|
Thermo Fisher
gene exp paf1 bt03239371 g1 83 ." width="250" height="auto" />Gene Exp Paf1 Bt03239371 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pmc07426922-68-0--1?v=Thermo+Fisher Average 88 stars, based on 1 article reviews
gene exp paf1 bt03239371 g1 - by Bioz Stars,
2026-08
88/100 stars
|
Buy from Supplier |
|
GroPep Bioreagents
anti barramundi igf 83 ." width="250" height="auto" />Anti Barramundi Igf, supplied by GroPep Bioreagents, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm25960447-88-30-32?v=GroPep+Bioreagents Average 90 stars, based on 1 article reviews
anti barramundi igf - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Bethyl
paf1 rabbit bethyl 83 ." width="250" height="auto" />Paf1 Rabbit Bethyl, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pmc07910549__41467_2021_21520_MOESM3_ESM-85-137-140?v=Bethyl Average 93 stars, based on 1 article reviews
paf1 rabbit bethyl - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
OriGene
lentiviral human paf1 shrnas ![]() Lentiviral Human Paf1 Shrnas, supplied by OriGene, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm39242538-50-16-21?v=OriGene Average 92 stars, based on 1 article reviews
lentiviral human paf1 shrnas - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
OriGene
qrt pcr paf1 5 ggaggaagagatggaggctgaa ![]() Qrt Pcr Paf1 5 Ggaggaagagatggaggctgaa, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pmc03478926__supp_jem__20112145_JEM_20112145_sm-19-46-52?v=OriGene Average 90 stars, based on 1 article reviews
qrt pcr paf1 5 ggaggaagagatggaggctgaa - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
origene cgagucaaguacugcaauagccucc ![]() Origene Cgagucaaguacugcaauagccucc, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm32471508-65-13-13?v=OriGene Average 91 stars, based on 1 article reviews
origene cgagucaaguacugcaauagccucc - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
paf1 ![]() Paf1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/bio_rxiv__64898__2026__01__27__701921-256-9-11?v=Santa+Cruz+Biotechnology Average 93 stars, based on 1 article reviews
paf1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Proteintech
paf1 ![]() Paf1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/bio_rxiv__64898__2026__01__27__701921-256-9-20?v=Proteintech Average 93 stars, based on 1 article reviews
paf1 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
OriGene
pex n his tagged cloning vector ![]() Pex N His Tagged Cloning Vector, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm32483358-153-8-11?v=OriGene Average 90 stars, based on 1 article reviews
pex n his tagged cloning vector - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
OriGene
rc200103l3 software ![]() Rc200103l3 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm36709426-225-199-197?v=OriGene Average 91 stars, based on 1 article reviews
rc200103l3 software - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
OriGene
pex2 ![]() Pex2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pmc08688145-263-6-15?v=OriGene Average 90 stars, based on 1 article reviews
pex2 - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
paf1 ![]() Paf1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/paf1/pm30135578-444-21-56?v=Addgene+inc Average 92 stars, based on 1 article reviews
paf1 - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
Image Search Results
83 ." width="100%" height="100%">
Journal: Scientific Reports
Article Title: Autophagy is a pro-survival adaptive response to heat shock in bovine cumulus-oocyte complexes
doi: 10.1038/s41598-020-69939-3
Figure Lengend Snippet: Genes evaluated by RT-qPCR using Applied BiosystemsTaqMan Assay
Article Snippet:
Techniques: RNA Binding Assay, Histone Deacetylase Assay, Binding Assay
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 1 PAF1 correlates with the aerobic glycolysis pathway genes in PDAC. A Single gene analysis of PAF1 with multiple pathways. B Enrichment plot of glycolysis pathway in pancreatic cancer. C Correlation analysis between PAF1 and genes of the aerobic pathway D. Immunohistochemical analysis of PAF1 and LDHA in PDAC progression tissue samples. E, F. A histoscore was calculated by multiplying intensity and positivity. Images were captured at ×20 magnification. Data represents mean ± SD. P-values were calculated using ordinary one-way ANOVA (multiple comparisons). ∗p < 0.05, ***p<0.001
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Immunohistochemical staining
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 2 Co-expression of PAF1/LDHA in PC models and loss of PAF1 reduces aerobic glycolytic genes expression. A. Immunofluorescence images of SW1990, MIA PaCa-2 and HPDE cell lines stained with PAF1 and LDHA antibody. Scale bar 20 μm B. Fluorescence mean intensity quantification of LDHA and PAF1 expression in Fig. 2 (A) C. Immunofluorescence images of Human PDAC and normal pancreas tissues stained with PAF1 and LDHA antibody. Scale bar 20 μm. D. Fluorescence mean intensity quantification of LDHA and PAF1 expression in Fig. 2 (C). Quantitative real-time PCR (qRT-PCR) analysis of PAF1, LDHA, LHHB, PDK1, HK2, PDHA1, ENO1, PKFL, PKFR, HK1 in Scr and PAF1 KD (E) SW1990 and (F) MIA PaCa-2 cells, qRT-PCR data were normalized with the β-Actin gene. (G) Western blot analysis of PAF1 and aerobic glycolysis genes expression in PAF1 KD and scramble SW1990 and MiaPaCa2 cells. β-actin was used as a control. Data are presented as the mean ± SD (*p<0.05,**p<0.01, ***p<0.001)
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Expressing, Immunofluorescence, Staining, Fluorescence, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Control
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 3 PAF1 reduction alters metabolism in PDAC. A PAF1 depletion reduces extracellular lactate production in SW1990 and MIA-PaCa-2. B PAF1 deple tion reduces intracellular glucose uptake in SW1990 and MIA PaCa-2 cells. C Overall ECAR curve of Scramble and PAF1 KD MIA PaCa-2 and SW1990 cells. Injection order: glucose (10mM), oligomycin (1 µM), and 2-DG (50 mM) for both MIA PaCa-2 and SW1990 cells. The overall ECAR curves were plotted as the mean ECAR ± SD of six replicates. D Overall oxygen consumption rate (OCR) curve of Scramble and PAF1 KD MIA PaCa-2 and SW1990 cells. Injection order: oligomycin (1 µM), FCCP (0.5 µM), and rotenone/ antimycin A (0.5 µM) for both MIA PaCa-2 and SW1990 cells. The overall OCR curves were plotted as the mean OCR ± SD of six replicates. E Bar graph showing the glycolysis capacity, Maximal Glycolysis and Glycolytic reserve of Scramble and PAF1 KD MIA PaCa-2 and SW1990 cells. F Bar graph showing the basal respiration, ATP-linked respiration and maximal respiration of Scramble and PAF1 KD MIA PaCa-2 and SW1990 cells. Data are presented as the mean ± SD (ns, not significant, **P < 0.01; ***P < 0.001; ****P < 0.0001). The representative images represent the mean ECAR and OCR ± SD of six replicates respectively
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Injection
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 4 PAF1 is co-expressed and interacts with HIF1α in PDAC. A Multiple correlation analysis between PAF1 and selected aerobic glycolysis transcription factors B Immunoprecipitation assay. PAF1 or HIF1α pulldown followed by immunoblotting with HIF1α, PAF1, LEO1, CDC73, CTR9 in indicated samples. Immunofluorescence images of C. SW1990, MIA PaCa-2, HPDE cell lines stained with PAF1 and HIF1α antibody. Scale bar 20 μm D. Fluorescence mean intensity quantification of HIF1α and PAF1 expression in Fig. 2 (C) E. Immunofluorescence images of Human PDAC and normal pancreas tissues stained with PAF1 and HIF1α antibody. Scale bar 20 μm. F. Fluorescence mean intensity quantification of HIF1α and PAF1 expression in Fig. 2(E)
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Immunoprecipitation, Western Blot, Immunofluorescence, Staining, Fluorescence, Expressing
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 5 PAF1 overexpression increases glycolytic rate and reduces mitochondrial respiration in normal cells. A qRT-PCR analysis of PAF1, LDHA, PDK1, HK2, PDHA1 and ENO1 in HPDE vector and PAF1 OE cells, qRT-PCR data were normalized with the β-Actin gene. B Western blot analysis of PAF1 and aerobic glycolysis genes expression in PAF1 OE and Vector HPDE cells, β-actin was used as a control. C Overall ECAR curve of Vector and PAF1OE HPDE cells. Injec tion order: glucose (10mM), oligomycin (1 µM), and 2-DG (50 mM). The overall ECAR curves were plotted as the mean ECAR ± SD of six replicates. D Bar graph showing the glycolysis capacity, Maximal Glycolysis and Glycolytic reserve of Vector and PAF1OE HPDE cells. E Overall oxygen consumption rate (OCR) curve of Vector and PAF1OE HPDE cells. Injection order: oligomycin (1 µM), FCCP (0.5 µM), and rotenone/ antimycin A (0.5 µM). The overall OCR curves were plotted as the mean OCR ± SD of six replicates. F Bar graph showing the basal respiration, ATP-linked respiration and maximal respiration of Vector and PAF1OE HPDE cells. Data are presented as the mean ± SD (ns, not significant, **P < 0.01; ***P < 0.001; ****P < 0.0001). The representative images represent the mean ECAR and OCR ± SD of six replicates respectively
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Over Expression, Quantitative RT-PCR, Plasmid Preparation, Western Blot, Expressing, Control, Injection
Journal: Cancer & metabolism
Article Title: PAF1/HIF1α axis rewires the glycolytic metabolism to fuel aggressiveness of pancreatic cancer.
doi: 10.1186/s40170-024-00354-2
Figure Lengend Snippet: Fig. 6 PAF1 regulates LDHA transcription through HIF1α binding. A Consensus Human HIF1α binding motif generated on https://jaspar.genereg.net/. B LDHA promoter sequence showing three HIF1α binding sites. C ChIP assay was performed using PAF1 and control IgG antibodies in MiaPaCa2 cells using primers that amplify LDHA promoter, which contains HIF1α binding motif. Immunoprecipitated and purified DNA was amplified using PCR followed by running in agarose gel. Binding site 2 and 3 did not amplify. D ChIP Re-ChIP assay was performed using PAF1, HIF1α and control IgG antibodies in Mia PaCa2 cells using primers that amplify LDHA promoter. Immunoprecipitated and purified DNA was amplified using PCR followed by running in agarose gel. Binding sites 2 and 3 did not amplify E ChIP assay was performed using PAF1 and control IgG antibodies in MiaPaCa2 shPAF1 cells using primers that amplify LDHA promoter for B.S.1. Immunoprecipitated and purified DNA was amplified using PCR followed by running in agarose gel. Binding site 1 did not amplify. F Representative sequence generated from PCR amplification and purification, with HIF1α binding motif highlighted. G Schematic shows the overall summary of the study
Article Snippet: Depletion of PAF1 using shRNA PAF1 knockdown in SW1990 and MIA PaCa-2 cells was performed using
Techniques: Binding Assay, Generated, Sequencing, Control, Immunoprecipitation, Purification, Amplification, Agarose Gel Electrophoresis
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Volcano plot of RNA Pol II-interacting proteins in C4-2 cells treated with 150 nM THZ531 (CDK12/13i), 20 nM NVP-2 (CDK9i) and 500 nM YKL-5-124 (CDK7i) for 4 h. The results show that 127, 43 and 72 proteins are significantly enriched under CDK12i, CDK9i and CDK7i, respectively, and 62, 18 and 12 proteins are significantly decreased (p < 0.05 and log2FC ± 1). B Upset plots compare the distribution of proteins that are significantly lost and gained after inhibition of CDK7, CDK9, or CDK12 under the 5-EU metabolic labeling method. C The dotplot shows the GO molecular function enrichment analysis of proteins that were significantly increased after inhibition of CDK7, CDK9, and CDK12. CDK12 inhibition specifically upregulated and enriched the “Damaged DNA Binding” and “Histone Acetylation” pathways, while CDK7i and CDK9i do not. D The protein-protein interaction (PPI) network (STRING database) of the adaptive complex formed around RNA Pol II, which exhibits significant increased interaction with RNA Pol II upon CDK12 inhibition, is centered on DDB1, BRD4, PAF1, and ELOA.
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Inhibition, Labeling, Binding Assay
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Prostate cancer cells depend on major transcription-associated cyclin-dependent kinases (CDK7, CDK9 and CDK12), whereas normal prostate cells show relative resistance to inhibitors targeting these kinases. Each cell line was cultured for 24 hours before treatment and then treated for 4 days in 50 nM YKL-5-124, 20 nM NVP-2 and 150 nM THZ531, respectively, and their cell viability was assessed using CellTiterGlo. The data is from three biological replicates, each having three technical replicates. B The results show that in the C4-2 cell line, PAF1 knockdown produced significant combined decrease in viability only with CDK12 inhibition. DDB1 knockdown produced significant combined decrease in viability with CDK12 and CDK9 inhibition, but not with CDK7 inhibition. BRD4 knockdown produced significant combined decrease in viability with CDK12, CDK9, and CDK7 inhibition. In the 22RV1 cell line, DDB1 and BRD4 knockdown produced combined decrease in viability with CDK12, CDK9, and CDK7 inhibition, but PAF1 knockdown produced significant combined lethality only with CDK12 inhibition. Cell viability after 4 days of DDB1, BRD4, and PAF1 knockdown with CDK7, CDK9, and CDK12 inhibitor treatments for the last three days. Data were obtained from three biological replicates (each containing three technical replicates), and the standard error of the mean was calculated. Student’s t -test was used to assess significance. C The knockdown of DDB1, BRD4, and PAF1 was confirmed by western blotting in castration-resistant prostate cancer cell lines C4-2 and 22RV1 (n=2).
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Cell Culture, Knockdown, Produced, Inhibition, Western Blot
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Knockdown of PAF1 in androgen-dependent cell line LNCaP induces combined reduction in cell viability with CDK12 inhibition, but does not trigger this combined effect with CDK9 and CDK7 inhibition. Knockdown of DDB1 in LNCaP induces combinatorial anti-proliferative effects with CDK12/13, CDK9, and CDK7 inhibition. Knockdown of BRD4 in LNCaP decreased cell viability with CDK9 and CDK7 inhibition but this effect is not significant with 150 nM treatment (CDK12/13) inhibition. B Knockdown of DDB1, BRD4, and PAF1 in the cell line immortalized from normal prostate epithelia, PNT1 does not induce significant combinatorial anti-proliferative effects with CDK12/13, CDK9, and CDK7 inhibition. Data were obtained from 3 biological replicates (each biological replicate contained 3 technical replicates), and the standard error of the mean was calculated. Significance was assessed using Student’s t -test.
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Knockdown, Inhibition
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Volcano plot of RNA Pol II-interacting proteins in C4-2 cells treated with 150 nM THZ531 (CDK12/13i), 20 nM NVP-2 (CDK9i) and 500 nM YKL-5-124 (CDK7i) for 4 h. The results show that 127, 43 and 72 proteins are significantly enriched under CDK12i, CDK9i and CDK7i, respectively, and 62, 18 and 12 proteins are significantly decreased (p < 0.05 and log2FC ± 1). B Upset plots compare the distribution of proteins that are significantly lost and gained after inhibition of CDK7, CDK9, or CDK12 under the 5-EU metabolic labeling method. C The dotplot shows the GO molecular function enrichment analysis of proteins that were significantly increased after inhibition of CDK7, CDK9, and CDK12. CDK12 inhibition specifically upregulated and enriched the “Damaged DNA Binding” and “Histone Acetylation” pathways, while CDK7i and CDK9i do not. D The protein-protein interaction (PPI) network (STRING database) of the adaptive complex formed around RNA Pol II, which exhibits significant increased interaction with RNA Pol II upon CDK12 inhibition, is centered on DDB1, BRD4, PAF1, and ELOA.
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Inhibition, Labeling, Binding Assay
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Prostate cancer cells depend on major transcription-associated cyclin-dependent kinases (CDK7, CDK9 and CDK12), whereas normal prostate cells show relative resistance to inhibitors targeting these kinases. Each cell line was cultured for 24 hours before treatment and then treated for 4 days in 50 nM YKL-5-124, 20 nM NVP-2 and 150 nM THZ531, respectively, and their cell viability was assessed using CellTiterGlo. The data is from three biological replicates, each having three technical replicates. B The results show that in the C4-2 cell line, PAF1 knockdown produced significant combined decrease in viability only with CDK12 inhibition. DDB1 knockdown produced significant combined decrease in viability with CDK12 and CDK9 inhibition, but not with CDK7 inhibition. BRD4 knockdown produced significant combined decrease in viability with CDK12, CDK9, and CDK7 inhibition. In the 22RV1 cell line, DDB1 and BRD4 knockdown produced combined decrease in viability with CDK12, CDK9, and CDK7 inhibition, but PAF1 knockdown produced significant combined lethality only with CDK12 inhibition. Cell viability after 4 days of DDB1, BRD4, and PAF1 knockdown with CDK7, CDK9, and CDK12 inhibitor treatments for the last three days. Data were obtained from three biological replicates (each containing three technical replicates), and the standard error of the mean was calculated. Student’s t -test was used to assess significance. C The knockdown of DDB1, BRD4, and PAF1 was confirmed by western blotting in castration-resistant prostate cancer cell lines C4-2 and 22RV1 (n=2).
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Cell Culture, Knockdown, Produced, Inhibition, Western Blot
Journal: bioRxiv
Article Title: Chromatin compaction upon CDK12 inhibition drives long gene silencing and a combinatorial lethal dependency on PAF1
doi: 10.64898/2026.01.27.701921
Figure Lengend Snippet: A Knockdown of PAF1 in androgen-dependent cell line LNCaP induces combined reduction in cell viability with CDK12 inhibition, but does not trigger this combined effect with CDK9 and CDK7 inhibition. Knockdown of DDB1 in LNCaP induces combinatorial anti-proliferative effects with CDK12/13, CDK9, and CDK7 inhibition. Knockdown of BRD4 in LNCaP decreased cell viability with CDK9 and CDK7 inhibition but this effect is not significant with 150 nM treatment (CDK12/13) inhibition. B Knockdown of DDB1, BRD4, and PAF1 in the cell line immortalized from normal prostate epithelia, PNT1 does not induce significant combinatorial anti-proliferative effects with CDK12/13, CDK9, and CDK7 inhibition. Data were obtained from 3 biological replicates (each biological replicate contained 3 technical replicates), and the standard error of the mean was calculated. Significance was assessed using Student’s t -test.
Article Snippet: Antibodies used are from ThermoFisher Scientific: DDB1 (2B12D1) and
Techniques: Knockdown, Inhibition