pagm4723 Search Results


94
Addgene inc destination vector pagm4723
Destination Vector Pagm4723, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pm31663642-278-10-18?v=Addgene+inc
Average 94 stars, based on 1 article reviews
destination vector pagm4723 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

90
Addgene inc aagctcttcatccaatggccaagcctttgtctcaagaagaatccac r
Aagctcttcatccaatggccaagcctttgtctcaagaagaatccac R, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pmc07766473__pharmaceuticals___13___00481___s001-27-162-169?v=Addgene+inc
Average 90 stars, based on 1 article reviews
aagctcttcatccaatggccaagcctttgtctcaagaagaatccac r - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc psb90 backbone
Psb90 Backbone, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pmc12141139-125-7-9?v=Addgene+inc
Average 93 stars, based on 1 article reviews
psb90 backbone - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

91
Addgene inc pagm4723 plasmid
Pagm4723 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/bio_rxiv__2023__05__05__539534-300-14-16?v=Addgene+inc
Average 91 stars, based on 1 article reviews
pagm4723 plasmid - by Bioz Stars, 2026-08
91/100 stars
  Buy from Supplier

92
Addgene inc pagm4723gg
Pagm4723gg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pmc08364250-282-5-9?v=Addgene+inc
Average 92 stars, based on 1 article reviews
pagm4723gg - by Bioz Stars, 2026-08
92/100 stars
  Buy from Supplier

93
Addgene inc l2 destination vector pagm4723 del
L2 Destination Vector Pagm4723 Del, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/bio_rxiv__2022__10__18__512804-224-13-17?v=Addgene+inc
Average 93 stars, based on 1 article reviews
l2 destination vector pagm4723 del - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

90
GoldenGate Software Inc level 2 plasmid pagm4723
Level 2 Plasmid Pagm4723, supplied by GoldenGate Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pmc11310522-375-31-68?v=GoldenGate+Software+Inc
Average 90 stars, based on 1 article reviews
level 2 plasmid pagm4723 - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Addgene inc eyfp reporter protein
Eyfp Reporter Protein, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pagm4723/pm35015507-252-52-56?v=Addgene+inc
Average 90 stars, based on 1 article reviews
eyfp reporter protein - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results