mtco2 Search Results


95
Genecopoeia mtco2 rabbit mab
Mtco2 Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mtco2 rabbit mab/product/Genecopoeia
Average 95 stars, based on 1 article reviews
mtco2 rabbit mab - by Bioz Stars, 2026-04
95/100 stars
  Buy from Supplier

96
Proteintech mtco2
The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, <t>MTCO2,</t> ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis
Mtco2, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mtco2/product/Proteintech
Average 96 stars, based on 1 article reviews
mtco2 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

94
Boster Bio u2af2
The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, <t>MTCO2,</t> ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis
U2af2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/u2af2/product/Boster Bio
Average 94 stars, based on 1 article reviews
u2af2 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

90
OriGene cox2
The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, <t>MTCO2,</t> ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis
Cox2, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cox2/product/OriGene
Average 90 stars, based on 1 article reviews
cox2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MitoSciences monoclonal antibody for mtco1 in complex iv
The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, <t>MTCO2,</t> ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis
Monoclonal Antibody For Mtco1 In Complex Iv, supplied by MitoSciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/monoclonal antibody for mtco1 in complex iv/product/MitoSciences
Average 90 stars, based on 1 article reviews
monoclonal antibody for mtco1 in complex iv - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Stressgen Biotechnologies antibodies mtco2 (mouse monoclonal)
Levels of HIF-1α and HIF-1 target proteins in A549 and A549 ρ 0 cells . Plateau phase cultures were treated with control vehicle (mannitol), cobalt acetate (cobalt, 100 μM), or hypoxia (1.5% oxygen atmosphere). ( A ) Levels of HIF-1α protein relative to control vehicle after 4 hours treatment as measured by ELISA. Effect of incubation under hypoxic conditions or with cobalt acetate is shown for comparison. Error bars indicate one standard deviation. ( B ) Representative Western blot showing <t>MT-CO2,</t> PGK1, DDIT4, GLUT1, and HSP60 levels in A549 and A549 ρ 0 cells. PGK1 and DDIT4 levels were more abundant (1.4- and 4.0-fold, respectively) in A549 ρ 0 cells relative to A549 cells. In contrast, GLUT1 and HSP60 levels were only marginally changed (1.1- and 1.25-fold less abundant) in A549 ρ 0 cells relative to A549 cells. All estimates were made via phorphorimaging analysis with HSC70 levels serving as a loading control. Note that MT-CO2 levels could not be detected in any A549 ρ 0 experiment while DDIT4 was expressed at low levels, but could be quantified in normoxic cells.
Antibodies Mtco2 (Mouse Monoclonal), supplied by Stressgen Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies mtco2 (mouse monoclonal)/product/Stressgen Biotechnologies
Average 90 stars, based on 1 article reviews
antibodies mtco2 (mouse monoclonal) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins mtco2-f r

Mtco2 F R, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mtco2-f r/product/Eurofins
Average 90 stars, based on 1 article reviews
mtco2-f r - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Microsynth ag probe northern blot: targeting mtco2 5’- gacgtccgggaattgcatctgtttt-3

Probe Northern Blot: Targeting Mtco2 5’ Gacgtccgggaattgcatctgtttt 3, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/probe northern blot: targeting mtco2 5’- gacgtccgggaattgcatctgtttt-3/product/Microsynth ag
Average 90 stars, based on 1 article reviews
probe northern blot: targeting mtco2 5’- gacgtccgggaattgcatctgtttt-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GeneTex antihuman mitochondria antibody mtco2

Antihuman Mitochondria Antibody Mtco2, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antihuman mitochondria antibody mtco2/product/GeneTex
Average 90 stars, based on 1 article reviews
antihuman mitochondria antibody mtco2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
ZenBio mtco2 rabbit monoclonal antibody (r25027)

Mtco2 Rabbit Monoclonal Antibody (R25027), supplied by ZenBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mtco2 rabbit monoclonal antibody (r25027)/product/ZenBio
Average 90 stars, based on 1 article reviews
mtco2 rabbit monoclonal antibody (r25027) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Busoga Forestry Company forestry 2.3 mtco 2 expected uganda plantation

Forestry 2.3 Mtco 2 Expected Uganda Plantation, supplied by Busoga Forestry Company, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forestry 2.3 mtco 2 expected uganda plantation/product/Busoga Forestry Company
Average 90 stars, based on 1 article reviews
forestry 2.3 mtco 2 expected uganda plantation - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Exxon Mobil Corporation annually, exxonmobil releases an average of 125 mtco2 annually since 2008

Annually, Exxonmobil Releases An Average Of 125 Mtco2 Annually Since 2008, supplied by Exxon Mobil Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/annually, exxonmobil releases an average of 125 mtco2 annually since 2008/product/Exxon Mobil Corporation
Average 90 stars, based on 1 article reviews
annually, exxonmobil releases an average of 125 mtco2 annually since 2008 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis

Journal: Cancer Cell International

Article Title: Darunavir analog precursors target mitochondrial metabolism in multiple myeloma and CLL.

doi: 10.1186/s12935-025-04142-w

Figure Lengend Snippet: The HIV protease inhibitors and BnpM-NH 2 affect the respiratory chain function altering the the expression of complex II and IV proteins . ( A ) WB analysis of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin expression in MM1S, RPMI-8226, and HG3 cells treated with BupM-NH2 and BnpM-NH2 (30 µM) for 48 h was performed. The intensity of NDUFB8, SDHB, UQCRC2, MTCO2, ATP5A1, and Actin intensity normalized to actin were quantified and plotted as bar graphs. The results are presented as mean ± SD of at least three replicates. ( B ) ROS production and mitochondrial mass in MM and CLL cells treated with BupM-NH 2 and BnpM-NH 2 (30 µM) for 24 h were assessed using mitosox and mitotracker assays. FACS analysis was employed to detect median fluorescent intensity (MFI), which was reported on a bar graph. Data, presented as mean ± SD, were obtained from at least three independent experiments. Significant differences ( P ≤ 0.05) were determined by one-way ANOVA with Tukey’s post analysis

Article Snippet: MTCO2 (1:6000, 26 KDa) , Proteintech , Cat#: 55070-1-AP; RRID: AB_10859832.

Techniques: Expressing

Levels of HIF-1α and HIF-1 target proteins in A549 and A549 ρ 0 cells . Plateau phase cultures were treated with control vehicle (mannitol), cobalt acetate (cobalt, 100 μM), or hypoxia (1.5% oxygen atmosphere). ( A ) Levels of HIF-1α protein relative to control vehicle after 4 hours treatment as measured by ELISA. Effect of incubation under hypoxic conditions or with cobalt acetate is shown for comparison. Error bars indicate one standard deviation. ( B ) Representative Western blot showing MT-CO2, PGK1, DDIT4, GLUT1, and HSP60 levels in A549 and A549 ρ 0 cells. PGK1 and DDIT4 levels were more abundant (1.4- and 4.0-fold, respectively) in A549 ρ 0 cells relative to A549 cells. In contrast, GLUT1 and HSP60 levels were only marginally changed (1.1- and 1.25-fold less abundant) in A549 ρ 0 cells relative to A549 cells. All estimates were made via phorphorimaging analysis with HSC70 levels serving as a loading control. Note that MT-CO2 levels could not be detected in any A549 ρ 0 experiment while DDIT4 was expressed at low levels, but could be quantified in normoxic cells.

Journal: BMC Genomics

Article Title: mtDNA depletion confers specific gene expression profiles in human cells grown in culture and in xenograft

doi: 10.1186/1471-2164-9-521

Figure Lengend Snippet: Levels of HIF-1α and HIF-1 target proteins in A549 and A549 ρ 0 cells . Plateau phase cultures were treated with control vehicle (mannitol), cobalt acetate (cobalt, 100 μM), or hypoxia (1.5% oxygen atmosphere). ( A ) Levels of HIF-1α protein relative to control vehicle after 4 hours treatment as measured by ELISA. Effect of incubation under hypoxic conditions or with cobalt acetate is shown for comparison. Error bars indicate one standard deviation. ( B ) Representative Western blot showing MT-CO2, PGK1, DDIT4, GLUT1, and HSP60 levels in A549 and A549 ρ 0 cells. PGK1 and DDIT4 levels were more abundant (1.4- and 4.0-fold, respectively) in A549 ρ 0 cells relative to A549 cells. In contrast, GLUT1 and HSP60 levels were only marginally changed (1.1- and 1.25-fold less abundant) in A549 ρ 0 cells relative to A549 cells. All estimates were made via phorphorimaging analysis with HSC70 levels serving as a loading control. Note that MT-CO2 levels could not be detected in any A549 ρ 0 experiment while DDIT4 was expressed at low levels, but could be quantified in normoxic cells.

Article Snippet: Western blotting was performed using antibodies against GLUT1 (aka SLC2A1, rabbit polyclonal), PGK1 (goat polyclonal), MTCO2 (mouse monoclonal), PDK1 (rabbit polyclonal), and DDIT4 (rabbit polyclonal) obtained from Santa Cruz Biotechnology, Molecular Probes, Stressgen, and Proteintech, respectively.

Techniques: Control, Enzyme-linked Immunosorbent Assay, Incubation, Comparison, Standard Deviation, Western Blot

Journal: Cell Metabolism

Article Title: PML-Regulated Mitochondrial Metabolism Enhances Chemosensitivity in Human Ovarian Cancers

doi: 10.1016/j.cmet.2018.09.002

Figure Lengend Snippet:

Article Snippet: MTCO2-F : 5′– TCATTTTCCTTATCTGCTTCC –3′ , Eurofins , N/A.

Techniques: Virus, Derivative Assay, Recombinant, Protease Inhibitor, Western Blot, Staining, Membrane, Electron Microscopy, SYBR Green Assay, Bicinchoninic Acid Protein Assay, DNA Profiling, Reverse Transcription, Software, Imaging, Cell Culture