orc2 Search Results


93
Cyagen Biosciences orc2 f f mice
A. Scheme of introduced loxP sites in <t>Orc2</t> locus. B. Representative picture of genotyping of offspring coming from Orc2 f/+ crossed with Orc2 f/+ . C. The ratio of observed to expected animals coming from Orc2 f/+ crossed with Orc2 f/+ . D. Schematic of the <t>ORC2</t> <t>protein</t> and the DeltaORC2 protein produced after deletion of exons 6 and 7. A110 is mutated to V110 and then the protein goes out of frame. E. Validation of Orc2 deletion 3 days after Adeno cre transduction. F. Western blot of ORC2 protein 5 days after Adeno cre transduction. 10 or indicated ul of lysate loaded/lane as written on the top G. MTT assay of WT and Orc2 f/f MEFs without and with Adeno cre transduction. H. Western blot of ORC2 protein 5 and 15 days after Adeno cre transduction.
Orc2 F F Mice, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/bio_rxiv__2024__04__04__588006-159-0-6?v=Cyagen+Biosciences
Average 93 stars, based on 1 article reviews
orc2 f f mice - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology orc2 sirna duplexes
(A) FLAG-mouse <t>ORC2</t> or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. <t>HA-ORC2</t> <t>protein</t> is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.
Orc2 Sirna Duplexes, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc05049798-303-15-11?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
orc2 sirna duplexes - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti orc2
(A) FLAG-mouse <t>ORC2</t> or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. <t>HA-ORC2</t> <t>protein</t> is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.
Anti Orc2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc12331980-42-0-4?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
anti orc2 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Novus Biologicals anti orc2 antibody 3b7
(A) FLAG-mouse <t>ORC2</t> or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. <t>HA-ORC2</t> <t>protein</t> is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.
Anti Orc2 Antibody 3b7, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/10__1074_slash_jbc__m112__368456-51-0-13?v=Novus+Biologicals
Average 90 stars, based on 1 article reviews
anti orc2 antibody 3b7 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Bethyl anti orc2
(A) FLAG-mouse <t>ORC2</t> or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. <t>HA-ORC2</t> <t>protein</t> is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.
Anti Orc2, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc06827294-376-0-10?v=Bethyl
Average 93 stars, based on 1 article reviews
anti orc2 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Proteintech orc2
ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and <t>ORC1</t> <t>protein</t> levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.
Orc2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc12462987-305-47-49?v=Proteintech
Average 93 stars, based on 1 article reviews
orc2 - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Biosynth Carbosynth 2015 n a rabbit polyclonal anti orc2 fang
ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and <t>ORC1</t> <t>protein</t> levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.
2015 N A Rabbit Polyclonal Anti Orc2 Fang, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc06375733__mmc4-563-20-53?v=Biosynth+Carbosynth
Average 86 stars, based on 1 article reviews
2015 n a rabbit polyclonal anti orc2 fang - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

90
MBL Life science anti-orc2 (3b7) antibodies
ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and <t>ORC1</t> <t>protein</t> levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.
Anti Orc2 (3b7) Antibodies, supplied by MBL Life science, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/10__1128_slash_mcb__01290___09-60-0-5?v=MBL+Life+science
Average 90 stars, based on 1 article reviews
anti-orc2 (3b7) antibodies - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Becton Dickinson anti-orc2
ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and <t>ORC1</t> <t>protein</t> levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.
Anti Orc2, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc03554108-40-82-87?v=Becton+Dickinson
Average 90 stars, based on 1 article reviews
anti-orc2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Cyagen Biosciences mapk7 floxed mice with loxp sites flanking exons 4, 5, 6, and 7 of mapk7 gene
Loss of <t>MAPK7</t> in chondrocytes caused growth restriction and short limbs in postnatal mice. a Phenotype of Mapk7 CKO and CON littermates at P21. Scale bar, 1 cm. b Analysis of body length of Mapk7 CKO and CON mice at P21 ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Comparison of body weight between CON and Mapk7 CKO mice at various time points. Male and female mice were combined ( n = 4). * P < 0.05 (paired-sample t test). Data are presented as mean ± SD. d Representative image and ( e, f ) quantification analysis of limb bones from 60-day-old CON and Mapk7 CKO mice ( n = 6). Scale bar, 5 mm. * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD
Mapk7 Floxed Mice With Loxp Sites Flanking Exons 4, 5, 6, And 7 Of Mapk7 Gene, supplied by Cyagen Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc07488079-35-22-27?v=Cyagen+Biosciences
Average 90 stars, based on 1 article reviews
mapk7 floxed mice with loxp sites flanking exons 4, 5, 6, and 7 of mapk7 gene - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
Promega recombinant orc2 mutants
Loss of <t>MAPK7</t> in chondrocytes caused growth restriction and short limbs in postnatal mice. a Phenotype of Mapk7 CKO and CON littermates at P21. Scale bar, 1 cm. b Analysis of body length of Mapk7 CKO and CON mice at P21 ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Comparison of body weight between CON and Mapk7 CKO mice at various time points. Male and female mice were combined ( n = 4). * P < 0.05 (paired-sample t test). Data are presented as mean ± SD. d Representative image and ( e, f ) quantification analysis of limb bones from 60-day-old CON and Mapk7 CKO mice ( n = 6). Scale bar, 5 mm. * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD
Recombinant Orc2 Mutants, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pm16762929-53-0-35?v=Promega
Average 90 stars, based on 1 article reviews
recombinant orc2 mutants - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
GeneTex orc2
Loss of <t>MAPK7</t> in chondrocytes caused growth restriction and short limbs in postnatal mice. a Phenotype of Mapk7 CKO and CON littermates at P21. Scale bar, 1 cm. b Analysis of body length of Mapk7 CKO and CON mice at P21 ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Comparison of body weight between CON and Mapk7 CKO mice at various time points. Male and female mice were combined ( n = 4). * P < 0.05 (paired-sample t test). Data are presented as mean ± SD. d Representative image and ( e, f ) quantification analysis of limb bones from 60-day-old CON and Mapk7 CKO mice ( n = 6). Scale bar, 5 mm. * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD
Orc2, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/orc2/pmc03401479-185-37-38?v=GeneTex
Average 90 stars, based on 1 article reviews
orc2 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results


A. Scheme of introduced loxP sites in Orc2 locus. B. Representative picture of genotyping of offspring coming from Orc2 f/+ crossed with Orc2 f/+ . C. The ratio of observed to expected animals coming from Orc2 f/+ crossed with Orc2 f/+ . D. Schematic of the ORC2 protein and the DeltaORC2 protein produced after deletion of exons 6 and 7. A110 is mutated to V110 and then the protein goes out of frame. E. Validation of Orc2 deletion 3 days after Adeno cre transduction. F. Western blot of ORC2 protein 5 days after Adeno cre transduction. 10 or indicated ul of lysate loaded/lane as written on the top G. MTT assay of WT and Orc2 f/f MEFs without and with Adeno cre transduction. H. Western blot of ORC2 protein 5 and 15 days after Adeno cre transduction.

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Scheme of introduced loxP sites in Orc2 locus. B. Representative picture of genotyping of offspring coming from Orc2 f/+ crossed with Orc2 f/+ . C. The ratio of observed to expected animals coming from Orc2 f/+ crossed with Orc2 f/+ . D. Schematic of the ORC2 protein and the DeltaORC2 protein produced after deletion of exons 6 and 7. A110 is mutated to V110 and then the protein goes out of frame. E. Validation of Orc2 deletion 3 days after Adeno cre transduction. F. Western blot of ORC2 protein 5 days after Adeno cre transduction. 10 or indicated ul of lysate loaded/lane as written on the top G. MTT assay of WT and Orc2 f/f MEFs without and with Adeno cre transduction. H. Western blot of ORC2 protein 5 and 15 days after Adeno cre transduction.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Produced, Biomarker Discovery, Transduction, Western Blot, MTT Assay

A. Scheme of Alb +/- - Orc2 f/f crossed with Alb +/- - Orc2 f/f . B. The ratio of observed to expected animals coming from A. C. Western blot of liver tissue from Orc2 f/f and Alb-Orc2 f/f animals. Red stars point to lanes with comparable amounts of total loaded protein. Note that the liver has hematopoietic and other cells in addition to hepatocytes, which is why a trace amount of ORC2 will always be detected. D. Average body weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Average liver weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. F. Average liver to body weight ratio of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. G. Representative H&E staining of liver tissue from Orc2 f/f ROSA26 stop-EYFP (WT) and Alb-Orc2 f/f ROSA26 stop-EYFP (KO) animals. H. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP animals. I. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP female mice. J. Quantification of hepatocytes nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP male mice. *p < 0.05, **p < 0.01, two-tailed Student’s t test.

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Scheme of Alb +/- - Orc2 f/f crossed with Alb +/- - Orc2 f/f . B. The ratio of observed to expected animals coming from A. C. Western blot of liver tissue from Orc2 f/f and Alb-Orc2 f/f animals. Red stars point to lanes with comparable amounts of total loaded protein. Note that the liver has hematopoietic and other cells in addition to hepatocytes, which is why a trace amount of ORC2 will always be detected. D. Average body weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Average liver weight of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. F. Average liver to body weight ratio of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. G. Representative H&E staining of liver tissue from Orc2 f/f ROSA26 stop-EYFP (WT) and Alb-Orc2 f/f ROSA26 stop-EYFP (KO) animals. H. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP animals. I. Quantification of hepatocyte nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP female mice. J. Quantification of hepatocytes nuclear size in Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop- EYFP male mice. *p < 0.05, **p < 0.01, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Western Blot, Staining, Two Tailed Test

A. Experimental design B. Genotyping and western blotting of hepatocytes C. Representative picture of EdU, EYFP and DAPI staining on the Orc2 WT and KO primary hepatocytes. D. The percentage of EdU positive nuclei from Orc2 WT or Orc2 KO primary hepatocytes. *p < 0.05, two-tailed Student’s t test.

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Experimental design B. Genotyping and western blotting of hepatocytes C. Representative picture of EdU, EYFP and DAPI staining on the Orc2 WT and KO primary hepatocytes. D. The percentage of EdU positive nuclei from Orc2 WT or Orc2 KO primary hepatocytes. *p < 0.05, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Western Blot, Staining, Two Tailed Test

A. Schematic of the experiment. B. Body weight of the Orc2 f/f ROSA26stop-EYFP mice without (-/-) or with Alb-Cre (-/+) before partial hepatectomy. C. Liver weight of the mice in B after liver regeneration. D. Regenerated Liver to pre-hepatectomy body weight ratio of the mice in B. E. H&E stain of Orc2 f/f ROSA26stop-EYFP livers with intact Orc2 ( Alb-cre -/- , N=3) or Orc2 knockout ( Alb-cre+/- , N=7). Scale bar: 25 μm. F. Quantitation of nuclear counts per field (76,000 um2). Six images were taken for each liver. 0 hr (pre-resection). 36 hr (post-regeneration). G. EdU incorporation of indicated livers. EYFP marks cells where Cre has been expressed. Scale bar: 25μm. H. Percent EdU+ nuclei counted in 1882 and 825 nuclei in the Cre- and Cre+ livers, respectively. I. Nuclear size of indicated livers. 0 hr (pre-resection). 36 hr (post-regeneration). Mean and S.D from about 40-70 nuclei, *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test is used

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Schematic of the experiment. B. Body weight of the Orc2 f/f ROSA26stop-EYFP mice without (-/-) or with Alb-Cre (-/+) before partial hepatectomy. C. Liver weight of the mice in B after liver regeneration. D. Regenerated Liver to pre-hepatectomy body weight ratio of the mice in B. E. H&E stain of Orc2 f/f ROSA26stop-EYFP livers with intact Orc2 ( Alb-cre -/- , N=3) or Orc2 knockout ( Alb-cre+/- , N=7). Scale bar: 25 μm. F. Quantitation of nuclear counts per field (76,000 um2). Six images were taken for each liver. 0 hr (pre-resection). 36 hr (post-regeneration). G. EdU incorporation of indicated livers. EYFP marks cells where Cre has been expressed. Scale bar: 25μm. H. Percent EdU+ nuclei counted in 1882 and 825 nuclei in the Cre- and Cre+ livers, respectively. I. Nuclear size of indicated livers. 0 hr (pre-resection). 36 hr (post-regeneration). Mean and S.D from about 40-70 nuclei, *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test is used

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Staining, Knock-Out, Quantitation Assay, Two Tailed Test

A. Experimental design. B-D. Quantification of nuclei ploidy in the livers of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Representative result of flow cytometry analysis for Alb-Orc2 f/f ROSA26 stop-EYFP animals. The light blue and yellow profiles are from the EYFP negative and positive cells, respectively. F-H. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test.

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A. Experimental design. B-D. Quantification of nuclei ploidy in the livers of Orc2 f/f ROSA26 stop-EYFP and Alb-Orc2 f/f ROSA26 stop-EYFP animals. E. Representative result of flow cytometry analysis for Alb-Orc2 f/f ROSA26 stop-EYFP animals. The light blue and yellow profiles are from the EYFP negative and positive cells, respectively. F-H. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. *p < 0.05, **p < 0.01, ***p < 0.001, two-tailed Student’s t test.

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Flow Cytometry, Two Tailed Test

A-B. Breeding schemes to obtain conditional double flox animals. C. The ratio of observed to expected animals coming from B. Orc1 = all animals with Orc1 f/f ROSA26stop-EYFP , Orc2 = all animals with Orc2f/f ROSA26stop-EYFP , Orc1 Orc2 = all animals with Orc1 f/f Orc2 f/f ROSA26stop-EYFP genotype. This was before introduction of Alb-Cre . D. Representative H&E staining of liver tissue from male Orc1 f/f Orc2 f/f ROSA26stop-EYFP (WT) and Alb-Cre , Orc1 f/f Orc2 f/f ROSA26stop-EYFP (dKO) animals. E. Quantification of hepatocyte nuclear size in the WT and DKO animals. F. Average body, liver weight and their ratio for WT and DKO animals. G. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. H-J. Body weight pre-resection, liver weight post-regeneration and regenerated liver to body weight ratio in mice with indicated genotypes. 4 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (-/-) were used as control group and 6 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (+/-) were used as experimental group. No significant difference between the two groups using two tailed Student t-test. K: H&E stain of Orc1 f/f Orc2 f/f ROSA26stop-EYFP mice livers with intact Orc1, Orc2 ( Alb-cre -/- , N=4) or Orc1,Orc2 DKO ( Alb-cre +/- , N=6). Scale bar: 50 μm. L. Quantitation of hepatocyte nuclear size post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. About 120-200 nuclei are counted. M: Quantitation of hepatocyte nuclear density post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. N. Micrographs of EdU, DAPI and EYFP imaging of livers with indicated genotypes post regeneration. Scale bar: 20 μm. O. Quantitation of EdU positive nuclei post regeneration. Five-six images were taken for each liver. *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test were used

Journal: bioRxiv

Article Title: Endo-reduplication in mouse liver after conditional mutation of ORC2 and combined mutation of ORC1 and ORC2

doi: 10.1101/2024.04.04.588006

Figure Lengend Snippet: A-B. Breeding schemes to obtain conditional double flox animals. C. The ratio of observed to expected animals coming from B. Orc1 = all animals with Orc1 f/f ROSA26stop-EYFP , Orc2 = all animals with Orc2f/f ROSA26stop-EYFP , Orc1 Orc2 = all animals with Orc1 f/f Orc2 f/f ROSA26stop-EYFP genotype. This was before introduction of Alb-Cre . D. Representative H&E staining of liver tissue from male Orc1 f/f Orc2 f/f ROSA26stop-EYFP (WT) and Alb-Cre , Orc1 f/f Orc2 f/f ROSA26stop-EYFP (dKO) animals. E. Quantification of hepatocyte nuclear size in the WT and DKO animals. F. Average body, liver weight and their ratio for WT and DKO animals. G. Quantification of nuclei ploidy for EYFP low (negative) and high (positive) primary hepatocytes. H-J. Body weight pre-resection, liver weight post-regeneration and regenerated liver to body weight ratio in mice with indicated genotypes. 4 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (-/-) were used as control group and 6 males of Orc1f/f Orc2f/f ROSA26stop-EYFP mice with Alb-Cre (+/-) were used as experimental group. No significant difference between the two groups using two tailed Student t-test. K: H&E stain of Orc1 f/f Orc2 f/f ROSA26stop-EYFP mice livers with intact Orc1, Orc2 ( Alb-cre -/- , N=4) or Orc1,Orc2 DKO ( Alb-cre +/- , N=6). Scale bar: 50 μm. L. Quantitation of hepatocyte nuclear size post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. About 120-200 nuclei are counted. M: Quantitation of hepatocyte nuclear density post regeneration. 0 hr (pre-resection). 36 hr (post-regeneration). Five-six images were taken for each liver. N. Micrographs of EdU, DAPI and EYFP imaging of livers with indicated genotypes post regeneration. Scale bar: 20 μm. O. Quantitation of EdU positive nuclei post regeneration. Five-six images were taken for each liver. *p < 0.05, ****p < 0.0001, unpaired two-tailed Student’s t test were used

Article Snippet: Orc2 f/f mice were generated by Cyagen Biosciences Inc. Exons 6-7 (amino acids L111-V150) was selected as conditional knockout region (cKO).

Techniques: Staining, Control, Two Tailed Test, Quantitation Assay, Imaging

(A) FLAG-mouse ORC2 or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. HA-ORC2 protein is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) FLAG-mouse ORC2 or ORC1 were transfected into C33A cells with either BPV-1 E2 or E2R (aa 162–410). 24 hr later, E2 immunoprecipitations (II-1 antibody) were blotted with E2 B201 or M2 antibodies. (B) ORC2 interacts with the BPV-1 E2 transactivation domain (TAD, aa 1–216). FLAG-mouse ORC2 was transfected into C33A cells with BPV-1 E2, TAD or E2R. 24 hr later, groups without full length E2 were treated with 10 μM MG132 for 6 hr to maintain input protein levels of ORC2. B201 antibody immune complexes were blotted with B201 and M2 antibodies. The TAD domain of E2 is the same size as light chain IgG as indicated by * in the Fig 1B. (C) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E2. HA antibody immunoprecipitates were blotted with HA-7 and M2 antibodies. (D) HA-ORC2 was transfected into 293TT cells along with FLAG-HPV-31 E1 and FLAG-HPV-31 E2. HA antibody immunoprecipitations were blotted with ORC2 and FLAG antibodies. ORC2 was not detected in the inputs but was detected in the pull down. HA-ORC2 protein is approximately 70 kDa and FLAG-31E1 protein is approximately 75 kDa. (E) Human ORC2 protein was incubated with 6-His-BPV E2:1–216 and MBP-6-His-HPV-16 E6. Nickel complexes were blotted with E2 (B201), E6, and ORC2 antibodies.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Incubation

(A) In-situ proximity ligation assay (PLA) between FLAG-HPV-31 E2 and HA-hORC2. Fluorescent spots indicate interaction based DNA amplification occurring in the nucleus (stained blue). The no transfection group was used as a negative control with these antibodies. (B) PLA between FLAG-HPV-31 E2 and HA-HPV-31 E1. (C) PLA between FLAG-HPV-31 E2 and endogenous ORC2. Secondary antibodies only were used as a negative control.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) In-situ proximity ligation assay (PLA) between FLAG-HPV-31 E2 and HA-hORC2. Fluorescent spots indicate interaction based DNA amplification occurring in the nucleus (stained blue). The no transfection group was used as a negative control with these antibodies. (B) PLA between FLAG-HPV-31 E2 and HA-HPV-31 E1. (C) PLA between FLAG-HPV-31 E2 and endogenous ORC2. Secondary antibodies only were used as a negative control.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: In Situ, Proximity Ligation Assay, DNA Amplification, Staining, Transfection, Negative Control

(A) Baculovirus expressing human ORC2 protein was added to 0.5% NP-40 lysis buffer containing protein A and protein G agarose bead slurry, and either mouse anti-EE or an equal mix of mouse anti-ORC2 (MBL) and rat anti-ORC2 (Cell Signaling) antibodies. IPs were loaded on a SDS page gel and ORC2 was detected with the mouse anti-ORC2 antibody (MBL) by immunoblotting. (B) HPV-BP and (C) CIN612-9E cells were synchronized with 2.5 mM double thymidine. Inset diagram shows flow cytometry based cell cycle analysis. ChIP was performed using mouse anti-ORC2 antibodies (MBL). Real-time PCR was completed with primers to the HPV-16 or HPV-31 LCR, a known mammalian origin of replication (GM-CSF), and Exon 9, a non-specific DNA region used as a negative binding control. EE (non-specific IgG) did not bind to these regions of DNA in these experiments and is not shown here.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Baculovirus expressing human ORC2 protein was added to 0.5% NP-40 lysis buffer containing protein A and protein G agarose bead slurry, and either mouse anti-EE or an equal mix of mouse anti-ORC2 (MBL) and rat anti-ORC2 (Cell Signaling) antibodies. IPs were loaded on a SDS page gel and ORC2 was detected with the mouse anti-ORC2 antibody (MBL) by immunoblotting. (B) HPV-BP and (C) CIN612-9E cells were synchronized with 2.5 mM double thymidine. Inset diagram shows flow cytometry based cell cycle analysis. ChIP was performed using mouse anti-ORC2 antibodies (MBL). Real-time PCR was completed with primers to the HPV-16 or HPV-31 LCR, a known mammalian origin of replication (GM-CSF), and Exon 9, a non-specific DNA region used as a negative binding control. EE (non-specific IgG) did not bind to these regions of DNA in these experiments and is not shown here.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Expressing, Lysis, SDS Page, Western Blot, Flow Cytometry, Cell Cycle Assay, Real-time Polymerase Chain Reaction, Binding Assay, Control

(A) C33A were transfected with the FLAG-HPV-31 E2 expression vector. 24 hours later cells were lysed (0.5% NP-40). The lysate from cells untransfected and cells transfected with FLAG-HPV-31 E2 were added to lysis buffer containing protein A and protein G bead slurry and rabbit anti-HPV-31 E2 serum. IPs were immunoblotted with M2 antibodies. (B) CIN612-9E cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, an equal mix of rat and mouse anti-ORC2 (Cell Signaling/MBL) or rabbit anti-HPV-31 E2 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-31 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE. (C) C33A cells were transfected with FLAG-HPV-31 E1 expression vector and lysates were immunoprecipiated with mouse anti-EE, rabbit anti-16 E1, and rat anti-16 E1 antibodies and then immunoblotted with M2 antibodies. (D) W12 cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, equal mix of rat and mouse anti-ORC2 antibodies (Cell Signaling/MBL), or rat anti-HPV-16 E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-16 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR3 and E6 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) C33A were transfected with the FLAG-HPV-31 E2 expression vector. 24 hours later cells were lysed (0.5% NP-40). The lysate from cells untransfected and cells transfected with FLAG-HPV-31 E2 were added to lysis buffer containing protein A and protein G bead slurry and rabbit anti-HPV-31 E2 serum. IPs were immunoblotted with M2 antibodies. (B) CIN612-9E cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, an equal mix of rat and mouse anti-ORC2 (Cell Signaling/MBL) or rabbit anti-HPV-31 E2 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-31 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE. (C) C33A cells were transfected with FLAG-HPV-31 E1 expression vector and lysates were immunoprecipiated with mouse anti-EE, rabbit anti-16 E1, and rat anti-16 E1 antibodies and then immunoblotted with M2 antibodies. (D) W12 cells were synchronized with 2.5 mM double thymidine. ChIP experiments were performed using mouse anti-EE, equal mix of rat and mouse anti-ORC2 antibodies (Cell Signaling/MBL), or rat anti-HPV-16 E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in and around the HPV-16 LCR. The locations of the primers are shown below the horizontal axis with the ori labeled. E2 binding sites are located between the LCR3 and E6 primer sets. Ct values are normalized to input and EE was set to equal 1. Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to EE.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Expressing, Plasmid Preparation, Lysis, Real-time Polymerase Chain Reaction, Labeling, Binding Assay

(A) Replication luciferase assays were completed with pFLORI31 and ORC2 depletion. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. ORC2 shRNA decreased ORC2 protein expression in C33A cells. (B) ORC2 shRNA decreased EBNA-1 based replication using the pREP4 plasmid (EBNA-1 based replication) in C33A cells. (C) ORC2 shRNA decreased ORC2 protein expression in HPV-BP and SiHa cells. (D) ORC2 knockdown increased HPV replication in cells containing HPV-16 episomes (HPV-BP) but not in cells with integrated HPV-16 (SiHa). HPV-BP and SiHa cells were transfected with 5.5 μg of shRNA hairpins. 7d later, cells were harvested and HPV-16 copy number (HPV-16 LCR) as normalized to GM-CSF ori #2. This experiment was performed three times with a representative image presented here.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Replication luciferase assays were completed with pFLORI31 and ORC2 depletion. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. ORC2 shRNA decreased ORC2 protein expression in C33A cells. (B) ORC2 shRNA decreased EBNA-1 based replication using the pREP4 plasmid (EBNA-1 based replication) in C33A cells. (C) ORC2 shRNA decreased ORC2 protein expression in HPV-BP and SiHa cells. (D) ORC2 knockdown increased HPV replication in cells containing HPV-16 episomes (HPV-BP) but not in cells with integrated HPV-16 (SiHa). HPV-BP and SiHa cells were transfected with 5.5 μg of shRNA hairpins. 7d later, cells were harvested and HPV-16 copy number (HPV-16 LCR) as normalized to GM-CSF ori #2. This experiment was performed three times with a representative image presented here.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Luciferase, shRNA, Expressing, Plasmid Preparation, Knockdown, Transfection

(A) ORC2 siRNA duplexes decreased ORC2 protein levels at a concentration of 15 or 5 nM after 48 h. (B) CIN612-9E cells were transfected with RLuc and pFLORI31. 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (C) CIN612-9E cells were transfected with 15 nM ORC2 and differentiated in 10% FBS DMEM + 2 mM CaCl 2 for 48h. Involucrin and β-actin levels were analyzed. (D) CIN612-9E cells were transfected with RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in either E-medium or 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (E) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs, RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (F) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs and placed in 10% FBS DMEM + 2 mM CaCl 2 for 72 h. DNA was isolated and HPV-31 DNA content was measured by RT-PCR and normalized to β-actin levels. The ORC2 siRNA group was normalized to the control siRNA group (control siRNA = 1). Values are expressed mean +/-. * p-value ≤ 0.05.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) ORC2 siRNA duplexes decreased ORC2 protein levels at a concentration of 15 or 5 nM after 48 h. (B) CIN612-9E cells were transfected with RLuc and pFLORI31. 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (C) CIN612-9E cells were transfected with 15 nM ORC2 and differentiated in 10% FBS DMEM + 2 mM CaCl 2 for 48h. Involucrin and β-actin levels were analyzed. (D) CIN612-9E cells were transfected with RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in either E-medium or 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (E) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs, RLuc and pFLORI31. Five hours later, the transfection was removed and cells were placed in 10% FBS DMEM + 2 mM CaCl 2 . 48h later cells were lysed and luciferase activity measured. Values are expressed as mean +/- SEM. * p-value ≤ 0.05. (F) CIN612-9E cells were transfected with 15 nM control or ORC2 siRNAs and placed in 10% FBS DMEM + 2 mM CaCl 2 for 72 h. DNA was isolated and HPV-31 DNA content was measured by RT-PCR and normalized to β-actin levels. The ORC2 siRNA group was normalized to the control siRNA group (control siRNA = 1). Values are expressed mean +/-. * p-value ≤ 0.05.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Concentration Assay, Transfection, Luciferase, Activity Assay, Control, Isolation, Reverse Transcription Polymerase Chain Reaction

CIN612-9E cells were transfected with 30 nM of control or ORC2 siRNAs for 48 h. ChIP experiments were performed using (A) rabbit anti-HPV-31 E2 antibodies or (B) rat E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in HPV-31 LCR previously found to be enriched for E2 binding. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control siRNA.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: CIN612-9E cells were transfected with 30 nM of control or ORC2 siRNAs for 48 h. ChIP experiments were performed using (A) rabbit anti-HPV-31 E2 antibodies or (B) rat E1 antibodies. Real-time PCR was performed with primers listed in Materials and Methods located in HPV-31 LCR previously found to be enriched for E2 binding. E2 binding sites are located between the LCR2 and LCR4 primer sets. Ct values are normalized to input and values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control siRNA.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Transfection, Control, Real-time Polymerase Chain Reaction, Binding Assay

(A) Lysates (1% NP-40) for i31E2 cells ± Dox and control/HPV-16E2 U2OS cell lines were blotted with FLAG-M2 (HPV-31 E2), TGV261 (HPV-16 E2), ORC2 (MBL) and β-actin antibodies. (B,C) TRE-x U2OS cells containing pcDNA4/TO-FLAG 31E2 (i31E2, ± 48h Dox treatment) and Control and 16E2 U2OS cells were treated overnight with 2.5 mM thymidine, released the next day for 6h, followed by 2.5 mM thymidine treatment overnight. ChIP was performed with an equal mix of mouse/rat-ORC2 antibodies (MBL/Cell Signaling) on the GM-CSF ori (B) or the lamin B2 (LB) ori (C). ChIP experiments were performed at least three times. The Ct values for ORC2 binding were first normalized to input for each cell line. ORC2 levels for the E2 expressing cell lines were normalized to the control cell lines (no E2). Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control cell line.

Journal: PLoS Pathogens

Article Title: The Replicative Consequences of Papillomavirus E2 Protein Binding to the Origin Replication Factor ORC2

doi: 10.1371/journal.ppat.1005934

Figure Lengend Snippet: (A) Lysates (1% NP-40) for i31E2 cells ± Dox and control/HPV-16E2 U2OS cell lines were blotted with FLAG-M2 (HPV-31 E2), TGV261 (HPV-16 E2), ORC2 (MBL) and β-actin antibodies. (B,C) TRE-x U2OS cells containing pcDNA4/TO-FLAG 31E2 (i31E2, ± 48h Dox treatment) and Control and 16E2 U2OS cells were treated overnight with 2.5 mM thymidine, released the next day for 6h, followed by 2.5 mM thymidine treatment overnight. ChIP was performed with an equal mix of mouse/rat-ORC2 antibodies (MBL/Cell Signaling) on the GM-CSF ori (B) or the lamin B2 (LB) ori (C). ChIP experiments were performed at least three times. The Ct values for ORC2 binding were first normalized to input for each cell line. ORC2 levels for the E2 expressing cell lines were normalized to the control cell lines (no E2). Values are expressed as mean +/- SEM. * p-value ≤ 0.05 compared to control cell line.

Article Snippet: The transfection reaction contained Lipofectamine 2000 (Invitrogen) and either control siRNA (Santa Cruz; sc-37007) or ORC2 siRNA duplexes (UUGAAGAAGGAGCGAGCGCAGCUUU [ ], IDT) at a final concentration 15 nM.

Techniques: Control, Binding Assay, Expressing

ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and ORC1 protein levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.

Journal: Advanced Science

Article Title: Topoisomerase I Inhibition in ETV4‐overexpressed Non‐Small Cell Lung Cancer Promotes Replication and Transcription Mediated R‐Loop Accumulation and DNA Damage

doi: 10.1002/advs.202409307

Figure Lengend Snippet: ETV4 transcriptionally controls key genes involved in DNA replication of NSCLC cells. A) Functional analysis showing the top KEGG pathways that are significantly associated with down‐regulated genes in H1299, H1703, and H358T si‐ETV4 groups normalized to negative control (NC) siRNA groups by Human Microarray ( GSE137445 ). B) Clustering analysis showing the gene signature is enriched in the DNA replication pathway. C) IGV tracks showing the enrichment of ETV4 at the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 from ChIP‐seq signals of A549‐shETV4 cells transfected with Flag‐ETV4 plasmids. D) ChIP‐PCR analysis for endogenous or exogenous ETV4 binding to the promoter region of MCM2, ‐4, ‐5, ‐10, and ORC1 genes in H1299 cells using anti‐ETV4 antibody or H358‐ETV4 cells using anti‐Flag antibody. E) Schematic depicting the core motif of ETV4 binding with its target genes, the wild‐type luciferase reporter constructs, and the mutations in the putative ETV4‐binding sites (mut‐1 or mut‐2 type) of MCMs/ORC1 promoter region. F–J) The wild‐type luciferase reporter plasmids of MCMs (ORC1) were co‐transfected along with ETV4, ETV4‐DBD deletion plasmid, or the empty vector into HEK293T cells. The constructed luc‐MCMs (ORC1)‐mut‐1 or ‐mut‐2 type plasmids were co‐transfected along with ETV4 plasmid or the empty vector into HEK293T cells. Relative luciferase activity was normalized against Renilla luciferase activity, respectively (mean ± SD; n = 4; ordinary one‐way ANOVA with Tukey's multiple comparisons test). **** p < 0.0001; ### p < 0.001, #### p < 0.0001. K) RT‐qPCR analysis of MCM2, ‐4, ‐5, ‐10, and ORC1 mRNA expression in H1299 cells transfected with ETV4 or NC siRNA, Transcript levels were normalized to ACTB gene expression (mean ± SD, n = 3; two‐tailed unpaired t ‐test). ** p < 0.01; *** p < 0.001; **** p < 0.0001. L) Immunoblots showing MCM2, ‐4, ‐5, ‐10, and ORC1 protein levels in NC and ETV4‐knockdown H1299 cells. M,N) Immunoblots showing the Chromatin‐bound proteins (Chrom.) and unbound proteins (Sol.) levels of MCM2, ‐4, ‐5, ‐10, and ORC1 protein in control and sh‐ETV4 A549 cells, or control and ETV4‐overexpression H358 cells.

Article Snippet: Blots were blocked with 5% nonfat milk in Tris‐Buffered Saline and Tween 20 (TBST), and incubated with antibodies specific for ETV4 (10684‐1‐AP, Proteintech), MCM2 (3619, CST), MCM3 (15597‐1‐AP, Proteintech), MCM4 (13043‐1‐AP, Proteintech), MCM5 (11703‐1‐AP, Proteintech), MCM6 (13347‐2‐AP, Proteintech), MCM7 (11225‐1‐AP, Proteintech), MCM10 (12251‐1‐AP, Proteintech), ORC1 (NBP100‐121, Novus), ORC2 (12739‐1‐AP, Proteintech), ORC3 (sc‐374231, Santa Cruz), ORC4 (13026‐1‐AP, Proteintech), ORC5 (11542‐1‐AP, Proteintech), ORC6 (17784‐1‐AP, Proteintech), Histone‐H3 (17168‐1‐AP, Proteintech), PCNA (13110, CST), phospho‐MCM2 S40 (ab133243, Abcam), CDC45 (15678‐1‐AP, Proteintech), SUPT16H (28598‐1‐AP, Proteintech), SSRP1 (15696‐1‐AP, Proteintech), γ‐H2AX (ET‐1602, HUABio), Flag (14793, CST), His (66005‐1‐Ig, Proteintech), HA (sc‐7392, Santa Cruz), GST (66001‐2‐lg, Proteintech), GAPDH (60004‐1‐Ig, Proteintech) and β‐actin (66009‐1‐Ig, Proteintech) was used as a loading control for Western blot.

Techniques: Functional Assay, Negative Control, Microarray, ChIP-sequencing, Transfection, Binding Assay, Luciferase, Construct, Plasmid Preparation, Activity Assay, Quantitative RT-PCR, Expressing, Gene Expression, Two Tailed Test, Western Blot, Knockdown, Control, Over Expression

Loss of MAPK7 in chondrocytes caused growth restriction and short limbs in postnatal mice. a Phenotype of Mapk7 CKO and CON littermates at P21. Scale bar, 1 cm. b Analysis of body length of Mapk7 CKO and CON mice at P21 ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Comparison of body weight between CON and Mapk7 CKO mice at various time points. Male and female mice were combined ( n = 4). * P < 0.05 (paired-sample t test). Data are presented as mean ± SD. d Representative image and ( e, f ) quantification analysis of limb bones from 60-day-old CON and Mapk7 CKO mice ( n = 6). Scale bar, 5 mm. * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Loss of MAPK7 in chondrocytes caused growth restriction and short limbs in postnatal mice. a Phenotype of Mapk7 CKO and CON littermates at P21. Scale bar, 1 cm. b Analysis of body length of Mapk7 CKO and CON mice at P21 ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Comparison of body weight between CON and Mapk7 CKO mice at various time points. Male and female mice were combined ( n = 4). * P < 0.05 (paired-sample t test). Data are presented as mean ± SD. d Representative image and ( e, f ) quantification analysis of limb bones from 60-day-old CON and Mapk7 CKO mice ( n = 6). Scale bar, 5 mm. * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Comparison

Mice with MAPK7 deficiency in chondrocytes displayed decreased cortical thickness and bone mass loss. a HE staining of distal femur sections from P60 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm. b Three-dimensional reconstruction μCT images ( n = 5) of (upper images) femur trabecular and (lower images) cortical bone in CON and Mapk7 CKO mice at P60. c–i Quantitative μCT analysis of CON and Mapk7 CKO femurs, including ( c ) cortical thickness, ( d ) bone mineral density (BMD), ( e ) bone volume/tissue volume ratio (BV/TV), ( f ) trabecular thickness, ( g ) trabecular number, ( h ) trabecular separation, and ( i ) the trabecular pattern factor. * P < 0.05 (Student’s t test). Data are presented as mean ± SD. j – l Immunofluorescence staining of ( j ) OSX, ( k ) OPN and ( l ) OCN on representative sections of proximal tibial growth plates from P7 mice

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Mice with MAPK7 deficiency in chondrocytes displayed decreased cortical thickness and bone mass loss. a HE staining of distal femur sections from P60 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm. b Three-dimensional reconstruction μCT images ( n = 5) of (upper images) femur trabecular and (lower images) cortical bone in CON and Mapk7 CKO mice at P60. c–i Quantitative μCT analysis of CON and Mapk7 CKO femurs, including ( c ) cortical thickness, ( d ) bone mineral density (BMD), ( e ) bone volume/tissue volume ratio (BV/TV), ( f ) trabecular thickness, ( g ) trabecular number, ( h ) trabecular separation, and ( i ) the trabecular pattern factor. * P < 0.05 (Student’s t test). Data are presented as mean ± SD. j – l Immunofluorescence staining of ( j ) OSX, ( k ) OPN and ( l ) OCN on representative sections of proximal tibial growth plates from P7 mice

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Staining, Immunofluorescence

MAPK7 deficiency reduced survival and proliferation of chondrocytes in the central proliferative layer. a HE- and ( b ) TUNEL-stained sections of the distal femoral growth plate at P7. Boxed areas in the center of the growth plate are magnified in the images at the bottom. c HE- and ( d ) TUNEL-stained sections of the distal femoral growth plates of P1 mice. Boxed areas in the center of the proliferative layer are magnified in the images at the bottom. Scale bar, 200 μm. e mRNA levels of Pcna , Ki67 , Cyclin B1 , and Cyclin D1 in tibial and femoral growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by real-time quantitative PCR ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. f Protein levels of MAPK7 and PCNA in tibial and femoral growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by western blot. g EdU labeling of chondrocytes in tibiae from P1 mice. Boxed areas in the top images, which represent the counted regions in the quantification of EdU-positive cells, are magnified in the images at the bottom. Scale bar, 200 μm. h EdU-positive cells were counted in the center and the periphery of the proliferation layer ( n = 3) * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: MAPK7 deficiency reduced survival and proliferation of chondrocytes in the central proliferative layer. a HE- and ( b ) TUNEL-stained sections of the distal femoral growth plate at P7. Boxed areas in the center of the growth plate are magnified in the images at the bottom. c HE- and ( d ) TUNEL-stained sections of the distal femoral growth plates of P1 mice. Boxed areas in the center of the proliferative layer are magnified in the images at the bottom. Scale bar, 200 μm. e mRNA levels of Pcna , Ki67 , Cyclin B1 , and Cyclin D1 in tibial and femoral growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by real-time quantitative PCR ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. f Protein levels of MAPK7 and PCNA in tibial and femoral growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by western blot. g EdU labeling of chondrocytes in tibiae from P1 mice. Boxed areas in the top images, which represent the counted regions in the quantification of EdU-positive cells, are magnified in the images at the bottom. Scale bar, 200 μm. h EdU-positive cells were counted in the center and the periphery of the proliferation layer ( n = 3) * P < 0.05 (Student’s t test). N.S., not significant. Data are presented as mean ± SD

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: TUNEL Assay, Staining, Isolation, Real-time Polymerase Chain Reaction, Western Blot, Labeling

Differentiation of hypertrophic chondrocytes within the central region of growth plates was impaired in Mapk7 CKO mice. a EdU labeling-chasing assay and corresponding HE staining of tibial sections from P4 mice. Dotted lines areas represent the proliferative zone and hypertrophic zone. PZ: proliferative zone; HZ: hypertrophic zone. b Quantification of EdU-positive cells in proliferative and hypertrophic zone. The percentage means EdU-labeled in hypertrophic zone relative to total number of EdU-positive chondrocytes in the proliferative and hypertrophic zone. HCs, hypertrophic chondrocytes. ( n = 5) * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Real-time quantitative PCR was performed to measure Col10a1 , Mmp13 , Runx2 , Opn , and Ihh mRNA expression levels in growth plates from P1 mice ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. d Protein levels of MAPK7, COL10A1, MMP13, RUNX2, and IHH in growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by western blot. e – g , i Immunofluorescence staining of ( e ) RUNX2, ( f ) COL10A1, ( g ) MMP13, and ( i ) OSX on representative sections of proximal tibial growth plates from P1 mice. Boxed areas are magnified in the images at the bottom. h Von Kossa staining of proximal tibial growth plates. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Differentiation of hypertrophic chondrocytes within the central region of growth plates was impaired in Mapk7 CKO mice. a EdU labeling-chasing assay and corresponding HE staining of tibial sections from P4 mice. Dotted lines areas represent the proliferative zone and hypertrophic zone. PZ: proliferative zone; HZ: hypertrophic zone. b Quantification of EdU-positive cells in proliferative and hypertrophic zone. The percentage means EdU-labeled in hypertrophic zone relative to total number of EdU-positive chondrocytes in the proliferative and hypertrophic zone. HCs, hypertrophic chondrocytes. ( n = 5) * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c Real-time quantitative PCR was performed to measure Col10a1 , Mmp13 , Runx2 , Opn , and Ihh mRNA expression levels in growth plates from P1 mice ( n = 3). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. d Protein levels of MAPK7, COL10A1, MMP13, RUNX2, and IHH in growth plates isolated from CON and Mapk7 CKO mice at P1 were assayed by western blot. e – g , i Immunofluorescence staining of ( e ) RUNX2, ( f ) COL10A1, ( g ) MMP13, and ( i ) OSX on representative sections of proximal tibial growth plates from P1 mice. Boxed areas are magnified in the images at the bottom. h Von Kossa staining of proximal tibial growth plates. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Labeling, Staining, Real-time Polymerase Chain Reaction, Expressing, Isolation, Western Blot, Immunofluorescence

Activation of MAPK7 in chondrocytes is essential for hypoxic adaptation and enhancement of HIF1α signaling under hypoxia. a , b Immunofluorescence staining of ( a ) MAPK7 ( b ) P-MAPK7 on representative sections of distal femoral growth plates at P1. Scale bar, 200 μm. RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone. c Western blot analysis of MAPK7 and p- MAPK7 in primary chondrocytes cultured under hypoxic conditions for 0, 1, 4, 12, or 24 h. d Immunofluorescence staining of SOX9 on representative sections of distal femoral growth plates at P1. Scale bar, 200 μm. e Western blot analysis of SOX9, COL2A1, MAPK7, HIF1α, and VEGFA in CON and Mapk7 CKO chondrocytes cultured under normoxic or hypoxic conditions for 48 h. f Western blot analysis of SOX9, COL2A1, MAPK7, p-MAPK7, HIF1α, and VEGFA protein levels in XMD8-92- or DMSO-treated primary chondrocytes cultured under normoxic or hypoxic conditions. Primary chondrocytes harvested from wild-type mouse knees were cultured in the presence of 5 μM XMD8-92 or an equal amount of DMSO under normoxia for 3 h, followed by normoxia or hypoxia for 48 h. XMD, XMD8-92. g , h mRNA levels of ( g ) Sox9 and ( h ) Col2a1 in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia were measured by real-time quantitative PCR (n = 3). *P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. i Immunofluorescence staining of HIF1α on representative proximal tibial growth plate sections from P1 mice. Scale bar, 200 μm. j mRNA levels of Hif1a and its known target genes were measured in growth plate cartilage from P1 Mapk7 CKO mice by real-time quantitative PCR. k HIF1α activity in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia, as evaluated by HIF1α-responsive element luciferase reporter (HRE-luc) assay ( n = 5). * P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. l mRNA level of hif1a in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia were measured by real-time quantitative PCR (n = 3). *P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. m Free ATP levels in CON and Mapk7 CKO chondrocytes cultured under normoxic or hypoxic conditions ( n = 4). * P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. n Primary chondrocytes were transfected with WT-MAPK7 or DN-MAPK7 expression vector in the presence of CA-MEK5 expression vector. Cells were harvested 48 h after transfection and protein levels of HIF1α, MAPK7 and p-MAPK7 were assayed by western blot

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Activation of MAPK7 in chondrocytes is essential for hypoxic adaptation and enhancement of HIF1α signaling under hypoxia. a , b Immunofluorescence staining of ( a ) MAPK7 ( b ) P-MAPK7 on representative sections of distal femoral growth plates at P1. Scale bar, 200 μm. RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone. c Western blot analysis of MAPK7 and p- MAPK7 in primary chondrocytes cultured under hypoxic conditions for 0, 1, 4, 12, or 24 h. d Immunofluorescence staining of SOX9 on representative sections of distal femoral growth plates at P1. Scale bar, 200 μm. e Western blot analysis of SOX9, COL2A1, MAPK7, HIF1α, and VEGFA in CON and Mapk7 CKO chondrocytes cultured under normoxic or hypoxic conditions for 48 h. f Western blot analysis of SOX9, COL2A1, MAPK7, p-MAPK7, HIF1α, and VEGFA protein levels in XMD8-92- or DMSO-treated primary chondrocytes cultured under normoxic or hypoxic conditions. Primary chondrocytes harvested from wild-type mouse knees were cultured in the presence of 5 μM XMD8-92 or an equal amount of DMSO under normoxia for 3 h, followed by normoxia or hypoxia for 48 h. XMD, XMD8-92. g , h mRNA levels of ( g ) Sox9 and ( h ) Col2a1 in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia were measured by real-time quantitative PCR (n = 3). *P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. i Immunofluorescence staining of HIF1α on representative proximal tibial growth plate sections from P1 mice. Scale bar, 200 μm. j mRNA levels of Hif1a and its known target genes were measured in growth plate cartilage from P1 Mapk7 CKO mice by real-time quantitative PCR. k HIF1α activity in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia, as evaluated by HIF1α-responsive element luciferase reporter (HRE-luc) assay ( n = 5). * P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. l mRNA level of hif1a in CON and Mapk7 CKO chondrocytes cultured under normoxia or hypoxia were measured by real-time quantitative PCR (n = 3). *P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. m Free ATP levels in CON and Mapk7 CKO chondrocytes cultured under normoxic or hypoxic conditions ( n = 4). * P < 0.05 (one-way ANOVA followed by Dunnett’s post hoc test). Data are presented as mean ± SD. n Primary chondrocytes were transfected with WT-MAPK7 or DN-MAPK7 expression vector in the presence of CA-MEK5 expression vector. Cells were harvested 48 h after transfection and protein levels of HIF1α, MAPK7 and p-MAPK7 were assayed by western blot

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Activation Assay, Immunofluorescence, Staining, Western Blot, Cell Culture, Real-time Polymerase Chain Reaction, Activity Assay, Luciferase, Transfection, Expressing, Plasmid Preparation

Targeted disruption of Mapk7 in chondrocytes inhibited vascular invasion into epiphyseal cartilage and delayed secondary ossification center (SOC) formation. a HE staining of proximal tibia and distal femur sections from P14 mice. Black dotted lines indicate the contour of the SOC. Scale bar, 200 μm. b Quantitative analysis of the areas of the tibial and femoral SOCs from P14 mice ( n = 4). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c , d Safranin O staining of proximal tibia and distal femur sections from P7 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm. e , f Immunofluorescence staining of ( e ) CD31 and ( f ) COL10A1 on representative sections of distal femurs from P7 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Targeted disruption of Mapk7 in chondrocytes inhibited vascular invasion into epiphyseal cartilage and delayed secondary ossification center (SOC) formation. a HE staining of proximal tibia and distal femur sections from P14 mice. Black dotted lines indicate the contour of the SOC. Scale bar, 200 μm. b Quantitative analysis of the areas of the tibial and femoral SOCs from P14 mice ( n = 4). * P < 0.05 (Student’s t test). Data are presented as mean ± SD. c , d Safranin O staining of proximal tibia and distal femur sections from P7 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm. e , f Immunofluorescence staining of ( e ) CD31 and ( f ) COL10A1 on representative sections of distal femurs from P7 mice. Boxed areas are magnified in the images at the bottom. Scale bar, 200 μm

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Disruption, Staining, Immunofluorescence

Proposed role of MAPK7 in growth plate development. a The expression patterns of MAPK7 and p-MAPK7 in the growth plate. The depth of color represents the expression levels of corresponding markers. RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone. b A schematic model summarizing the role of MAPK7 in the regulation of growth plate development and modulating HIF1α signaling for hypoxic adaptation

Journal: Cell & Bioscience

Article Title: Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia

doi: 10.1186/s13578-020-00462-8

Figure Lengend Snippet: Proposed role of MAPK7 in growth plate development. a The expression patterns of MAPK7 and p-MAPK7 in the growth plate. The depth of color represents the expression levels of corresponding markers. RZ, resting zone; PZ, proliferative zone; HZ, hypertrophic zone. b A schematic model summarizing the role of MAPK7 in the regulation of growth plate development and modulating HIF1α signaling for hypoxic adaptation

Article Snippet: Mapk7 floxed mice which carried the targeted allele with a couple of loxP sites flanking exons 4, 5, 6, and 7 of Mapk7 gene were generated by Cyagen Biosciences (Suzhou, China), and schematic diagram of loxp sites was shown in Additional file : Fig. S1a.

Techniques: Expressing