ndei Search Results


ndei  (New England Biolabs)
99
New England Biolabs ndei
Ndei, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndei/product/New England Biolabs
Average 99 stars, based on 1 article reviews
ndei - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier
ndei restriction endonuclease jena biosciences cat  (Jena Bioscience)
93
Jena Bioscience ndei restriction endonuclease jena biosciences cat
Ndei Restriction Endonuclease Jena Biosciences Cat, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndei restriction endonuclease jena biosciences cat/product/Jena Bioscience
Average 93 stars, based on 1 article reviews
ndei restriction endonuclease jena biosciences cat - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
ids of 136543 136544 136545  (Addgene inc)
90
Addgene inc ids of 136543 136544 136545
Ids Of 136543 136544 136545, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ids of 136543 136544 136545/product/Addgene inc
Average 90 stars, based on 1 article reviews
ids of 136543 136544 136545 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
epsilon_fw_ndei epsilon_rev_xhoi  (Generi Biotech)
90
Generi Biotech epsilon_fw_ndei epsilon_rev_xhoi
Bacterial strains, plasmids, and primers used in this study.
Epsilon Fw Ndei Epsilon Rev Xhoi, supplied by Generi Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epsilon_fw_ndei epsilon_rev_xhoi/product/Generi Biotech
Average 90 stars, based on 1 article reviews
epsilon_fw_ndei epsilon_rev_xhoi - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
naei  (Promega)
90
Promega naei
Bacterial strains, plasmids, and primers used in this study.
Naei, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/naei/product/Promega
Average 90 stars, based on 1 article reviews
naei - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
dna coding cyclic peptide epitope xc154p1  (Bioneer Corporation)
90
Bioneer Corporation dna coding cyclic peptide epitope xc154p1
Bacterial strains, plasmids, and primers used in this study.
Dna Coding Cyclic Peptide Epitope Xc154p1, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna coding cyclic peptide epitope xc154p1/product/Bioneer Corporation
Average 90 stars, based on 1 article reviews
dna coding cyclic peptide epitope xc154p1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
ndei  (SibEnzyme ltd)
90
SibEnzyme ltd ndei
Bacterial strains, plasmids, and primers used in this study.
Ndei, supplied by SibEnzyme ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndei/product/SibEnzyme ltd
Average 90 stars, based on 1 article reviews
ndei - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
restriction enzyme ndei  (Enzynomics co Ltd)
90
Enzynomics co Ltd restriction enzyme ndei
Bacterial strains, plasmids, and primers used in this study.
Restriction Enzyme Ndei, supplied by Enzynomics co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/restriction enzyme ndei/product/Enzynomics co Ltd
Average 90 stars, based on 1 article reviews
restriction enzyme ndei - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
ndei  (Agencourt Bioscience Corporation)
90
Agencourt Bioscience Corporation ndei
Bacterial strains, plasmids, and primers used in this study.
Ndei, supplied by Agencourt Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndei/product/Agencourt Bioscience Corporation
Average 90 stars, based on 1 article reviews
ndei - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
ndei e0216y  (Amersham Life Sciences Inc)
90
Amersham Life Sciences Inc ndei e0216y
Bacterial strains, plasmids, and primers used in this study.
Ndei E0216y, supplied by Amersham Life Sciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ndei e0216y/product/Amersham Life Sciences Inc
Average 90 stars, based on 1 article reviews
ndei e0216y - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
qacr expression plasmid pet-21b(+)-qacr  (Fasmac Co Ltd)
90
Fasmac Co Ltd qacr expression plasmid pet-21b(+)-qacr
Bacterial strains, plasmids, and primers used in this study.
Qacr Expression Plasmid Pet 21b(+) Qacr, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/qacr expression plasmid pet-21b(+)-qacr/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
qacr expression plasmid pet-21b(+)-qacr - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Bacterial strains, plasmids, and primers used in this study.

Journal: Toxins

Article Title: Targeted Mass Spectrometry Analysis of Clostridium perfringens Toxins

doi: 10.3390/toxins11030177

Figure Lengend Snippet: Bacterial strains, plasmids, and primers used in this study.

Article Snippet: epsilon_FW_NdeI epsilon_REV_XhoI , CCACATATGAAAAAAAATCTTGTAAAAAGTTTAG TGGCTCGAGTTTTATTCCTGGTGCCTTAATATAAA , Generi Biotech.

Techniques: Isolation, Expressing, Plasmid Preparation, Planar Chromatography, Sequencing