mef2 Search Results


94
Developmental Studies Hybridoma Bank uas mcd8gfp mef2 mcd8gfp
Uas Mcd8gfp Mef2 Mcd8gfp, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uas mcd8gfp mef2 mcd8gfp/product/Developmental Studies Hybridoma Bank
Average 94 stars, based on 1 article reviews
uas mcd8gfp mef2 mcd8gfp - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

91
Proteintech mef 2 isoform a d
Mef 2 Isoform A D, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef 2 isoform a d/product/Proteintech
Average 91 stars, based on 1 article reviews
mef 2 isoform a d - by Bioz Stars, 2026-06
91/100 stars
  Buy from Supplier

93
Proteintech mef 2a
Mef 2a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef 2a/product/Proteintech
Average 93 stars, based on 1 article reviews
mef 2a - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Boster Bio antibody against lamp1
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Antibody Against Lamp1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody against lamp1/product/Boster Bio
Average 93 stars, based on 1 article reviews
antibody against lamp1 - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology phosphorylated mef2c
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Phosphorylated Mef2c, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phosphorylated mef2c/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
phosphorylated mef2c - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

86
Santa Cruz Biotechnology gatcgctctaaaaataaccctgtcg 3 sense
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Gatcgctctaaaaataaccctgtcg 3 Sense, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gatcgctctaaaaataaccctgtcg 3 sense/product/Santa Cruz Biotechnology
Average 86 stars, based on 1 article reviews
gatcgctctaaaaataaccctgtcg 3 sense - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
AECOM International Development s59-mef2-ht d-gal4 (line 10-2a)
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
S59 Mef2 Ht D Gal4 (Line 10 2a), supplied by AECOM International Development, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/s59-mef2-ht d-gal4 (line 10-2a)/product/AECOM International Development
Average 90 stars, based on 1 article reviews
s59-mef2-ht d-gal4 (line 10-2a) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Promega mef2-luciferase assay
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Mef2 Luciferase Assay, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mef2-luciferase assay/product/Promega
Average 90 stars, based on 1 article reviews
mef2-luciferase assay - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Verlag GmbH m9 (mef2) binding sites
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
M9 (Mef2) Binding Sites, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/m9 (mef2) binding sites/product/Verlag GmbH
Average 90 stars, based on 1 article reviews
m9 (mef2) binding sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Genomatix gmbh predicted mef2 sites
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Predicted Mef2 Sites, supplied by Genomatix gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/predicted mef2 sites/product/Genomatix gmbh
Average 90 stars, based on 1 article reviews
predicted mef2 sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Lonza cell nucleofection solution mef-2
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Cell Nucleofection Solution Mef 2, supplied by Lonza, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cell nucleofection solution mef-2/product/Lonza
Average 90 stars, based on 1 article reviews
cell nucleofection solution mef-2 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
GeNOsys Inc oligonucleotides containing different cox-2 promoter sites
A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and <t>Lamp1</t> in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.
Oligonucleotides Containing Different Cox 2 Promoter Sites, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligonucleotides containing different cox-2 promoter sites/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
oligonucleotides containing different cox-2 promoter sites - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results


A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and Lamp1 in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.

Journal: bioRxiv

Article Title: Fasting reverses PLN R14del-mediated cardiomyopathy through lysosomal reactivation

doi: 10.64898/2026.03.24.713684

Figure Lengend Snippet: A. Volcano plot showing all significantly (p-value < 0.05) downregulated (n = 201) and upregulated (n = 433) genes in wild type (WT) and plna R14del zebrafish hearts with a log₂(fold change) higher than +/− 0.7. Each dot represents one gene; blue corresponds to downregulated genes and green to upregulated genes. The p-value cut off corresponds to 1.30 on the -log 10 axis. B. Fold enrichment of downregulated and upregulated GO terms identified using the DAVID online GO analysis tool, when comparing WT and plna R14del zebrafish hearts in a pseudo-bulk dataset. C. Representative images of immunofluorescent staining against DAPI, Pln and Lamp1 in one year old WT and plna R14del zebrafish. Data shown are representative for n = 8 WT and n = 8 plna R14del zebrafish hearts. Scale bar = 5 μm. White arrowheads indicate Pln and Lamp1 co-localization. D. Quantification of number of Lamp1 foci divided by cardiomyocyte (CM) area. Statistics were performed by two-tailed unpaired t-test. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. E. Quantification of Pln puncta co-localized with Lamp1 foci. Data obtained from n = 8 WT and n = 8 plna R14del zebrafish hearts. F. Representative image of immunofluorescent staining against DAPI, PLN and LAMP1 in left ventricle (LV) from patients with end-stage cardiomyopathy carrying the PLN R14del variant. Dashed box high lights the zoomed in area. Data shown are representative for n = 4 individuals. Scale bars = 10 μm. White arrowheads indicate PLN and LAMP1 co-localization. G. Representative images of immunoelectron microscopy against Lamp1 (10 nm gold) in one year old WT and plna R14del zebrafish hearts. * Indicate endo-lysosomal compartments. Data shown are representative for n = 3 individuals. Scale bar = 200 nm. H. Representative images of DQ red BSA BSA ex vivo assay in one year old WT and plna R14del hearts. Dots represent functional lysosomes. Data shown are representative for n = 4 WT and n = 3 plna R14del zebrafish hearts. Scale bar = 10 μm. I. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 4 WT and n = 3 plna R14del zebrafish hearts. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test. J. Representative images of DQ red BSA ex vivo assay in WT cardiac slices treated with medium or thapsigargin (100 μM). Dots represent functional lysosomes. Data shown are representative for n = 3 per group. Scale bar = 10 μm. K. Quantification of number of DQ red BSA foci per 5000 μm 2 . Data points represent an individual measurement per image; multiple points originate from one individual. Data obtained from n = 3 zebrafish hearts per group. Error bars indicate mean ± s.d. Statistics were performed by two-tailed unpaired t-test.

Article Snippet: Sections were then blocked for 5 min with 1% BSA-c/VG and incubated for 1 hour at room temperature with a primary antibody against Lamp1 (1:10, Boster Biological Technology, DZ01398-1).

Techniques: Staining, Two Tailed Test, Variant Assay, Immuno-Electron Microscopy, Ex Vivo, Functional Assay