|
Developmental Studies Hybridoma Bank
hanh nguyen Hanh Nguyen, supplied by Developmental Studies Hybridoma Bank, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hanh nguyen/product/Developmental Studies Hybridoma Bank Average 94 stars, based on 1 article reviews
hanh nguyen - by Bioz Stars,
2026-02
94/100 stars
|
Buy from Supplier |
|
Proteintech
myef2 ![]() Myef2, supplied by Proteintech, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/myef2/product/Proteintech Average 91 stars, based on 1 article reviews
myef2 - by Bioz Stars,
2026-02
91/100 stars
|
Buy from Supplier |
|
Proteintech
mef 2a ![]() Mef 2a, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mef 2a/product/Proteintech Average 93 stars, based on 1 article reviews
mef 2a - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
mef2 ![]() Mef2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mef2/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
mef2 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Boster Bio
rabbit anti mef2 ![]() Rabbit Anti Mef2, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti mef2/product/Boster Bio Average 93 stars, based on 1 article reviews
rabbit anti mef2 - by Bioz Stars,
2026-02
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
gatcgctctaaaaataaccctgtcg 3 sense ![]() Gatcgctctaaaaataaccctgtcg 3 Sense, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gatcgctctaaaaataaccctgtcg 3 sense/product/Santa Cruz Biotechnology Average 86 stars, based on 1 article reviews
gatcgctctaaaaataaccctgtcg 3 sense - by Bioz Stars,
2026-02
86/100 stars
|
Buy from Supplier |
|
OriGene
mef2c ![]() Mef2c, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mef2c/product/OriGene Average 90 stars, based on 1 article reviews
mef2c - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Verlag GmbH
m9 (mef2) binding sites ![]() M9 (Mef2) Binding Sites, supplied by Verlag GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/m9 (mef2) binding sites/product/Verlag GmbH Average 90 stars, based on 1 article reviews
m9 (mef2) binding sites - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Qiagen
cignal mef2 reporter (luc) kit ![]() Cignal Mef2 Reporter (Luc) Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cignal mef2 reporter (luc) kit/product/Qiagen Average 90 stars, based on 1 article reviews
cignal mef2 reporter (luc) kit - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Inserm Transfert
pgl2-mef2-luc ![]() Pgl2 Mef2 Luc, supplied by Inserm Transfert, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pgl2-mef2-luc/product/Inserm Transfert Average 90 stars, based on 1 article reviews
pgl2-mef2-luc - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
|
Seven Hills Bioreagents
recombinant adenovirus encoding the mef2-luciferase reporter gene admef2-luc ![]() Recombinant Adenovirus Encoding The Mef2 Luciferase Reporter Gene Admef2 Luc, supplied by Seven Hills Bioreagents, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant adenovirus encoding the mef2-luciferase reporter gene admef2-luc/product/Seven Hills Bioreagents Average 90 stars, based on 1 article reviews
recombinant adenovirus encoding the mef2-luciferase reporter gene admef2-luc - by Bioz Stars,
2026-02
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Role of PARP1 in oligodendrocyte differentiation during developmental myelination and remyelination after myelin damage
doi: 10.1101/2021.04.23.441060
Figure Lengend Snippet: A, flow chart of identifying PARylated acceptor proteins. Whole proteins were prepared from the spinal cord of P7 mice 30 min after PARG inhibitor PDD injection to stabilize protein PARylation (PAR half-life is less than 1min). B-C , GO analysis of biological processes ( B ) and molecular function ( C ) of the 131 potential PARylated acceptor proteins identified by Co- IP and LC-MS/MS. D, representative graphs depicting examples of known PARylated proteins and novel PARylated proteins. E, Co-IP followed by Western blotting assay confirming the interaction between Myef2 and PARP1 and the presence of PARylated Myef2 at the molecular weight of Myef2 (∼55kD) in the primary brain OLs at D2. Rabbit IgG, negative control for Myef2 IP. F, Myef2 mRNA level in primary OPCs and D1, 2 and 4 differentiating OLs. N = 3 each group. One-way ANOVA followed by Tukey’s multiple comparison tests. G, double IHC of PARP1 and Myef2 in the corpus callosum of P7 Parp1-WT and Parp1-KO mice. H , abundance of Mbp and Mag mRNA in the immunoprecipitates using RNA immunoprecipitation (RIP) by Myef2 antibody or Ctrl IgG in D2 primary OLs treated with DMSO or 4HQ treated. N = 3 each group. Two-way ANOVA followed by Sidak multiple comparison tests. Mbp: DMSO vs 4HQ F (1, 8) = 10.79 P = 0.0111, IgG vs Myef2 antibody F (1, 8) = 53.51 P < 0.0001. Mag: DMSO vs 4HQ F (1, 8) = 10.82 P = 0.0110, IgG vs Myef2 antibody F (1, 8) = 43.75 P = 0.0002. I , schematic conclusion of panel H , PARP1 inhibition by 4HQ potentiated the binding of Myef2 to mRNA molecules. J , experimental designs for Panels K-P . Primary OPCs purified from neonatal rat brain were differentiated in the presence of Myef2 siRNA or scramble controls for 36 h in the differentiation medium prior to analysis. K, qRT-PCR assay for Myef2 mRNA level. N = 4 Ctrl, 4 Myef2 siRNA. Myef2, t (6) = 21.36 P <0.0001. L , ICC of Myef2 and MBP in Ctrl and Myef2 siRNA-treated primary OLs. M , quantification of Myef2 intensity and MBP + ramified OLs (percentage of DAPI + cells). N = 5 Ctrl, 4 Myef2 siRNA. Myef2 intensity , t (8) = 6.084 P = 0.0003; % of MBP + cells, t (8) = 6.672 P = 0.0002. N-O, representative Western blotting images ( N ) and quantification ( O ). β-actin, loading control. N = 3 scramble Ctrl, 4 Myef2 siRNA. Myef2 , t (4) = 3.410 P = 0.0270; MAG, t (4) = 2.893 P = 0.0444; MBP, t (4) = 3.387 P = 0.0276. P, qRT-PCR assay for Mbp and Mag in Ctrl (n = 4) and Myef2 siRNA-treated (n = 4) primary OLs. Mbp, t (6) = 0.2572 P = 0.8056; Mag , t (6) = 0.1497 P = 0.8859. Two-tailed Student’s t test, * P < 0.05; ** P < 0.01; *** P < 0.001; ns, not significant. Scale bars: G, 20 μm; L 10 μm.
Article Snippet: Primary antibodies and isotype control IgG used were: PARP1 (39559, RRID: AB_2793257, Active Motif), PAR (4335-MC-100, RRID: AB_2572318, Trevigen), Sox2 (sc-17320, RRID: AB_2286684 Santa Cruz Biotechnology),
Techniques: Injection, Co-Immunoprecipitation Assay, Liquid Chromatography with Mass Spectroscopy, Western Blot, Molecular Weight, Negative Control, Comparison, RNA Immunoprecipitation, Inhibition, Binding Assay, Purification, Quantitative RT-PCR, Control, Two Tailed Test
Journal: Scientific reports
Article Title: Zebrafish VCAP1X2 regulates cardiac contractility and proliferation of cardiomyocytes and epicardial cells.
doi: 10.1038/s41598-018-26110-3
Figure Lengend Snippet: Figure 2. VCAP1X2 mutant displayed cardiac dysfunction and impaired cardiomyocyte proliferation. (A) Pseudodynamic reconstructed 3D images and respective bright-field images are shown of end-diastolic phase beating hearts from Tg(myl7:EGFP; myl7:H2AFZ mCherry) (a,b) or VCAP1X2 mutant (c,d) at 72 hpf. Yellow lines indicate the diameter of the ventricular chamber. Green fluorescence marks ventricular myocardium and red indicates ventricular chamber. Scale bar, 50 μm. (B) Parameters related to heart performance were measured from pseudodynamic reconstructed 3D images (a–c, n = 3, N = 2) or CCD images (d–f, n = 20, N = 3) for Tg(myl7:EGFP; myl7:H2AFZ mCherry) or WT and VCAP1X2 mutant at 72 hpf. End-systolic volume (a) and end-diastolic volume (b) were significantly increased in VCAP1X2 mutant compared with Tg(myl7:EGFP; myl7:H2AFZ mCherry) embryos. Ejection fraction (c) was lower in VCAP1X2 mutant than in Tg(myl7:EGFP; myl7:H2AFZ mCherry) embryos. End-diastolic length (d) and width (e) were increased while fractional shortening (f) was decreased in VCAP1X2 mutant compared to WT. Error bars represent standard error. Student’s t-test, **p < 0.01, ***p < 0.001. (C) Paraffin sectioning with hematoxylin and eosin staining revealed a thinner compact layer in the ventricle of VCAP1X2 mutants (b) and LacZ mRNA-injected VCAP1X2 mutants (c) compared to WT (a) or VCAP1X2 mRNA-injected VCAP1X2 mutants (d) (n = 10 per condition). a, atrium, v, ventricle. Scale bar, 50 μm. (D) Immunostaining of BrdU (red) in heart ventricles from Tg(myl7:EGFP; myl7:H2AFZ mCherry) (myl7) (a) or VCAP1X2 mutants (b) at 72 hpf. Significantly decreased cardiomyocyte (CM) number (c) and percentage of BrdU+ CMs (d) in the ventricle was detected in VCAP1X2 mutant compared to Tg(myl7:EGFP; myl7:H2AFZ mCherry) embryos (n = 20 per condition, N = 3). Student’s t-test, ***p < 0.001. Scale bar, 50 μm. Apoptotic cells were analyzed by TUNEL labeling (E) and similar low level of apoptotic cells (F) was detected in VCAP1X2 mutant and Tg(myl7:EGFP; myl7:H2AFZ mCherry) embryos (n = 15, N = 3). Cardiomyocyte nuclei stained by anti-MEF2 antibody. Error bars represent standard error. Scale bar, 50 μm.
Article Snippet: Tissues were incubated with primary antibody including
Techniques: Mutagenesis, Fluorescence, Staining, Injection, Immunostaining, TUNEL Assay, Labeling