Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) Domain architecture of the human E3 ligase UBR5. Unresolved regions in the EM map are shown as dash lines. The disordered UBA and MLLE domains are shown as gray squares. (B) Selected 2D class averages of the dimer (left) and tetramer (right). (C-D) Cryo-EM 3D maps of the dimer (C) and tetramer (D). Domains are colored as in (A).

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques: Cryo-EM Sample Prep

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) The dimer structure in cartoon viewed from top along the 2-fold symmetry axis (left) and a monomer in a side view (right). Th structures are colored as in Figure 1A. The crystal structures of the UBA (PDB ID 2QHO) and MLLE (PDB ID 3NTW) are shown in shadowed cartoons for illustrative purpose only; they are invisible in the EM map. (B) Top and bottom views of the middle Armadillo-like helical scaffold that primarily mediates UBR5 dimerization. The three major interacting regions are marked by three colored shapes in the right panel. (C) Close-up view of the hydrophobic interface region marked by the red circle in (B). Residues involved in dimerization such as the salt bridge between Arg1492 and Asp1916 are shown as sticks. (D) Close-up view of the interface region marked by the orange square in (B). This region contains both hydrophobic and H-bonding interactions. (E) Close-up view of the region marked by green square in (B), which involves the domain-swapped dimerization (DSD) motif.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques:

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) UBR5 HECT domain in the L-conformation in two orthogonal views. (B) The NEDD4L-HECT-E2-Ub structure (PDB ID 3JWO) in the same view. (C) Superimposition of the UBR5-HECT (this study) and NEDD4L-HECT-E2-Ub (PDB ID 3JWO) structures. The UBR5 HECT N-lobe is poised to bind E2, but the C-lobe needs to rotate 130° to reach the C-lobe position of the NEDD4L-HECT for transthiolation reaction. (D) The two most distinct conformations of the UBR5 dimer as determined by 3DVA, showing a 14 Å lateral movement of the NTR and a 55° rotation of the HECT. SBB2 above SBB1 was observed in this lower resolution variability analysis, but missing in the 2.8 Å 3D map, indicating its high mobility in the dimer. (E) Ub-E2 docked in the right intermolecular jaw of the UBR5 dimer. The distance between the C-lobe and UBR-box is 62 Å. (F) Possible substrate ubiquitylation pathway. The curved red arrow indicates that E3 Ub transthiolation reaction occurs in the intermolecular jaw. The dashed red arrow indicates the Ub transfer route for substrate ubiquitylation.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques:

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) Focus-refined EM map of the NTR and UBR-box in transparent surface view superimposed with atomic model in cartoons and colored as in Figure 1B. (B) Left: Side view of the β-propeller and the small β-barrel 1 (SBB1) in the NTR. Right: Top view of the seven-blades β-propeller. (C) Structure of the UBR-box with two zinc fingers coordinating three zinc ions (yellow spheres). The coordinating cysteine and histidine residues are in sticks. (D) Electrostatic surface views of the UBR5 UBR-box (left) and the UBR2 UBR-box bound to an N-degron peptide shown in orange sticks (right, PDB ID 3NY3). The two N-degron binding subsites are marked by dashed red and purple circles, respectively. (E) Sequence alignment of the UBR boxes of human UBR5, UBR1, UBR2, and UBR4. The conserved Cys and His residues coordinating the first Zn2+ are indicated by red arrows. The six Cys that coordinate the remaining two Zn2+ are indicated by blue arrows. Cys1211 participates in coordination of two zincs and is indicated by a yellow arrow.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques: Zinc-Fingers, Binding Assay, Sequencing

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) Key residues involved in E2 and Ub binding are displayed as red spheres, and their locations are highlighted by colored circles. The catalytic cysteine is in yellow. The right panels show the catalytic pocket and three predicted interfaces between HECT C-lobe and Ub, between HECT N-lobe and Ub, and between UBA and Ub, based on alignment with the isolated HECT–Ub structures shown in Figure 5A. The UBA location is based on the published isolated UBR5 UBA–Ub complex structure (PDB ID 2QHO). (B-C) In-gel fluorescence of the E2 discharge assay by purified WT and seven mutant UBR5 proteins under non-reducing (B) and reducing agent (5mM β-mercaptoethanol, C). (D) Quantification of the E2-Ub bands. (E) Quantification of the ubiquitylated WT and mutant UBR5 proteins. In panels d-e, ΔNTR refers to UBR5 truncating N-terminal residues 1-875. All values represent means ± SD obtained from three independent experiments.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques: Binding Assay, Isolation, Fluorescence, Purification, Mutagenesis

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: (A) Atomic model of the tetramer UBR5 in cartoon view. Two UBR5 chains (A and C) are colored as in Fig. 1c, and the two remaining chains in salmon. The red rectangle marks the tetramerization interface between two dimers that is mediated by the SBB2-SBB2 interaction. (B) Close-up view of the red rectangle region in panel a showing the EM density of SBB1/2 of protomers A and C in transparent surface superimposed with atomic model in cartoons. (C) Close-up view of the interface in the green box in panel b showing the SBB2 residues involved in tetramerization as predicted by AlphaFold-multimer.

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques:

Journal: Structure (London, England : 1993)

Article Title: Structure of the human UBR5 E3 ubiquitin ligase

doi: 10.1016/j.str.2023.03.010

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5alpha competent cells ThermoFisher Cat# 18265017 E. coli BL21(DE3) competent cells ThermoFisher Cat# EC0114 E. coli DH10Bac competent cells ThermoFisher Cat# 10361012 Chemicals, peptides, and recombinant proteins Protease inhibitor MilliporeSigma Cat# 11873580001 DyLight ™ 800 Maleimide Thermo Fisher Cat # 46621 Plasmid Mega Kit Qiagen Cat # 12181 Deposited data UBR5 structure model (C1 symmetry in dimer) This study PDB: 8D4X UBR5 structure model (C2 symmetry in dimer) This study PDB: 8E0Q UBR5 structure model (C1 symmetry in tetramer) This study PDB: 8EWI UBR5 structure map (C1 symmetry in dimer) This study EMDB: EMD-27201 UBR5 structure model (C2 symmetry in dimer) This study EMDB: EMD-27822 UBR5 structure model (C1 symmetry in tetramer) This study EMDB: EMD-28646 Experimental models: Cell lines Sf9 insect cells Invitrogen Cat# 11496015 Oligonucleotides GCGCGGAATTCATGGACTACAAGGACGACGACGACAAGATGCAGCACATCCTGAGGTGCGACTACG Eurofins Scientific UBR5(876-2799)_forward CGAAAGCGGCCGCTTATTACACGAAACCGAAGTTCTTGGTCT Eurofins Scientific UBR5(876-2799)_reverse CCGCGCGGCAGCCATATGTGTCAGATCTTCGTGAAAACCC Eurofins Scientific Cys-Ub_forward GTGGTGGTGGTGCTCGAGTCAACCACCTCTCAGACGCAGG Eurofins Scientific Cys-Ub_reverse Recombinant DNA pFastBac_UBR5 This study N/A pET28a_Cys-ub This study N/A pET28a-PEPCK1 This study N/A Software and algorithms cryoSPARC v3.2.0 Punjani et al., 2017 74 https://cryosparc.com/ MotionCor2 Zheng et al., 2017 75 https://emcore.ucsf.edu/ucsf-software Coot v0.9.4 Emsley et al., 2004 76 https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/ Phenix v1.20 Adams et al., 2010 77 https://phenix-online.org/documentation/reference/autobuild_gui.html ChimeraX Goddard et al.,2018 78 https://www.cgl.ucsf.edu/chimerax/docs/user/index.html Chimera Pettersen et al., 2004 79 http://www.cgl.ucsf.edu/chimera/ DeepEMhancer Sanchez-Garcia et al., 2021 80 https://github.com/rsanchezgarc/deepEMhancer AlphaFold2 Jumper et al., 2021 65 https://github.com/deepmind/alphafold Others Quantifoil Au R2/1 SPI Supplies Cat# 4330G-FA easiGlow glow discharger PELCO Model# 91000 Vitrobot Thermo Fisher N/A Superose 6 Increase10/300 GL Sigma-Aldrich Cat# GE29-0915-96 Open in a separate window KEY RESOURCES TABLE.

Techniques: Recombinant, Protease Inhibitor, Plasmid Preparation, Software

Journal: Oncogenesis

Article Title: Ras-association domain family 10 acts as a novel tumor suppressor through modulating MMP2 in hepatocarcinoma.

doi: 10.1038/oncsis.2016.24

Figure Lengend Snippet: Figure 3. RASSF10 modulated cell cycle. (a) Cell-cycle distribution was analyzed by FACS flow cytometry in QGY7703 cells and HepG2 cells stably transfected with pcDNA3.1-RASSF10 or pcDNA3.1 vector. Restoration of RASSF10 induced the accumulation of HCC cells in G1 cell cycle phase. The asterisk indicates statistical significance (*Po0.05). (b) Western blot shows the expression of major mediators in cell cycle process including p27, CyclinD1, CDK2 and CDK4.

Article Snippet: Primary antibodies used in this study are as follows: RASSF10 (1:1000, catalog number: ab113105), MMP2 (1:1000, catalog number: ab86607) and tissue inhibitor of metalloproteinases 2 (TIMP2) (1:200, catalog number: ab180630) (Abcam, Cambridge, MA, USA); cyclin-dependent kinases2 (CDK2) (1:200, catalog number: sc-748), CDK4 (1:200, catalog number: sc-260), Janus kinase 1/2 (JNK1/2) (1:200, catalog number: sc7345), p38-mitogen activated protein kinase (p38 MAPK) (1:200, catalog number: sc-4708) (Santa Cruz Biotechnology, Dallas, TX, USA); P27(1:1000, catalog number: #3686 s), CyclinD1 (1:1000, catalog number: #2978); extracellular regulated protein kinases (ERK) (1/1000, catalog number: #4695), FAK (1:1000, catalog number: #3285), pFAK397 (1:1000, catalog number: #3283 s) and pFAK 925 (1:1000, catalog number: #3284 s) (Cell Signaling Technology, Beverly, MA, USA); GAPDH (1:1000, catalog number: 85-14- 9523-80) and Tublin (1:1000, catalog number: 85-41-4510-82) (Multisciences Biotech, Hangzhou, China).

Techniques: Cytometry, Stable Transfection, Transfection, Plasmid Preparation, Western Blot, Expressing

Journal: Oncogenesis

Article Title: Ras-association domain family 10 acts as a novel tumor suppressor through modulating MMP2 in hepatocarcinoma.

doi: 10.1038/oncsis.2016.24

Figure Lengend Snippet: Figure 4. RASSF10 retarded tumor growth in vivo. (a) Subcutaneous tumor growth curve of RASSF10-expressing QGY7703 and HepG2 cells in nude mice was compared with vector (pcDNA3.1) transfected cells. The RASSF10 group showed a retarded tumor growth compared with the vector group (HepG2, P = 0.012; OGY7703, Po0.01). The data are means ± s.d. (n = 8/group). (b) A representative picture of tumor growth in nude mice subcutaneously inoculated with RASSF10 or vector (n = 8/group). (c) Histogram represents mean of the tumor weight from the RASSF10 and vector groups. The asterisk indicates statistical significance (*Po0.05, **Po0.01). (d) Cell cycle mediators including p27, Cycling D1, CDK2 and CDK4 were evaluated in the xenograft tumors by RT-PCR.

Article Snippet: Primary antibodies used in this study are as follows: RASSF10 (1:1000, catalog number: ab113105), MMP2 (1:1000, catalog number: ab86607) and tissue inhibitor of metalloproteinases 2 (TIMP2) (1:200, catalog number: ab180630) (Abcam, Cambridge, MA, USA); cyclin-dependent kinases2 (CDK2) (1:200, catalog number: sc-748), CDK4 (1:200, catalog number: sc-260), Janus kinase 1/2 (JNK1/2) (1:200, catalog number: sc7345), p38-mitogen activated protein kinase (p38 MAPK) (1:200, catalog number: sc-4708) (Santa Cruz Biotechnology, Dallas, TX, USA); P27(1:1000, catalog number: #3686 s), CyclinD1 (1:1000, catalog number: #2978); extracellular regulated protein kinases (ERK) (1/1000, catalog number: #4695), FAK (1:1000, catalog number: #3285), pFAK397 (1:1000, catalog number: #3283 s) and pFAK 925 (1:1000, catalog number: #3284 s) (Cell Signaling Technology, Beverly, MA, USA); GAPDH (1:1000, catalog number: 85-14- 9523-80) and Tublin (1:1000, catalog number: 85-41-4510-82) (Multisciences Biotech, Hangzhou, China).

Techniques: In Vivo, Expressing, Plasmid Preparation, Transfection, Reverse Transcription Polymerase Chain Reaction