Journal: International Journal of Molecular Sciences

Article Title: MST1 Regulates Neuronal Cell Death via JNK/Casp3 Signaling Pathway in HFD Mouse Brain and HT22 Cells

doi: 10.3390/ijms20102504

Figure Lengend Snippet: Metabolic dysregulation induced oxidative stress both in in vivo and in vitro models: ( a , b ) The histogram showing the results of lipid peroxidation (LPO) and reactive oxygen species (ROS) levels in the high-fat diet (HFD) mice model; ( c , d ) a histogram represent the results of LPO and ROS levels in palmitic acid treated HT22 cells; ( e ) shown are the Western blot results of nuclear factor-2 erythroid-2 (Nrf-2) and hemeoxygenase-1 (HO-1) along with respective histograms in the palmitic acid-treated HT22 cells. β-Actin was used as a loading control; ( f ) shown are the Western blot results of mammalian sterile 20-like kinase-1 (MST1), phosphor-c-Jun N-terminal Kinase (p-JNK), and Caspase-3 along with respective histograms in brain homogenates of HFD-fed mice and the normal control group. β-Actin was used as a loading control; ( g ) representative images of immunofluorescence staining of colocalization of Nrf2/HO-1 in palmitic acid-treated cells; ( h , i ) immunofluorescence staining images of MST1 and Casp-3 in mice cortex and the hippocampus region. n = 12 mice/group. The data are shown here as a mean ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: Four shRNA constructs for Mouse MST1 (Origene, Rockville, MD, USA) with sequence TACCGTGGCGAGGTAGACGTTACAGAGTC, GCGCCTTGGTGCTTCACATCTCGACCTGG, TGTCATCTCCAACCAGGAATGTAACACGA, ATGCTACCACGGCTCAGGTGAACAGTATC was transiently transfected into HT22 cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific), according to the manufacturer’s protocols, and efficiently reduced the MST1 protein expression levels.

Techniques: In Vivo, In Vitro, Western Blot, Control, Sterility, Immunofluorescence, Staining

Journal: International Journal of Molecular Sciences

Article Title: MST1 Regulates Neuronal Cell Death via JNK/Casp3 Signaling Pathway in HFD Mouse Brain and HT22 Cells

doi: 10.3390/ijms20102504

Figure Lengend Snippet: Metabolic dysfunctions regulate the expression level of MST1, p-JNK, and p-AKT in HT22 cells: ( a – c ) Western blot analysis of MST1, p-JNK, and protein kinase B (p-AKT) in palmitic acid, IL-1β, and glucose treated HT22 cells. The bands were quantified using ImageJ software, and the differences are depicted in the respective histogram. β-actin was used as a loading control. ( d ) Representative images of immunofluorescence staining showing MST1 expression in glucose-treated cells; ( e ) double immunofluorescence images of p-JNK and MST1 in palmitic acid treated HT22 cells; ( f ) representative immunofluorescence results of p-JNK expression in IL-1β treated HT22 cells. The data are shown here as a mean ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: Four shRNA constructs for Mouse MST1 (Origene, Rockville, MD, USA) with sequence TACCGTGGCGAGGTAGACGTTACAGAGTC, GCGCCTTGGTGCTTCACATCTCGACCTGG, TGTCATCTCCAACCAGGAATGTAACACGA, ATGCTACCACGGCTCAGGTGAACAGTATC was transiently transfected into HT22 cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific), according to the manufacturer’s protocols, and efficiently reduced the MST1 protein expression levels.

Techniques: Expressing, Western Blot, Software, Control, Immunofluorescence, Staining

Journal: International Journal of Molecular Sciences

Article Title: MST1 Regulates Neuronal Cell Death via JNK/Casp3 Signaling Pathway in HFD Mouse Brain and HT22 Cells

doi: 10.3390/ijms20102504

Figure Lengend Snippet: Metabolic deregulation induced apoptotic cell death in in vitro models: ( a – c ) Shown are the Western blot results of apoptotic markers Bax Bcl-2 can Cleaved-Casp-3 in IL-1β, palmitic acid, and glucose treated cells HT22 cells. β-actin was used as a loading control. For protein band quantification ImageJ software was used. One-way ANOVA followed by post-hoc analysis was used for statistical analysis. The density values were expressed in arbitrary units (AUs) as the mean ± SEM; ( d ) given are the representative images of double immunofluorescence staining of IL-1β and MST1 in IL-1β treated HT22 cells; ( e ) confocal microscopic results of Caspase-3 expression in palmitic acid treated HT22 cells. The data are expressed as the mean ± SEM. * p < 0.05, ** p < 0.01.

Article Snippet: Four shRNA constructs for Mouse MST1 (Origene, Rockville, MD, USA) with sequence TACCGTGGCGAGGTAGACGTTACAGAGTC, GCGCCTTGGTGCTTCACATCTCGACCTGG, TGTCATCTCCAACCAGGAATGTAACACGA, ATGCTACCACGGCTCAGGTGAACAGTATC was transiently transfected into HT22 cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific), according to the manufacturer’s protocols, and efficiently reduced the MST1 protein expression levels.

Techniques: In Vitro, Western Blot, Control, Software, Double Immunofluorescence Staining, Expressing

Journal: International Journal of Molecular Sciences

Article Title: MST1 Regulates Neuronal Cell Death via JNK/Casp3 Signaling Pathway in HFD Mouse Brain and HT22 Cells

doi: 10.3390/ijms20102504

Figure Lengend Snippet: Effect of shRNA MST1 on JNK/Casp3 in HT22 cells: ( a – c ) Shown are the Western blot results of MST1, p-JNK, and Cleaved-Casp-3 in IL-1β, palmitic acid, and glucose treated cells HT22 cells. β-actin was used as a loading control. For protein band quantification ImageJ software was used. One-way ANOVA followed by post-hoc analysis was used for statistical analysis. The density values were expressed in arbitrary units (AUs) as the mean ± SEM; ( d ) given are the representative images of immunofluorescence staining MST1 in PA-treated HT22 cells; the data are expressed as the mean ± SEM. * Significantly different from the control group, and # Significantly different from the stress-induced group; * p < 0.05, # p < 0.05.

Article Snippet: Four shRNA constructs for Mouse MST1 (Origene, Rockville, MD, USA) with sequence TACCGTGGCGAGGTAGACGTTACAGAGTC, GCGCCTTGGTGCTTCACATCTCGACCTGG, TGTCATCTCCAACCAGGAATGTAACACGA, ATGCTACCACGGCTCAGGTGAACAGTATC was transiently transfected into HT22 cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific), according to the manufacturer’s protocols, and efficiently reduced the MST1 protein expression levels.

Techniques: shRNA, Western Blot, Control, Software, Immunofluorescence, Staining

Journal: International Journal of Molecular Sciences

Article Title: MST1 Regulates Neuronal Cell Death via JNK/Casp3 Signaling Pathway in HFD Mouse Brain and HT22 Cells

doi: 10.3390/ijms20102504

Figure Lengend Snippet: List of primary and secondary antibodies used in this study and their information.

Article Snippet: Four shRNA constructs for Mouse MST1 (Origene, Rockville, MD, USA) with sequence TACCGTGGCGAGGTAGACGTTACAGAGTC, GCGCCTTGGTGCTTCACATCTCGACCTGG, TGTCATCTCCAACCAGGAATGTAACACGA, ATGCTACCACGGCTCAGGTGAACAGTATC was transiently transfected into HT22 cells using the Lipofectamine 3000 reagent (Thermo Fisher Scientific), according to the manufacturer’s protocols, and efficiently reduced the MST1 protein expression levels.

Techniques:

Journal: Journal of neurochemistry

Article Title: Macrophage stimulating protein preserves blood brain barrier integrity after intracerebral hemorrhage through recepteur d'origine nantais dependent GAB1/Src/β-catenin pathway activation in a mouse model.

doi: 10.1111/jnc.14622

Figure Lengend Snippet: Fig. 1 Time-line of study design. Representative figure showing experimental design and number of animals for each group. ICH, intracerebral hemorrhage; WB, western blot; BBB, blood brain barrier; rhMSP, recombinant human macrophage stimulating protein.

Article Snippet: Eight-week male CD1 mice were pseudo randomly assigned to the following groups: Sham, ICH + Vehicle, ICH + rhMSP (MSP-0.1 lg), ICH + rhMSP (MSP-0.3 lg), ICH + rhMSP (MSP-1 lg), ICH + rhMSP + scrambled siRNA, ICH + rhMSP + RON siRNA, ICH + rhMSP + GAB1 siRNA. rhMSP (6244-MS-025/CF; R&D Systems, Minneapolis, MN, USA) was administered via intranasal route 1 h post-ICH and then once daily for 3 days to the 72 h groups.

Techniques: Western Blot, Recombinant

Journal: Current Issues in Molecular Biology

Article Title: Levistolide A Alleviates Myocardial Ischemia–Reperfusion Injury Partly by Improving Calcium Homeostasis via the ADORA2B/cAMP/PKA/PLB/SERCA2α Signaling Axis

doi: 10.3390/cimb48020125

Figure Lengend Snippet: The key role of ADORA2B in the calcium signaling pathway and its molecular docking results with LA. ( A ) Schematic representation of the central position of ADORA2B in the calcium signaling pathway; ( B ) Molecular docking binding mode of LA with the ADORA2B protein.

Article Snippet: The antibodies used in this study are as follows: adenosine A2B receptor (ADORA2B) (37KDa) antibody (bs-5900R) was purchased from Bioss Biotechnology Co., Ltd. (Beijing, China); phospholamban (PLB) (36KDa) antibody (A01395-1) was purchased from Boster Biological Engineering Co., Ltd. (Wuhan, China); phosphorylated phospholamban-Ser16 (p-PLB-Ser16) (36KDa) antibody (AP0907) was purchased from ABclonal Biotechnology Co., Ltd. (Wuhan, China); SERCA2α (140KDa) antibody (9580T) was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA); and α-Tubulin (55 KDa) antibody (66031-1-Ig) was purchased from Proteintech Group, Inc. (Wuhan, China).

Techniques: Binding Assay

Journal: Current Issues in Molecular Biology

Article Title: Levistolide A Alleviates Myocardial Ischemia–Reperfusion Injury Partly by Improving Calcium Homeostasis via the ADORA2B/cAMP/PKA/PLB/SERCA2α Signaling Axis

doi: 10.3390/cimb48020125

Figure Lengend Snippet: Protein expression levels of ADORA2B, p-PLB, PLB, and SERCA2α in different groups of H9C2 cells. ( A ) Representative Western blot bands of target proteins in each group; ( B ) Relative protein expression level of ADORA2B; ( C ) Relative protein expression level of p-PLB; ( D ) Relative protein expression level of SERCA2α. Compared to the control group, ## p < 0.01. Compared to the H/R group, ** p < 0.01. Compared to the LA + H/R group, Δ p < 0.05, ΔΔ p < 0.01.

Article Snippet: The antibodies used in this study are as follows: adenosine A2B receptor (ADORA2B) (37KDa) antibody (bs-5900R) was purchased from Bioss Biotechnology Co., Ltd. (Beijing, China); phospholamban (PLB) (36KDa) antibody (A01395-1) was purchased from Boster Biological Engineering Co., Ltd. (Wuhan, China); phosphorylated phospholamban-Ser16 (p-PLB-Ser16) (36KDa) antibody (AP0907) was purchased from ABclonal Biotechnology Co., Ltd. (Wuhan, China); SERCA2α (140KDa) antibody (9580T) was purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA); and α-Tubulin (55 KDa) antibody (66031-1-Ig) was purchased from Proteintech Group, Inc. (Wuhan, China).

Techniques: Expressing, Western Blot, Control

Journal: European journal of biochemistry

Article Title: Tetranectin binds hepatocyte growth factor and tissue-type plasminogen activator.

doi: 10.1046/j.1432-1033.2003.03549.x

Figure Lengend Snippet: Fig. 1. SDS/PAGE/Ligand blot analysis. The samples were reduced prior to electrophoresis. Left: SDS/PAGE indicates two bands of TN as a result of N-terminal cleavage. Right: Lanes 1–6 were loaded with plasminogen, tPA, uPA, HGF, prothrombin, and MSP, respectively. The blot shows TN-binding to plasminogen and HGF. However, longer exposure revealed binding to tPA as well.

Article Snippet: Ligand blot analysis using 125I-labelled tetranectin Three micrograms of bovine Plg, 4 lg human tPA, 2 lg human uPA, 2 lg human HGF (294-HGN, R&D Systems Europe, UK), 3 lg bovine prothrombin, and 2 lg human MSP (352-MS, R&D Systems) were dissolved in the Laemmli-buffer containing 2% SDS and subjected to SDS/PAGE.

Techniques: SDS Page, Electrophoresis, Binding Assay