAS reveal genetic basis of cell-free DNA end motifs

doi: 10.1038/s41467-025-67940-w

Figure Lengend Snippet: A total of 28,016 pregnant women were included in this study, with clinical phenotypes from prenatal care and sequencing data from non-invasive prenatal testing (NIPT) collected. Fragmentation characteristics of cell-free DNA (cfDNA) were extracted from the sequencing data, and after genotype imputation, genotype data were obtained for genome-wide association studies (GWAS). A total of 104 phenotypes and 256 motifs were subjected to GWAS as phenotypic variables, discovering the novel associations of PANX1 and DNASE1L1 genes with the cfDNA end motifs. Experiments with gene knockout (KO) mice and cell lines were conducted to validate these associations. Additionally, a series of post-GWAS analyses was performed by integrating the one-sample 104 phenotypes GWAS results, reported associated loci from the GWAS catalog, and diseases reported in the OMIM database, to explore the biological mechanisms, causal relationship, and gene pleiotropy of cfDNA fragmentation characteristics. The icon of “Public databases” is the official icon of the GWAS catalog database. GWAS Catalog logo is available for re-use under CC-BY-4.0, https://creativecommons.org/licenses/by/4.0/ . Created in BioRender. Su, S. (2025) https://BioRender.com/m1tkhdf .

Article Snippet: The Panx1 -deficient mice model (C57BL/6JCya) was created by CRISPR/Cas-mediated genome engineering at Cyagen.

Techniques: Sequencing, GWAS, Gene Knockout

Journal: Nature Communications

Article Title: cfGWAS reveal genetic basis of cell-free DNA end motifs

doi: 10.1038/s41467-025-67940-w

Figure Lengend Snippet: A Box plot showing the MDS of cfDNA for plasma samples from wild-type (WT) and Panx1 KO mice. B and C Accumulated frequency of motifs showing significant positive and negative correlations, respectively, with SNPs in the PANX1 gene from GWAS analysis in plasma samples from WT and Panx1 KO mice. D Box plot of the MDS of cfDNA for cell culture supernatant from WT and PANX1 KO cell lines. E and F Accumulated frequency of motifs with significant positive and negative correlations, respectively, with SNPs in the PANX1 gene from GWAS analysis in cell culture supernatants from WT and PANX1 KO cell lines. These box plots are defined as follows: the center line represents the median, the box limits indicate the 25th and 75th percentiles, and the whiskers extend to the minimum and maximum values. Statistical significance, determined by a two-sided t -test, is indicated by asterisks with the following conventions: * p < 0.05, ** p < 0.01, and *** p < 0.001. Created in BioRender. Su, S. (2025) https://BioRender.com/m1tkhdf .

Article Snippet: The Panx1 -deficient mice model (C57BL/6JCya) was created by CRISPR/Cas-mediated genome engineering at Cyagen.

Techniques: Clinical Proteomics, Cell Culture

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: RNA was extracted from stable Rh30 cells expressing PANX1 or the GFP control for RNA-seq analysis 48 h post cumate induction. A Representative western blots of stable Rh30 cells expressing PANX1 and its GFP control prior to RNA extraction. Western blots are representative of three independent experiments. B Pie chart highlighting the number of genes identified by RNA-seq ( n = 3). Genes with an FDR cut-off of q < 0.05 after differential expression test are considered significantly changed. C Volcano plot showing gene expression profiles. Up- (Log 2 Fold > 1) and downregulated (Log 2 Fold < −1) genes are shown in red and green, respectively. The horizontal bar indicates the FDR cut-off ( q = 0.05). D DAVID gene ontology (GO) analysis of the significantly up- and downregulated genes. A list of enriched GO terms in biological processes is shown. The gene hits under GO: Regulation of apoptotic process ( E ) and GO: Negative regulation of migration ( F ) are shown along with their expression in cells expressing PANX1 relative to their respective GFP controls. G KEGG pathway analysis of the significantly up- and downregulated genes, of which the relative expression of the genes implicated in MAPK signaling ( H ) and Rap1 signaling ( I ) pathways are shown. RT-qPCR validation of RNA-seq hits MMP2 ( J ), TRAF2 ( K ), APOBEC2 ( L ), and MARCKS ( M ). Red and green bars indicate up- or downregulation from RNA-seq. Results are expressed as mean ± s.d. of three independent experiments. * P < 0.05 and ** P < 0.01 compared to GFP. GJA1 , which encodes Cx43, showing significantly increased transcript levels ( N ) from RNA-seq, and validation of its temporal increase in protein levels by western blotting ( O ) and its quantification ( P ) in Rh30 cells expressing PANX1 compared to the GFP control. * P < 0.05 compared to GFP on Day 8 and Day 10 in ( O ). Results are expressed as mean ± s.d. of three independent experiments.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Expressing, Control, RNA Sequencing, Western Blot, RNA Extraction, Quantitative Proteomics, Gene Expression, Migration, Quantitative RT-PCR, Biomarker Discovery

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: A Representative western blot of BirA*-PANX1 and Myc-PANX1 expressed in Rh18 (eRMS) and Rh30 (aRMS) cells. Western blots are representative of three independent experiments. B Sulforhodamine B dye uptake induced by mechanical stimulation in HEK293T cells expressing GFP (control), PANX1, or BirA*-PANX1. Results are expressed as mean ± s.d. of four independent experiments. *** P < 0.001 and ** P < 0.01 compared to GFP. 3D spheroid formation using our stable cumate-inducible Rh18 and Rh30 cell lines was assessed in the presence of cumate to allow PANX1 or BirA*-PANX1 expression. Representative images of Rh18 ( C ) and Rh30 ( D ) cells taken at 200 h are shown. As these cells express GFP constitutively, the changes in mean image fluorescence (MIF) over time, a measurement of spheroid size, were quantified for both Rh18 ( C ) and Rh30 ( D ) cells. Results are expressed as mean ± s.d. of three independent experiments. *** P < 0.001 compared to GFP for both PANX1 and BirA*-PANX1. A.U.: arbitrary units. Bars = 300 µm.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Western Blot, Expressing, Control, Fluorescence

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: Representative western blots of biotinylated proteins captured by streptavidin and BirA*-PANX1 in Rh18 (eRMS) ( A ) and Rh30 (aRMS) ( B ) are shown. BirA* and Myc-PANX1 were used as background controls for biotinylation and HPLC-ESI-MS/MS, respectively. Western blots are representative of three independent experiments. Top 50 protein hits in Rh18 ( C ) and Rh30 ( D ) identified by BioID are displayed. Results are shown as mean ± s.d. of Unique Peptide Counts normalized to the Myc-PANX1 background controls from three independent experiments. E Venn diagram showing the overlapping top 50 hits between Rh18 and Rh30 cells. F STRING analysis of the 43 overlapping hits reveals a PANX1 (red star) interactome consisting of plasma membrane (red), actin microfilament (blue) and microtubule (green) associated proteins.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Western Blot, Tandem Mass Spectroscopy, Clinical Proteomics, Membrane

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: BrdU incorporation of wild-type Rh18 (eRMS) ( A ) and Rh30 (aRMS) ( B ) cells expressing PANX1 or Myc-PANX1 and respective empty vector (EV) or GFP controls. Results are expressed as mean ± s.d. of three independent experiments. ** P < 0.01 and *** P < 0.001 compared to EV, # P < 0.05 compared to GFP. N.S. not significant. C Sulforhodamine B dye uptake induced by mechanical stimulation with HEK293T cells transiently expressing GFP, PANX1, or Myc-PANX1. Results are expressed as mean ± s.d. of four independent experiments. * P < 0.05 and ** P < 0.01 compared to GFP. Stable Rh18 and Rh30 cells expressing Myc-PANX1 or its GFP control vector were homogenized and separated by a sucrose gradient by ultra-highspeed centrifugation to enrich Myc-PANX1-containing subcellular fractions. The Myc-PANX1-enriched fractions or their corresponding GFP control fractions were pooled and subjected to co-immunoprecipitation by anti-Myc antibodies. The co-IP’ed samples were further analyzed by HPLC-ESI-MS/MS. Representative images of Rh18 ( D ) and Rh30 ( E ) cell lysates separated by a sucrose density gradient. Subcellular fractions of Rh18 ( F ) and Rh30 ( G ) cell lysates containing Myc-PANX1 were analyzed by western blotting and the quantification of Myc-PANX1 levels are shown below. The Myc-PANX1 enriched fractions, indicated by the shaded areas, and their corresponding GFP control fractions were combined separately for co-IP by anti-Myc antibodies and the subsequent HPLC-ESI-MS/MS analysis. Results are from two independent experiments.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: BrdU Incorporation Assay, Expressing, Plasmid Preparation, Control, Centrifugation, Immunoprecipitation, Tandem Mass Spectroscopy, Western Blot, Co-Immunoprecipitation Assay

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: The total protein hits in Rh18 (eRMS) and Rh30 (aRMS) cells identified by both BioID and co-IP using Myc-PANX1 enriched fractions were analyzed. Venn diagrams show 27 and 26 overlapping protein hits between the two HPLC-ESI-MS/MS approaches with Rh18 ( A ) and Rh30 ( B ) cells, respectively. STRING protein interaction network analysis of the overlapping hits from Rh18 ( C ) and Rh30 ( D ) cells. The proteins in the network are labeled according to their respective cell component GO terms: plasma membrane (red), actin microfilament (blue) and microtubules (green). PANX1 and the top hit AHNAK are marked with a red star. The shaded areas show clusters of plasma membrane associated protein hits.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Co-Immunoprecipitation Assay, Tandem Mass Spectroscopy, Labeling, Clinical Proteomics, Membrane

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: Stable Rh18 (eRMS) and Rh30 (aRMS) cells were induced to express PANX1 or Myc-PANX1 for 48 h and whole cell lysates were subjected to co-IP followed by western blotting analyses. The known PANX1 binding partner, ACTB, was pull-downed with Myc-PANX1 in Rh18 ( A ) and Rh30 ( B ) lysates using anti-Myc antibodies. In addition, PANX1 was pull-downed with AHNAK in both Rh18 ( C ) and Rh30 ( D ) lysates using anti-AHNAK antibodies. All western blots are representative of three independent experiments. E Immunofluorescence confocal laser microscopy showing colocalization (arrowheads) of transiently expressed PANX1 (red) and endogenous AHNAK (green) in Rh18 and Rh30 cells. DAPI-stained nuclei are shown in blue. Bar = 20 µm.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Co-Immunoprecipitation Assay, Western Blot, Binding Assay, Immunofluorescence, Microscopy, Staining

Journal: Oncogene

Article Title: Identification of pannexin 1-regulated genes, interactome, and pathways in rhabdomyosarcoma and its tumor inhibitory interaction with AHNAK

doi: 10.1038/s41388-020-01623-2

Figure Lengend Snippet: Rh18 (eRMS) and Rh30 (aRMS) cells were transiently transfected with siRNA targeting AHNAK or a scrambled siRNA non-targeting control (NTC). Representative western blots of Rh18 ( A ) and Rh30 ( B ) cells and their respective quantifications ( n = 3) of AHNAK levels 72 h following siRNA-mediated knockdown (KD). GAPDH was used as a loading control. ** P < 0.01 compared to NTC siRNA (−cumate); ## P < 0.01 and ### P < 0.001 compared to NTC siRNA (+cumate). PANX1 expression was induced with 30 µg/mL of cumate 48 h post AHNAK KD and then subjected to Alamar blue viability, scratch wound migration, and soft agar anoikis assays. Alamar blue assay of Rh18 ( n = 5) ( C ) and Rh30 ( n = 4) ( D ) showing percent (%) cell viability normalized to NTC siRNA (-cumate) of the respective cell line. * P < 0.05 and ** P < 0.01. Wound closure of Rh18 ( n = 3) ( E ) and Rh30 ( n = 4) ( F ) cells, were monitored for 60 or 80 h, respectively. The confluence of the wound area at the endpoint is shown as a percentage of the NTC siRNA (−cumate) from the respective cell line. * P < 0.05, ** P < 0.01 and *** P < 0.001. Rh18 ( n = 4) ( G ) and Rh30 ( n = 3) ( H ) cells were grown in suspension for 6 days and the number of viable cells counted by Trypan Blue dye exclusion assay on days 0, 3, and 6 are shown. Day 0 denotes the time of cell seeding on soft agar. * P < 0.05 and ** P < 0.01. Stable Rh18 and Rh30 cells were treated with 50 ng/µL doxycycline for 96 h to induce the expression of AHNAK shRNA or its NTC shRNA and then analyzed by western blotting to assess AHNAK KD efficiency. Representative western blots and their respective quantifications ( n = 3) of AHNAK levels in Rh18 ( I ) and Rh30 ( J ). GAPDH was used as a loading control. ** P < 0.01 compared to NTC shRNA. For Alamar blue viability assay, stable Rh18 and Rh30 cells were treated with 30 µg/mL of cumate for 48 h to allow PANX1 expression post shRNA-mediated AHNAK KD. Results are expressed as percent (%) cell viability of NTC shRNA of either Rh18 ( n = 3) ( K ) or Rh30 ( n = 4) ( L ) cells in the absence of PANX1 overexpression (−cumate). * P < 0.05 and ** P < 0.01. All results are expressed as mean ± s.d.

Article Snippet: PANX1 cDNA (Origene, Rockville, MD) was subcloned into pcDNA3.1-MCS-BirA*(R118G)-HA.

Techniques: Transfection, Control, Western Blot, Knockdown, Expressing, Migration, Alamar Blue Assay, Suspension, Exclusion Assay, shRNA, Viability Assay, Over Expression

Journal: Oncogenesis

Article Title: Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function.

doi: 10.1038/s41389-018-0100-4

Figure Lengend Snippet: Fig. 1 PANX1 is down-regulated in human eRMS and aRMS. a RT-qPCR analysis, b immunofluorescent labeling (PANX1, red), and c Western blot of six patient-derived RMS cell lines (three aRMS and three eRMS), undifferentiated (Undiff.) and differentiated (Diff.) human skeletal muscle myoblasts (HSMM) revealed that PANX1 transcript and protein levels are down-regulated when compared to differentiated HSMM. Myosin heavy chain (MHC, green) was used as a marker for myogenic differentiation. Tubulin was used as a loading control. ***P < 0.001 compared to differentiated HSMM. Results are expressed as mean ± s.d. d Representative images of human RMS primary tumors and normal skeletal muscle from formalin-fixed, paraffin- embedded sections were immunolabeled for PANX1 (red), which was quantified in e. The negative control, without primary antibodies, confirmed labeling specificity. ***P < 0.001 compared to normal skeletal muscle. Results are expressed as mean ± s.d. Blue = nuclei, bars = 30 µm

Article Snippet: Plasmid construction, transfections, and stable cell lines generation PANX1 cDNA (Origene, Rockville, MD, USA) was subcloned into pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, Palo Alto, CA, USA).

Techniques: Quantitative RT-PCR, Labeling, Western Blot, Derivative Assay, Marker, Control, Immunolabeling, Negative Control

Journal: Oncogenesis

Article Title: Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function.

doi: 10.1038/s41389-018-0100-4

Figure Lengend Snippet: Fig. 2 PANX1 expression inhibits RMS cell proliferation and migration. eRMS (Rh18) and aRMS (Rh30) cells ectopically expressing PANX1 were analyzed by BrdU incorporation and scratch wound migration assays. a Representative Western blot of eRMS (Rh18) and aRMS (Rh30) cells transiently transfected with PANX1. GAPDH was used as a loading control. BrdU incorporation assay showed a significant reduction of proliferation in eRMS (Rh18) (b) and aRMS (Rh30) (c) cells over-expressing PANX1. ***P < 0.001 and **P < 0.01 compared to GFP. Western blot analysis and quantification of eRMS (Rh18) (d) and aRMS (Rh30) (e) inducible stable cells over-expressing PANX1 after treatment with 30 µg/mL cumate for 24 h. Tubulin was used as loading control. ***P < 0.001 compared to GFP without cumate, GFP with cumate, and PANX1 without cumate. N.S.: not significant. Representative pictures and quantification of stable eRMS (Rh18) (f) and aRMS (Rh30) (g) cells, treated with or without cumate to induce PANX1 over-expression, subjected to scratch wound assay for 45 h. The dotted lines show cell boundaries after initial scratch. The confluence of the wound areas was quantified 45 h post wounding, which showed a significant reduction in cumate-treated PANX1 over-expressing stable eRMS (Rh18) (f) and aRMS (Rh30) (g) compared to their respective controls. **P < 0.01, *P < 0.05 compared to GFP without cumate, GFP with cumate, and PANX1 without cumate. Results are expressed as mean ± s.d. Bars = 300 µm

Article Snippet: Plasmid construction, transfections, and stable cell lines generation PANX1 cDNA (Origene, Rockville, MD, USA) was subcloned into pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, Palo Alto, CA, USA).

Techniques: Expressing, Migration, BrdU Incorporation Assay, Western Blot, Transfection, Control, Over Expression, Scratch Wound Assay Assay

Journal: Oncogenesis

Article Title: Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function.

doi: 10.1038/s41389-018-0100-4

Figure Lengend Snippet: Fig. 5 Expression of PANX1 decreases RMS tumor growth in vivo. Stable GFP control and PANX1 over-expressing eRMS (Rh18) and aRMS (Rh30) cells were injected orthotopically into the left and right gastrocnemius of the mice (mice randomly assigned, not a blinded method). PANX1 expression was maintained by intraperitoneal injection of cumate every 3 days. PANX1 over-expression in eRMS (Rh18) (a) and aRMS (Rh30) (b) cells led to a significantly reduced growth rate compared to their respective GFP controls. At endpoint, PANX1-expressing eRMS (Rh18) (c) and aRMS (Rh30) (d) xenografts weighted significantly less than the control tumors. Day 0 denotes the day of cell intramuscular (IM) injection. *P < 0.05, **P < 0.01, ***P < 0.001 compared to GFP. Results are expressed as mean ± s.d. Western blots of eRMS (Rh18) (e) and aRMS (Rh30) (f) xenografts demonstrate successful induction of PANX1 by cumate in vivo. Tubulin was used as loading control

Article Snippet: Plasmid construction, transfections, and stable cell lines generation PANX1 cDNA (Origene, Rockville, MD, USA) was subcloned into pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, Palo Alto, CA, USA).

Techniques: Expressing, In Vivo, Control, Injection, Over Expression, Western Blot

Journal: Oncogenesis

Article Title: Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function.

doi: 10.1038/s41389-018-0100-4

Figure Lengend Snippet: Fig. 7 C66S, C84S, and C265S PANX1 mutants are channel deficient. a Western blot of C66S, C84S, and C265S PANX1 mutants show banding patterns similar to wild-type PANX1 in HEK293T cells. The Gly0, Gly1, and Gly2 species of PANX1 are indicated. GAPDH was used as a loading control. b Expression of C66S, C84S, and C265S mutants in HEK293T cells did not increase dye uptake incidence, unlike wild-type PANX1 expressing cells. **P < 0.001 compared to GFP, #P < 0.01 compared to C66S, C84S, and C265S. c HEK293T cells were transfected with PANX1, C66S, C84S, and C265S constructs. The cells were then co-labeled for PANX1 (red) together with GM130 (Golgi apparatus marker) or calnexin (ER marker) in blue. Representative images show some co-localization (arrows) of PANX1 and the three mutants with calnexin. Bars = 8 µm. d Cell surface biotinylation experiments demonstrate that PANX1, as well as all three PANX1 mutants, are detected at the plasma membrane of HEK293T cells. GAPDH was used as a marker for cytosolic proteins, while EGFR was used as a marker for plasma membrane proteins. Densitometric analysis and quantification of cell surface biotinylation experiments show that all three mutants are localized at the cell surface in the same amount as PANX1. Cell surface expression was calculated relative to the total protein in input lanes (e), and was also calculated as absolute protein levels in the pulldown lanes (f)

Article Snippet: Plasmid construction, transfections, and stable cell lines generation PANX1 cDNA (Origene, Rockville, MD, USA) was subcloned into pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, Palo Alto, CA, USA).

Techniques: Western Blot, Control, Expressing, Transfection, Construct, Labeling, Marker, Clinical Proteomics, Membrane

Journal: Oncogenesis

Article Title: Pannexin 1 inhibits rhabdomyosarcoma progression through a mechanism independent of its canonical channel function.

doi: 10.1038/s41389-018-0100-4

Figure Lengend Snippet: Fig. 8 Channel defective PANX1 mutants reduce RMS tumor growth. Western blot of C66S, C84S, and C265S PANX1 mutants compared to wild- type PANX1 in eRMS (Rh18) (a) and aRMS (Rh30) cells (b). The Gly0, Gly1, and Gly2 species of PANX1 are indicated. GAPDH was used as a loading control. Similar to wild-type PANX1 expressing cells, no increase in dye uptake was observed when C66S, C84S, and C265S mutants were expressed in eRMS (Rh18) (a) and aRMS (Rh30) cells (b). 3D spheroid formation (c) and regression (d) assays described previously were performed using inducible eRMS (Rh18) and aRMS (Rh30) stable cell lines expressing either the C66S, C84S, or C265S PANX1 mutant and compared to cells expressing wild-type PANX1, as well as to GFP control cells. In both eRMS and aRMS cells, expression of PANX1 mutants inhibited formation of 3D spheroids (c) and caused their regression (d) similar to wild-type PANX1. ***P < 0.001 compared GFP; GFP treated with cumate; PANX1; and C66S or C84S or C265S mutant. N.S.: not significant. aRMS (Rh30) cells over-expressing the C265S mutant or the GFP control vector were injected orthotopically into the left and right gastrocnemius of the mice, respectively. Intraperitoneal injection of cumate was performed every 3 days. Expression of the C265S mutant significantly reduced aRMS xenograft growth rate (e). Expression of PANX1 and the C265S mutant both resulted in a diminution of ~50% in tumor volume when compared to control xenografts (f). N.S.: not significant. Day 0 denotes the day of intramuscular (IM) cell injection. *p < 0.05, **p < 0.01, ***p < 0.001 compared to GFP. Results are expressed as mean ± s.d

Article Snippet: Plasmid construction, transfections, and stable cell lines generation PANX1 cDNA (Origene, Rockville, MD, USA) was subcloned into pCDH-CuO-MCS-EF1-GFP lentiviral vector (System Biosciences, Palo Alto, CA, USA).

Techniques: Western Blot, Control, Expressing, Stable Transfection, Mutagenesis, Plasmid Preparation, Injection