Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 2. GPR43 agonist is involved in sepsis-induced inflammatory reactions through trigger NLRP3 inflammasome. Survival rate (A) in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) for 72 h; W/D rate (B), lung injury score (C) and lung tissue using HE staining (D) in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) for 24 h; IL-6/IL-10 levels in tissue of CLP mice (E) in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) for 24 h; IL-6/IL-10 levels in serum of CLP mice (F) in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) for 24 h; Representative electron microscopy images and area void of cristae (minimum of 40 mitochondria) was used to measure mitochondrial cristae density in macrophage CLP of mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) (G) for 24 h; Representative electron microscopy images and area void of cristae (minimum of 40 mitochondria) was used to measure mitochondrial cristae density in macrophage CLP of mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) (H) for 24 h; NLRP3, Caspase-1 and IL-1β protein expressions in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) (I) for 24 h; NLRP3, Caspase-1 and IL-1β protein expressions in GPR43-/- mice of CLP (J) for 24 h; Serum IL-1β and SOD levels in CLP mice with GPR43 agonist (4-CMTB, 10 mg/kg, i.p.) (K, L) for 24 h; Serum IL-1β and SOD levels in GPR43-/- mice of CLP (M, N) for 24 h. Sepsis+control, CLP mice with normal saline; Sepsis+GRP43 a, CLP mice with i GPR43 agonist (4-CMTB, 10 mg/kg, i.p.); WT, WT mice with CLP; GPR43-/-, GPR43-/- mice with CLP. ##p<0.01 compared with WT mice with CLP or ##p<0.01 compared with CLP mice with normal saline.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Staining, Electron Microscopy, Control, Saline

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 3. GPR43 gene trigger NLRP3 inflammasome in macrophage by regulation of mitochondrial fission. GPR43 protein expression in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist (A); GPR43 protein expression in macrophage by up- regulation of GPR43 and LPS+ATP+GPR43 agonist (B); NLRP3, Caspase-1 and IL-1β protein expressions in cells and IL-1β protein expression in macrophage by up-regulation of GPR43 and LPS+ATP+GPR43 agonist (C); NLRP3, Caspase-1 and IL-1β protein expressions in cells and IL-1β protein expression in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist (D); IL-1β and SOD levels in macrophage by up- regulation of GPR43 and LPS+ATP+GPR43 agonist (E, F); IL-1β and SOD levels in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist (G, H); Representative electron microscopy images, area void of cristae (minimum of 40 mitochondria) was used to measure mitochondrial cristae density (I), Calcein-AM/CoCl2 assay (J), and Calcein-AM/CoCl2 assay and dissipation of Δψm by JC-1 assay (K) in macrophage by up-regulation of GPR43 and LPS+ATP+GPR43 agonist; Representative electron microscopy images, area void of cristae (minimum of 40 mitochondria) was used to measure mitochondrial cristae density (L), Calcein-AM/CoCl2 assay (J), and Calcein-AM/CoCl2 assay and dissipation of Δψm by JC-1 assay (M) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist (N). Negative, negative control; GPR43, over-expression of GPR43; NS, si-negative control; Si-GPR43, down-regulation of GPR43; LPS+ATP+4-CMTB, macrophage by treated with LPS+ATP+4-CMTB. ##p<0.01 compared with negative control or si-negative control.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Expressing, Electron Microscopy, Negative Control, Over Expression

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 4. The inhibition of GPR43 activate NLRP3 inflammasome by ROS production-induced mitochondrial fission. Survival rate (A) in GRP43-/- mice with CLP and ROS I for 72 h; W/D rate (B), lung injury score (C), lung tissue using HE staining (D), SOD activity level (E), serum IL-1β levels (F), NLRP3/caspase-1/ IL-1β protein expressions (G) in GRP43-/- mice with CLP and ROS I for 24 h; NLRP3, Caspase-1 and IL-1β protein expressions in cells and IL-1β protein expression in supernatant (H), IL-1β levels (I), ROS production level (J), and SOD activity levels (K) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist for 24 h; Representative electron microscopy images (L) in macrophage of GRP43-/- mice with CLP for 24 h; Representative electron microscopy images (M) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist for 24 h; Confocal showed the accumulation of ROS production within mitochondria (N) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist for 24 h. GPR43-/-, GPR43-/- mice with CLP; GPR43-/-+ROS i, GPR43-/- mice of CLP with ROS inhibitor; Negative, negative control; Si-GPR43, down-regulation of GPR43; LPS+ATP+4-CMTB, macrophage by treated with LPS+ATP+4-CMTB. ##p<0.01 compared with GPR43-/- mice with CLP or GPR43-/- mice with CLP; **p<0.01 compared with down-regulation of GPR43.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Inhibition, Staining, Activity Assay, Expressing, Electron Microscopy, Negative Control

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 5. P47phox caused ROS production in the function of GPR43 in sepsis-induced inflammatory reactions model. Survival rate (A) in GRP43-/- mice with CLP and anti-p47phox for 72 h; W/D rate (B), lung injury score (C), lung tissue using HE staining (D), SOD activity level (E), serum IL-1β levels (F), NLRP3/caspase-1/ IL-1β protein expressions (G) in GRP43-/- mice with CLP and anti-p47phox for 24 h; NLRP3, Caspase-1 and IL-1β protein expressions in cells and IL-1β protein expression in supernatant (H), IL-1β levels (I), ROS production level (J), and SOD activity levels (K) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist for 24 h. GPR43-/-, GPR43-/- mice with CLP; GPR43-/-+ROS i, GPR43-/- mice of CLP with ROS inhibitor; Negative, negative control; Si-GPR43, down-regulation of GPR43; si-p47phox, down- regulation of p47phox; LPS+ATP+4-CMTB, macrophage by treated with LPS+ATP+4-CMTB. ##p<0.01 compared with GPR43-/- mice with CLP or GPR43-/- mice with CLP; **p<0.01 compared with down-regulation of GPR43.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Staining, Activity Assay, Expressing, Negative Control

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 6. Nox1/EBP50/p47phox is involved in the activation of NLRP3 inflammasome by GRP43 gene in sepsis model. EBP50 and p47phox sequence structures highlighting the PDZ domains of EBP50 and the potential PDZ-binding motif on p47phox, streptavidin regulated anti-p47phox or anti-EBP50 antibodies on RAW264.7 cell (A); Anti-FLAG antibody with anti-p47phox or anti-FLAG antibodies on lysates (B); P47phox and EBP50 expression in vitro model using confocal (C); Outline of p47phox sequence structures highlighting the mutation (in red) of C-terminal PDZ binding motif on p47phox (D); NOX-1 and p47phox sequence structures highlighting the PDZ domains of NOX-1 and the potential PDZ-binding motif on p47phox (E); Anti-FLAG antibody with anti- NOX-1 or anti-FLAG antibodies on lysates (F); NOX-1 and EBP50 expression in vitro model using confocal (G); Nox1, EBP50 and p47phox protein expressions in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist (H, I). Control, control group; LPS+ATP, macrophage by treated with LPS+ATP; L-4-CMTB, 10 μM of 4-CMTB; M-4-CMTB, 20 μM of 4-CMTB; H-4-CMTB, 40 μM of 4-CMTB. ##p<0.01 compared with control group; **p<0.01 compared with LPS+ATP.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Activation Assay, Sequencing, Binding Assay, Expressing, In Vitro, Mutagenesis, Control

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 8. GPR43 is involved in the activation of NLRP3 inflammasome in sepsis model by PPARγ. Survival rate (A) in GRP43-/- mice with CLP and PPARγ a for 72 h; W/D rate (B), lung injury score (C), lung tissue using HE staining (D), serum IL-1β levels (E), PPARγ/NOX- 1/EBP50/ p47phox/NLRP3/caspase-1/ IL-1β protein expressions (F) in GRP43-/- mice with CLP and PPARγ a for 24 h; PPARγ, NOX-1, EBP50, p47phox, NLRP3, Caspase-1 and IL-1β protein expressions in cells and IL-1β protein expression in supernatant (G, I), IL-1β levels (H), ROS production level (J), and SOD activity levels (K) in macrophage by down-regulation of GPR43 and LPS+ATP+GPR43 agonist for 24 h. GPR43-/-, GPR43-/- mice with CLP; GPR43-/-+ PPARγ a, GPR43-/- mice of CLP with PPARγ a; Negative, negative control; Si-GPR43, down-regulation of GPR43; PPARγ a, Pioglitazone; LPS+ATP+4-CMTB, macrophage by treated with LPS+ATP+4-CMTB. ##p<0.01 compared with GPR43-/- mice with CLP or GPR43-/- mice with CLP; **p<0.01 compared with down-regulation of GPR43.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Activation Assay, Staining, Expressing, Activity Assay, Negative Control

Journal: Aging

Article Title: GPR43 regulation of mitochondrial damage to alleviate inflammatory reaction in sepsis.

doi: 10.18632/aging.203572

Figure Lengend Snippet: Figure 9. GPR43 is involved in the activation of NLRP3 inflammasome in sepsis model by ROS-induced mitochondrial damage via PPARγ.

Article Snippet: Membranes were blocked using 5% non-fat dry milk with TBST buffer for 1 h, then incubated overnight at 4° C with GPR43 (1:1000, ab131003, Abcam), MFN2 (1:500, ab205236, Abcam), PPARγ (1:1000, ab178860, Abcam), NOX-1 (1:1000, ab121009, Abcam), EBP50 (1:1000, ab3452, Abcam), p47phox (1:1000, ab166930, Abcam), NLRP3 (1:1000, 15101, Cell Signaling Technology, Danvers, MA, US), Caspase-1 (1:1000, sc392736, Santa Cruz Biotechnology), IL-1β (1:1000, www.aging-us.com 22601 AGING 12242, Cell Signaling Technology, Danvers, MA, US), and β-Actin (1:5000, sc-47778, Santa Cruz Biotechnology).

Techniques: Activation Assay

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 8 | 2-APB inhibits NLRP3 inflammasome activation in HTV-treated mice. (A, B) Representative immunoblots of NLRP3, cleaved caspase-1and Asc in lung extracts from CON, HTV and HTV+2-APB group and densitometric analyses of NLRP3, cleaved caspase-1and Asc. (C) Levels of NLRP3, caspase-1 and Asc mRNA. Data are expressed as means ± SD (n = 6 per group). *P < 0.05 vs. CON group. #P < 0.05 vs. HTV group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Activation Assay, Western Blot

Journal: Frontiers in immunology

Article Title: Inhibition of IP3R/Ca2+ Dysregulation Protects Mice From Ventilator-Induced Lung Injury via Endoplasmic Reticulum and Mitochondrial Pathways.

doi: 10.3389/fimmu.2021.729094

Figure Lengend Snippet: FIGURE 11 | Carbachol stimulates mitochondrial dysfunction and NLRP3 inflammasome activation in lung epithelial cells and macrophage. (A, B) Fluorescence microscopy and the ratio of JC-1 staining (red, J-aggregates; green, monomer) in MLE12 and RAW264.7 cells after treating with 50 mM carbachol or non-treated for 24h, Scale bar: 200mm. (C) Levels of ATP. (D, E) Levels of ROS were determined by flow cytometry. (F) Levels of NLRP3, caspase-1and Asc mRNA in MLE12 cells. (G) Levels of NLRP3, caspase-1 and Asc mRNA in RAW264.7 cells. Data are expressed as means ± SD from 3 independent experiments. Mann-Whitney U test was used for caspase-1 mRNA comparison between two groups from MLE12 cells, because the data were non-normally distributed. *P < 0.05 vs. Mock group.

Article Snippet: Genes Primer sequences (5’-3’) Mouse-GRP78 Forward GAAAGGATGGTTAATGATGCTGAG Reverse GTCTTCAATGTCCGCATCCTG Mouse-CHOP Forward CAAATGGCAGTTCAAAACCATC Reverse ATGTGTGCTGTGTGTGTGTTCC Mouse-NLRP3 Forward TGTGAGAAGCAGGTTCTACTCT Reverse GACTGTTGAGGTCCACACTCT Mouse-Caspase-1 Forward AGGCATGCCGTGGAGAGAAACAA Reverse AGCCCCTGACAGGATGTCTCCA Mouse-ASC Forward GACAGTACCAGGCAGTTCGT Reverse AGTCCTTGCAGGTCAGGTTC Mouse-GAPDH Forward TGTGTCCGTCGTGGATCTGA Reverse TTGCTGTTGAAGTCGCAGGAG Se ptember 2021 | Volume 12 | Article 729094 (#2148, CST), anti-GRP78 (sc-166490, Santa Cruz; and/or GB11098, Servicebio), anti-CHOP (sc-7351, Santa Cruz), antiphospho-IRE1a (ab48187, abcam), anti-IRE1a (ab37073, abcam), anti-TRAF2 (#4724, CST), anti-XBP-1s (#40435, CST), anti-phospho-PERK (#3179, CST), anti- PERK (#5683, CST), anti- phospho- eIF2a (AP0635, ABclonal), antieIF2a(A0764, ABclonal), anti-ATF6 (ab37149, abcam), antiIkBa (#4814s, CST), anti-p-NF-kB p65 (Ser536, #3033s, CST), anti-NF-kB p65 (#8242s, CST), anti-Lamin B (sc-374015, Santa Cruz), anti- NLRP3 (#13158, CST), anti-caspase-1 (A0964, ABclonal), anti-ASC (67824S, CST), anti-b-actin (#4970, CST).

Techniques: Activation Assay, Fluorescence, Microscopy, Staining, Cytometry, MANN-WHITNEY, Comparison

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: (A-H) Representative images of retinal cross sections showing expression of NLRP3 (green) along with nuclear stain DAPI (blue) (scale bar = 50 µm) across ages (A, E) 4 mo, (B, F) 8 mo, (C, G) 12 mo, (D, H) 20 mo. Elevated Nlrp3 inflammasome immunoreactivity is observed in aging R345W +/+ mice compared to their WT littermates beginning at 12 mo of age. (I) No detectible Nlrp3 staining in Nlrp3 deficient mice.

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Expressing, Staining

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: (A) mRNA was extracted from WT or R345W +/+ RPE/choroid samples, reverse transcribed and probed for transcript levels of complement component 3 (C3, p ≤ 0.05), caspase 1 (Casp1), interleukin 18 (Il18), interleukin 1 beta (Il1β), interleukin 6 (Il6), nucleotide-binding oligomerization (NOD)-like receptor protein 3 (Nlrp3), complement factor H (Cfh), Efemp1 (F3), tissue inhibitor of matrix metalloproteinase 3 (Timp3) and plotted relative to β-actin (n = 5-6 mice). 2-way ANOVA. Mean ± S.D. * p < 0.05.

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Reverse Transcription, Binding Assay

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: (A) H&E-stained retinal histology sections demonstrates that removal of Casp1 and Nlrp3 is well tolerated structurally. Scale bar = 100 µm. (B) Representative BLamD traced electron micrographs from each genotype. Scale bar = 2 µm. (C) Violin plot depicting comparative analysis of BLamD size per FOV across different genotypes. (D) Comparative analysis of the abundance of sub-FOVs containing BLamDs presented as percent coverage across BrM. n = 3 males/3 females for each genotype. Analysis performed using Kruskal-Wallis test. Note: TEM images of WT and R345W +/+ mice as well as quantification (C, D) are identical to the 12 mo age group displayed earlier in .

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Staining

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: (A-D) Representative images (n = 4) of retinal cross sections showing expression of Gfap (A, C, red) and Vim (B, D, green) along with nuclear stain DAPI (blue) as a reference (scale bar = 50 µm). Increased expression of Gfap and Vim is observed in Nlrp3 -/- R345W +/+ mice (similar to that seen in R345W+/+ mice, cf. ) compared to Nlrp3 -/- (or WT, cf. ) mice.

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Expressing, Staining

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: Nlrp3 -/- R345W +/+ mice. (22 mo) mice compared to R345W +/+ (20 mo). Representative images (n = 4-6) of Iba1 + (green) stained microglia in the ganglion cell layer (GCL), inner plexiform layer (IPL), outer plexiform layer (OPL), photoreceptor layer (PR) and RPE (scale bar = 100 µm). Graphs representing cell densities in each of the specified layers showing significant reductions in microglia densities in the GCL, IPL, PR, and RPE layers. Note: data presented here were analyzed using a two-way ANOVA in combination with data presented in . **** p < 0.0001. Mean ± S.D. Note: R345W +/+ images and quantification are identical to that shown earlier in .

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Staining

Journal: bioRxiv

Article Title: Genetic removal of Nlrp3 protects against sporadic and R345W Efemp1-induced basal laminar deposit formation

doi: 10.1101/2024.10.14.618289

Figure Lengend Snippet: (A) 12 mo H&E-stained histology images of WT, Casp1 -/- , and Nlrp3 -/- mice. Scale bar = 100 µm. (B) Representative TEM images from 12 mo mice. (C, D) quantitation of BLamD size (µm 2 /FOV) and percent sub-FOVs containing BLamDs. Scale bar = 2 μm Comparative analysis performed using Kruskal-Wallis test. **** p < 0.0001. Note: The WT TEM image and WT BLamD quantification are identical to that shown previously in .

Article Snippet: Available TaqMan probes (Applied Biosystems, Waltham, MA) were used for qPCR reactions as follows: β-actin (Mm02619580_g1), C3 (Mm01232779_m1), Casp1 (mm00438023_m1), Cfh (Mm01299248_m1), Efemp-1 (Mm00524588_m1), Gfap (Mm01253033_m1), Il18 (mm00434226_m1), Il1β (Mm00434228_m1), Il6 (Mm00446190_m1), Nlrp3 (mm00840904_m1), and Timp3 (Mm00441826_m1).

Techniques: Staining, Quantitation Assay

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 4. Astrocytic Kir6.1 deletion aggravates astrocyte injury and NLRP3-related pyroptosis in the hippocampus. A-B Immunofluorescent staining of GFAP-positive astrocytes in hippocampal sections (A) with quantification (B, n = 6). C-D ELISA of IL-1β (C) and IL-18 (D) from hippocampus of WT and CKO mice after CSDS (n = 6). E Representative immunoblots of NLRP3, caspase-1, and GSDMD-N from mice hippocampus. F-H Quantification of NLRP3 (F), caspase-1 (G), and GSDMD-N (H) (n = 5). The data shown are the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001 vs corresponding control (Con) group; ##p < 0.01, ###p < 0.001 vs WT CSDS groups.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Staining, Enzyme-linked Immunosorbent Assay, Western Blot, Control

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 5. Astrocytic Kir6.1 ablation promotes pyroptosis of astrocytes in the hippocampus. A, C, E Representative magnification images showing the co-localization of GFAP (red) and NLRP3 (green) (A), GFAP (red) and caspase-1 (green) (C), and GFAP (red) and GSDMD (green) (E) in a part of mice hippocampus region after CSDS. White arrows show example of GFAP+/NLRP3+, GFAP+/caspase-1+, and GFAP+/GSDMD+ cells. B, D, F Quantification of the percentage of GFAP positive cells that are NLRP3 positive (B), caspase-1 positive (D), and GSDMD positive (F) in the hippocampus (n = 5). The data shown are the mean ± SEM. **p < 0.01, ***p < 0.001 vs corresponding control (Con) group; ###p < 0.001 vs WT CSDS groups.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Control

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 6. Kir6.1 is a negative regulator of NLRP3-mediated astrocytic pyroptosis. Primary astrocytes prepared from WT and CKO mice were treated with 10 µM VX765 for 1 h, followed by stimulation with LPS plus ATP. A The viability of cells was assessed by the CCK-8 assay (n = 4). B LDH in supernatants was measured by LDH kit (n = 5). C ELISA of IL-1β in the supernatants (n = 5). D-G Representative immunoblots of the cleaved caspase-1 in the supernatants (SN) and the NLRP3, pro-caspase-1, full-length GSDMD and GSDMD N-terminal in cell lysate (D) and quantification of cleaved caspase-1 (E, n = 3), NLRP3 (F, n = 3) and GSDMD-N (G, n = 5). H Treated astrocytes were stained with YO-PRO-1 (green) and Eth-D2 (red) to visualize the discrete membrane pores. DAPI stains nucleus (blue). I Quantification of YO-PRO-1+ Eth-D2- cells (n = 5). The data shown are the mean ± SEM. **p < 0.01, ***p < 0.001 vs corresponding control (Con) group; $$p < 0.01, $$$p < 0.001 vs WT LPS+ATP groups; ##p < 0.01, ###p < 0.001 vs corresponding LPS+ATP group.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: CCK-8 Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Staining, Membrane, Control

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 7. Kir6.1 interacts with NLRP3 and inhibits NLRP3 inflammasome assembly. A Representative images showing the localization of NLRP3 (red) and Kir6.1 (green) in astrocytes. B The interaction between Kir 6.1 and NLRP3 in astrocytes was measured by co-IP. C The association of ASC with NLRP3, and procaspase-1 in LPS+ATP treated astrocytes isolated from WT and CKO mice was assessed by co-IP. D-E Quantification of data shown in (C, n = 3). The data shown are the mean ± SEM. **p < 0.01.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Co-Immunoprecipitation Assay, Isolation

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 8. The mitochondrial ROS is required for NLRP3-mediated pyroptosis in Kir6.1 knockout astrocytes. A-B Representative images and quantification of mitochondrial ROS levels by flow cytometry (n = 3). C-D Representative images and quantification of MitoSOX fluorescence intensity (n = 3). The nucleus was stained with DAPI (blue). ***p < 0.001 vs control (Con) group; ###p < 0.001 vs WT LPS+ATP groups. Primary astrocytes from CKO mice were pretreated with 5 mM ROS inhibitor NAC for 1 h and then stimulated with LPS plus ATP. E-H Representative immunoblots of the cleaved caspase-1 and mature IL-1β in the supernatants and the GSDMD and GSDMD N-terminal in cell lysates (E) and quantification of caspase-1 cleavage (F), IL-1β (G), and GSDMD-N (H). n = 3, *p < 0.05 vs control (Con) group; #p < 0.05, ##p < 0.01 vs LPS+ATP groups.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Knock-Out, Flow Cytometry, Fluorescence, Staining, Control, Western Blot

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 9. Inhibiting NLRP3 inflammasome rescues pyroptosis of astrocytes and depressive behaviors in CKO mice. CKO mice were intraperitoneally injected with VX765 (100 mg/kg) once daily for 10 consecutive days. A Representative magnification images showing the co-localization of GFAP (red) and GSDMD (green) in a part of mice hippocampus region after CSDS. White arrows show example of GFAP+/GSDMD+ cells. B-C Quantification of GFAP+ cells number (B, n = 6) and percentage of GFAP positive cells that are GSDMD positive (C, n = 5) in the DG area of hippocampus. **p < 0.01, ***p < 0.001. D-E Representative immunoblot (D) and quantitative analysis of GSDMD in hippocampus of mice (E, n = 5). F ELISA of IL-1β from hippocampus of mice (n = 6). G-I Sucrose preference (G, n = 8), total immobility time in TST (H, n = 9) and in FST (I, n = 9) of mice. ***p < 0.001 vs control (Con) group; ##p < 0.01, ###p < 0.001 vs CSDS groups.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Injection, Western Blot, Enzyme-linked Immunosorbent Assay, Control

Journal: Theranostics

Article Title: Kir6.1/K-ATP channel in astrocytes is an essential negative modulator of astrocytic pyroptosis in mouse model of depression.

doi: 10.7150/thno.77455

Figure Lengend Snippet: Figure 10. Proposed model depicting the crucial role of Kir6.1, via its interaction with NLRP3 and inhibition of mtROS generation, in preventing the assembly and activation of NLRP3 inflammasome, consequently, inhibiting the pyroptosis of astrocytes in depression.

Article Snippet: Astrocytes were primed with lipopolysaccharide (LPS, 100 ng ml-1, Sigma, USA) for 24 h and then pulsed with 5 mM ATP (Sigma, USA) for 30 min. For pharmacological measurements, NLRP3 inflammasome inhibitor VX765 (10 μM, Selleck, China) or ROS inhibitor N-acetyl-cysteine (NAC, 5 mM, Sigma, USA) was added to the cell culture medium 1 h before LPS plus ATP stimulation.

Techniques: Inhibition, Activation Assay