Journal: Frontiers in Molecular Neuroscience

Article Title: Whole Genome Expression Analysis in a Mouse Model of Tauopathy Identifies MECP2 as a Possible Regulator of Tau Pathology

doi: 10.3389/fnmol.2017.00069

Figure Lengend Snippet: Microarray analysis of the hippocampi of 6-month-old WT and hTau MaptKO ( Duke ) mice. (A) Total RNA from hippocampi of 6-month-old WT and hTau MaptKO ( Duke ) mice was hybridized to MouseWG-6 v2.0 Expression BeadChip (Illumina ® ). Expression of 64 genes that were significantly altered in hTau MaptKO ( Duke ) mice compared to WT is shown. Values displayed as fold change in expression level: up-regulated (red) and down-regulated (blue) genes. Data represents mean fold change from three mice per genotype. (B) Gene interaction network analysis (using Metacore analytical suite) for the 64 significantly altered genes in hTau MaptKO ( Duke ) mice compared to WT mice. The genes with red (or blue) next to their graphic key is either up- (or down-) regulated. As expected, endogenous mouse tau (MAPT) is one of the most down-regulated genes. Other genes relevant to neuronal function or neurological disease include Prkca, Mecp2, Strn4, Slc40a1, Pold2, Pcsk2 (up-regulated) and Krt12, Lass1, Plat and Nrxn1 (down-regulated). Many of the altered genes are regulated by the transcription factor SP1. (C) Venn diagrams showing GO’s biological processes when all 64 genes are categorized for top biological processes segregate into three distinct Venn diagrams: Group 1: anatomical structure development – 17 altered genes out of total 47, i.e., 17/47; cellular nitrogen compound metabolic process – 15/47; biosynthetic process 13/47. Group 2: cell death – 9/47; signal transduction 8/47; response to stress 8/47. Group 3: neurological system 5/47, cell cycle 2/47 and immune system processes 4/47. Note the genes written in red (or blue) are significantly up- (or down-) regulated.

Article Snippet: Other antibodies: GAPDH (rabbit polyclonal antibody; EMD Millipore; #ABS16), T-MECP2 (D4F3; rabbit monoclonal antibody; Cell Signaling #3456); phospho-MECP2 (pSer80; rabbit polyclonal antibody; PhosphoSolutions #p1205-80).

Techniques: Microarray, Expressing, Transduction

Journal: Frontiers in Molecular Neuroscience

Article Title: Whole Genome Expression Analysis in a Mouse Model of Tauopathy Identifies MECP2 as a Possible Regulator of Tau Pathology

doi: 10.3389/fnmol.2017.00069

Figure Lengend Snippet: MECP2 expression and phosphorylation is up-regulated in 6-month-old hTau MaptKO ( Duke ) mice. (A) qRT-PCR analysis showing statistically significant ( ∗ p < 0.05; unpaired t- test; n = 4 WT, and n = 4 for hTau MaptKO ( Duke ) mice; mean + SEM) up-regulation of MECP2 in the hemi-brains of 6-month-old hTau MaptKO ( Duke ) vs. WT mice. (B) Note the regional differences in the expression of MECP2 in the hippocampus (HIP), cortex (CX), and rest of the brain (ROB) that are devoid of CX and HP. (C) Another gene ( Vat1l ) that was increased in our whole genome microarray analysis also showed modest up-regulation in its mRNA levels in the brains of hTau MaptKO ( Duke ) mice compared to age-matched WT mice. (D,E) Western blot analysis showing a trend toward increased levels for phospho(p)-Ser80 MECP2/total (t) MECP2 and tMECP2/GAPDH [ p = 0.08; unpaired t- test; n = 3, all females for WT and n = 10, three females and six males for hTau MaptKO ( Duke ) ] in 6-month-old hTau MaptKO ( Duke ) versus WT mice; mean + SEM). (F) Double IF and confocal microscopy analysis revealing a modest increase in pMECP2 in the CA3 region of HP in 6-month-old hTau MaptKO ( Duke ) mice compared to age-matched WT controls. Scale bar 25 μm.

Article Snippet: Other antibodies: GAPDH (rabbit polyclonal antibody; EMD Millipore; #ABS16), T-MECP2 (D4F3; rabbit monoclonal antibody; Cell Signaling #3456); phospho-MECP2 (pSer80; rabbit polyclonal antibody; PhosphoSolutions #p1205-80).

Techniques: Expressing, Phospho-proteomics, Quantitative RT-PCR, Microarray, Western Blot, Confocal Microscopy

Journal: Frontiers in Molecular Neuroscience

Article Title: Whole Genome Expression Analysis in a Mouse Model of Tauopathy Identifies MECP2 as a Possible Regulator of Tau Pathology

doi: 10.3389/fnmol.2017.00069

Figure Lengend Snippet: MECP2 phosphorylation is up-regulated in 12-month-old hTau MaptKO ( Duke ) mice and in human AD brain. (A,B) Western blot analysis showing pMECP2/GAPDH ratio significantly higher [ ∗ p < 0.05; unpaired t- test; n = 3 for hTau MaptKO ( Duke ) versus WT mice; all three males for WT; two males and one female for hTau MaptKO ( Duke ) ; mean + SEM] in the hippocampus of 12-month-old hTau MaptKO ( Duke ) mice compared to WT controls. No alteration in the tMECP2/GAPDH ratio in the hippocampus of 12-month-old hTau MaptKO ( Duke ) mice compared to controls. (C) Significantly elevated pMECP2 immunoreactive specks within the nucleus of CA3 hippocampal neurons of 12-month-old hTau MaptKO ( Duke ) mice compared to age-matched WT controls. (D) Double IF and confocal microscopy analysis shows a modest increase in the pMECP2 in the CA3 neuronal layer of 12-month-old hTau MaptKO ( Duke ) mice compared to age-matched WT controls. (E–G) Confocal projections (in E,G ) and bright field images show elevated pMECP2 immunoreactivity and co-localization with nuclear stain DAPI (in E,G ) or peri-vascular labeling (in F ) specifically in the Layer III of temporal cortex of human AD brain autopsy sections compared to the to non-AD healthy control subject. Orthogonal view in (G) shows pMECP2 labeling to be nuclear or peri-nuclear in the human AD cortex. Scale bar 10 μm (in C,F ); 25 μm (in D,G ); 100 μm (in E ).

Article Snippet: Other antibodies: GAPDH (rabbit polyclonal antibody; EMD Millipore; #ABS16), T-MECP2 (D4F3; rabbit monoclonal antibody; Cell Signaling #3456); phospho-MECP2 (pSer80; rabbit polyclonal antibody; PhosphoSolutions #p1205-80).

Techniques: Phospho-proteomics, Western Blot, Confocal Microscopy, Staining, Labeling, Control

Journal: Frontiers in Molecular Neuroscience

Article Title: Whole Genome Expression Analysis in a Mouse Model of Tauopathy Identifies MECP2 as a Possible Regulator of Tau Pathology

doi: 10.3389/fnmol.2017.00069

Figure Lengend Snippet: MECP2 regulates tau pathology in vitro . N2a cells transiently transfected with human tau 0N3R isoform (‘+Tau’) or a control plasmid (‘-Tau’) were nucleofected with siRNA [scramble siRNA (siScr) or MECP2 siRNA]. After 24 h of siRNA nucleofection, the cells were harvested and probed for AT180, PHF-1, Tau5, Tau12, and T-MECP2. (A,B) Note that siMECP2 significantly reduced levels of MECP2 in both ‘-Tau’ and ‘+Tau’ N2a cells ( ∗ p < 0.01; unpaired t- test; n = 3 replicates; mean + SEM). (C,D) siMECP2 treatment also significantly ( ∗ p < 0.01; unpaired t- test; n = 3 replicates; mean + SEM) reduced the levels of both total tau (Tau5/GAPDH) and human tau (Tau12/GAPDH) ratios in the ‘+Tau’ N2a cells compared to scramble siRNA treated conditions. (E–H) siMECP2 knockdown resulted in statistically significant ( ∗ p < 0.01; unpaired t- test; n = 3 replicates; mean + SEM) increase and decrease in AT180/Tau5 and PHF1/Tau5 ratios, respectively. Note that the ratio for β-actin/GAPDH was not altered either in ‘-Tau’/‘+Tau’ conditions or with/without siMECP2 conditions.

Article Snippet: Other antibodies: GAPDH (rabbit polyclonal antibody; EMD Millipore; #ABS16), T-MECP2 (D4F3; rabbit monoclonal antibody; Cell Signaling #3456); phospho-MECP2 (pSer80; rabbit polyclonal antibody; PhosphoSolutions #p1205-80).

Techniques: In Vitro, Transfection, Control, Plasmid Preparation, Knockdown

Journal: Cancer cell

Article Title: The osteogenic niche is a calcium reservoir of bone micrometastases and confers unexpected therapeutic vulnerability

doi: 10.1016/j.ccell.2018.10.002

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Western blots were performed using antibodies against NFAT1(Cell Signalling, 5861S), pS6K(T389) (Cell Signaling, 9234S), pCamKII(T286) (Cell Signalling, 12716S), MeCP2 (Cell Signalling, 3456S), pMeCP2(S421)(Rockland, 600-401-X14), Firefly luciferase (Thermo, PA5-32209).

Techniques: Luciferase, Recombinant, Expressing, In Vivo, Software

Journal: Scientific Reports

Article Title: A prelude to the proximity interaction mapping of CXXC5

doi: 10.1038/s41598-021-97060-6

Figure Lengend Snippet: Interaction of CXXC5 and MeCP2. ( a ) The intracellular localization of CXXC5 and MeCP2 when co-synthesized is assessed with ICC of HEK293 cells transiently transfected for 48 h with the expression vector bearing the 3F-CXXC5 or the HA-MeCP2 cDNA. The Flag (green channel) or the HA (red channel) antibody was used to detect 3F-CXXC5 and HA-MeCP2, respectively. DAPI was used for DNA staining. The scale bar is 10 μm. ( b,c ) To examine the co-synthesis of CXXC5 and MeCP2, nuclear extracts of HEK293 cells transiently transfected with the expression vector bearing ( b ) the 3F-CXXC5 and/or the HA-MeCP2 or (c) HA-CXXC5 and/or the 3F-MeCP2 cDNA were subjected to WB analysis. Proteins were immunoblotted (IB) with the Flag or HA antibody. HDAC1 used as a loading control was probed with the HDAC1 antibody. ( d,e ) The nuclear extracts of HEK293 cells co-synthesizing 3F-CXXC5 and HA-MeCP2, or co-synthesizing HA-CXXC5 and 3F-MeCP2 were subjected to Co-IP using the HA antibody or the isotype-matched IgG followed by immunoblotting using ( d) the Flag or ( e ) the HA antibody. Molecular masses (MM) in kDa are indicated.

Article Snippet: For siRNA transfection, MCF7 cells in 6-well tissue culture plates were transiently transfected with the HiPerfect transfection reagent (Qiagen) using 10 nM a scrambled siRNA (AllStar, CtS), a siRNA specific for CXXC5 (siRNA#10; FlexiTube GeneSolution, Qiagen), as we described previously , , and/or a siRNA pool specific to MeCP2 (sc-35892, SCBT).

Techniques: Synthesized, Transfection, Expressing, Plasmid Preparation, Staining, Control, Co-Immunoprecipitation Assay, Western Blot

Journal: Scientific Reports

Article Title: A prelude to the proximity interaction mapping of CXXC5

doi: 10.1038/s41598-021-97060-6

Figure Lengend Snippet: In cellula interaction of CXXC5 and MeCP2. ( a ) Proximity ligation assay (PLA). To assess the in cellula interaction of CXXC5 and MeCP2, HEK293 cells grown in coverslips were transiently co-transfected the expression vector bearing the 3F-CXXC5 or HA-MeCP2 cDNA. Cells were fixed, permeabilized, blocked, and probed with the HA and/or the Flag antibody. Cells were then subjected to fluorescent probes for circular DNA amplification. DAPI was used for nuclear staining. The scale bar is 25 µm. ( b ) Chromatin immunoprecipitation assay (ChIP)-WB. Co-transfected cells were also subjected to ChIP using the Flag antibody or the isotype-matched IgG followed by immunoblotting using the HA antibody. The membrane was also re-probed with the Flag antibody. HC and LC indicate the heavy and light chain of IgG. 10% of ChIP was used as input control.

Article Snippet: For siRNA transfection, MCF7 cells in 6-well tissue culture plates were transiently transfected with the HiPerfect transfection reagent (Qiagen) using 10 nM a scrambled siRNA (AllStar, CtS), a siRNA specific for CXXC5 (siRNA#10; FlexiTube GeneSolution, Qiagen), as we described previously , , and/or a siRNA pool specific to MeCP2 (sc-35892, SCBT).

Techniques: Proximity Ligation Assay, Transfection, Expressing, Plasmid Preparation, DNA Amplification, Staining, Chromatin Immunoprecipitation, Western Blot, Membrane, Control

Journal: Scientific Reports

Article Title: A prelude to the proximity interaction mapping of CXXC5

doi: 10.1038/s41598-021-97060-6

Figure Lengend Snippet: Identification of interaction region(s) of CXXC5 with MeCP2. ( a ) Schematics of CXXC5 variants. 3F denotes 3XFlag tag and eNLS is an NLS signal derived from the SV40 T antigen. DBM denotes DNA binding mutant. ( b ) The synthesis of proteins in transiently transfected HEK293 cells was verified by WB using the Flag antibody. Molecular masses (MM) in kDa are indicated. ( c ) Transiently transfected HEK293 cells were subjected to ICC using the Flag antibody followed by Alexa Fluor 488 conjugated secondary antibody for visualization with a fluorescence microscope. DAPI was used for the nuclei staining. ( d ) HEK293 cells were transiently co-transfected with the expression vector bearing cDNA for a 3F-CXXC5 variant and HA-MeCP2. Nuclear extracts (500 ug) were subjected to Co-IP with the HA antibody or the isotype-matched IgG. The precipitates were subjected to SDS-15%PAGE followed by WB using the Flag antibody or the HA antibody. 10% of nuclear extracts was used as input control.

Article Snippet: For siRNA transfection, MCF7 cells in 6-well tissue culture plates were transiently transfected with the HiPerfect transfection reagent (Qiagen) using 10 nM a scrambled siRNA (AllStar, CtS), a siRNA specific for CXXC5 (siRNA#10; FlexiTube GeneSolution, Qiagen), as we described previously , , and/or a siRNA pool specific to MeCP2 (sc-35892, SCBT).

Techniques: Derivative Assay, Binding Assay, Mutagenesis, Transfection, Fluorescence, Microscopy, Staining, Expressing, Plasmid Preparation, Variant Assay, Co-Immunoprecipitation Assay, Control

Journal: Scientific Reports

Article Title: A prelude to the proximity interaction mapping of CXXC5

doi: 10.1038/s41598-021-97060-6

Figure Lengend Snippet: Identification of a sub-region of MeCP2 critical for interacting with CXXC5. ( a ) Schematics of the wild-type MeCP2 and the carboxyl-terminally truncated MeCP2 1-400 bearing the 3xFlag (3F) or the HA (HA) tag at the amino-terminus. The N-terminal domain (NTD), methyl CpG binding domain (MBD), inter-domain (ID), transcription repression domain (TRD), and C-terminal domain (CTD) containing a WW protein interaction domain are indicated. ( b ) The synthesis of MeCP2 (FL) or HA-MeCP2 1-400 (Δ) in transiently transfected cells was assessed with WB using the HA antibody. EV indicates empty vector as control and MM denotes molecular masses in kDa. ( c,d ) HEK293 cells were transiently co-transfected with the expression vector bearing cDNA for 3F-CXXC5 and HA-MeCP2 or HA-MeCP2 1-400 . Nuclear extracts were subjected to Co-IP with the HA or the isotype-matched IgG. The precipitates were subjected to WB using the Flag antibody. The membrane was re-probed with the HA antibody. 10% of nuclear extracts was used as input control. Molecular masses (MM) in kDa are indicated. ( e ) Nuclear extracts of HEK293 cells transiently co-transfected with an expression vector bearing cDNA for the 3F-CXXC domain (3F-CXXC), HA-MeCP2, or HA-MeCP2 1-400 , were subjected to WB using the Flag, HA or HDAC1 antibody. Molecular masses (MM) in kDa are indicated. ( f ) Nuclear extracts, 500 µg, co-synthesizing CXXC , and HA-MeCP2, or HA-MeCP2 1-400 , were subjected to Co-IP with the HA antibody or the isotype-matched IgG. The precipitates were subjected to WB using the Flag antibody. The membrane was also re-probed with the HA antibody. 10% of nuclear extracts was used as input control. Molecular masses (MM) in kDa are indicated.

Article Snippet: For siRNA transfection, MCF7 cells in 6-well tissue culture plates were transiently transfected with the HiPerfect transfection reagent (Qiagen) using 10 nM a scrambled siRNA (AllStar, CtS), a siRNA specific for CXXC5 (siRNA#10; FlexiTube GeneSolution, Qiagen), as we described previously , , and/or a siRNA pool specific to MeCP2 (sc-35892, SCBT).

Techniques: Binding Assay, Transfection, Plasmid Preparation, Control, Expressing, Co-Immunoprecipitation Assay, Membrane

Journal: Scientific Reports

Article Title: A prelude to the proximity interaction mapping of CXXC5

doi: 10.1038/s41598-021-97060-6

Figure Lengend Snippet: Assessing the interplay between CXXC5 and MeCP2 in CXXC5 target gene expressions. ( a ) MCF7 cells were untransfected (UT), or were transiently transfected with CtS, siRNA specific for CXXC5 (#10), and/or siRNA pool for MeCP2 (Me-SiR) for 48 h. To equalize the total amount of siRNA (20 nM) used in co-transfection experiments, 10 nM gene-specific siRNA was used together with 10 nM CtS. cDNA generated from total RNA were subjected to qPCR. The RPLP0 expression was used for normalization. Results, the mean ± S.E. of three independent determinations, depict fold change in comparison with transcript levels of CXXC5 or MeCP2 of UT, which were set to 1. The asterisk indicates a significant difference. ( b ) Nuclear extracts of transfected cells were also subjected to WB using the CXXC5 or MeCP2 antibody. HDAC1 was probed with an HDAC1-specific antibody. MMs in kDa are indicated. Uncropped blots are presented in Supplementary Information, Figure . ( c ) To assess the effect of reduction in CXXC5 and/or MeCP2 levels on gene expressions, MCF7 cells were transfected with CtS, #10, and/or Me-SiR as indicated for 48 h. cDNAs were then subjected to qPCR using primer sets specific to target genes. RPLP0 expressions were used for normalization. Results as fold change in gene expressions compared to those observed in CtS transfected cells are the mean ± S.E. of three independent determinations. Asterisks indicate significant differences. ( d ) To assess whether alterations in CXXC5 levels affect the MeCP2 loading on target promoters, MCF7 cells transfected with CtS (10 nM) or #10 (10 nM) for 48 h were subjected to ChIP using IgG or a MeCP2 antibody. Recovered DNAs were subjected to qPCR using primer sets for target gene promoters. Results, normalized to IgG, depict fold changes compared to CtS, which was set to 1.

Article Snippet: For siRNA transfection, MCF7 cells in 6-well tissue culture plates were transiently transfected with the HiPerfect transfection reagent (Qiagen) using 10 nM a scrambled siRNA (AllStar, CtS), a siRNA specific for CXXC5 (siRNA#10; FlexiTube GeneSolution, Qiagen), as we described previously , , and/or a siRNA pool specific to MeCP2 (sc-35892, SCBT).

Techniques: Transfection, Cotransfection, Generated, Expressing, Comparison

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for in vitro DNA pull-downs. b Whole cell extracts (WCE) from WT-MEF were incubated with streptavidin beads alone (mock) or with streptavidin beads-bound biotinylated dsDNA (b-dsDNA) or ssDNA (b-ssDNA) prior to in vitro DNA pull-down. Input and eluates were analyzed by Western blot (WB) using the indicated antibodies. c As in a , except that WCE from WT-RAW264.7 were used. d In vitro pulldown was performed as in c , except that beads-bound biotinylated dsRNA were also used. e In vitro pulldown was performed as in b , except that two different b-dsDNA were used. f Experimental scheme for in-cell DNA pulldowns. g WT-MEF were transfected with b-dsDNA or not (mock) before WCE preparation and streptavidin-affinity pull-down. Input and eluates were analyzed by WB using the indicated antibodies. h As in g , except that WCE were from WT-RAW264.7 cells transfected or not with b-dsDNA. i Immunofluorescence analysis was conducted on WT-MEF transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 10 µm, except for Zoom: 5 µm. j Violin plots show the % MeCP2 intensity in the cytosol in experiments performed as in i ( n = 123 for Mock and for 120 dsDNA-transfected cells). k Pearson’s correlation coefficient was calculated on the cytosolic dsDNA and MeCP2 signals in WT-MEF treated as in j . l Immunofluorescence analysis of WT-MEF transfected or not with dsDNA and ssDNA for 6 h was performed using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. BF, bright field. Scale bars: 10 µm; Scale bars for Zoomed images: 5 µm. Images are representative of 3 independent experiments. m Violin plots show the % MeCP2 intensity in the cytosol and nucleus in experiments performed as in l ; n = 105 cells per condition. WB and images are representative of at least 3 independent experiments. Significance was assessed using two-sided Student t-test. ns: non-significant. * P < 0.05, ** P < 0.01, and **** P < 0.0001. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: In Vitro, Incubation, Western Blot, Transfection, Immunofluorescence, Staining

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a WT-MEF were stimulated with dsDNA for 3, 6, and 16 h prior to immunofluorescence analyses using an MeCP2 targeting antibody and DAPI nuclear staining. Scale bars: 10 µm. b Violin plots show the number of MeCP2 foci intensity in the cytosol and in the nucleus in experiments performed as in a ; n > 50 cells per condition. c Immunofluorescence analysis was performed on WT-MEF treated or not with 20 nM of Leptomycin B (LMB) prior to dsDNA transfection for 3 h using anti-MeCP2 antibody (enhanced signal or not) and DAPI nuclear staining. Scale bars: 10 µm; Scale bar for Zoomed images: 5 µm. Images are representative of two independent experiments. d Violin plots show the % of MeCP2 intensity in the cytosol and nucleus in cells treated as in c ; n = 95 cells per condition. e Immunofluorescence analysis was conducted on WT-MEF and MEF cGas−/− cells transfected or not with dsDNA for 6 h using anti-MeCP2 antibody, anti-dsDNA antibody and DAPI nuclear staining. BF, bright field. Images are representative of 3 independent experiments. Scale bar: 20 µm. f Immunofluorescence analysis was performed on WT-MEF and MEF Trex1-/- using anti-MeCP2 antibody and DAPI nuclear staining. Scale bars: 20 µm. Images are representative of two independent experiments. g Violin plots show the % of MeCP2 intensity in the cytosol and nucleus of cells treated as in f , n = 97 cells per condition. Significance was assessed using a two-sided Student t -test. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Transfection

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF stably expressing a EGFP-cGAS construct (MEF EGFP-cGAS ) transfected or not with dsDNA for 6 h using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 20 µm; Scale bar for Zoom: 10 µm. (Right) Graph presents mean ± SEM. b Pearson’s correlation coefficient values for co-localization of cGas and MeCP2. p values were determined by Student’s t test. **** p < 0.0001; n = 12. c WT-MEF were transfected or not for 10 min, 30 min, 1 h, 3 h or 6 h with b-dsDNA before whole-cell extract preparation and pull-down using streptavidin-affinity beads. Input and eluates were analyzed by WB using the indicated antibodies. d WT-MEF were transfected or not with dsDNA before whole-cell extract preparation and immunoprecipitation using control IgG or a MeCP2-specific antibody. Input and immunoprecipitated material were analyzed by WB using the indicated antibodies. e MeCP2 knockout RAW264.7 were engineered to stably express FLAG-tagged MeCP2 prior to stimulation with dsDNA for 1, 3, 6 and 16 h. Whole cell extracts were subjected to FLAG immunoprecipitation prior to analysis of inputs and eluates by WB using the indicated antibodies. f Whole cell extracts prepared from WT-MEF or MEF cGas-/- cells were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. g Whole cell extracts prepared from MEF expressing a control non-targeting gRNA (MEF gCTRL ) or a MeCP2-targeting gRNA (MEF gMecp2 ) were incubated with streptavidin beads alone or with streptavidin bead-bound b-dsDNA prior to pull-down. Input and eluates were analyzed by WB using the indicated antibodies. All WB are representative of 3 independent experiments. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Stable Transfection, Expressing, Construct, Transfection, Staining, Immunoprecipitation, Control, Knock-Out, Incubation

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Immunofluorescence analysis was conducted on MEF gCTRL or MEF gMecp2 after challenge or not with dsDNA for 6 h, using anti-cGas antibody and DAPI nuclear staining. Scale bar: 20 µm. Images are representative of 3 independent experiments. b Intracellular 2’3’-cGAMP levels were measured by ELISA following transfection or not with the dsDNA of MEF gCTRL or MEF gMecp2 . Graph presents fold increase 2’3’-cGAMP levels from 5 independent experiments. c MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h prior to gene expression analyses. Graph presents mean (±SEM) Ifnβ , Cxcl10 , Il6 and Isg15 mRNA levels ( n = 3 independent experiments). d MEF gCTRL or MEF gMecp2 were challenged with dsDNA for 24 h prior to collection of the supernatant and analyses using proteome profiler antibody arrays. The heat map presents data obtained from duplicate measurements. e representative images of arrays from d . f MEF gCTRL or MEF gMecp2 were challenged or not with dsDNA for 6 h in the presence or not of the H-151 Sting inhibitor. Graphs present mean (±SEM) Ifnβ , Il6 , Ccl5 , Oas1 , and Ifit2 mRNA levels and mean centroid analysis ( n = 3 independent experiments). One-way ANOVA with Sidak’s multiple comparison. g MEF overexpressing WT-MeCP2 (eMeCP2) or not (Empty) were transfected or not with dsDNA for 6 h prior to analysis of Ifnβ , Il6 , Cxcl10 , and Mecp2 mRNA levels. Graphs present mean (±SEM) from 3 independent experiments. h MEF gCTRL or MEF gMecp2 were challenged or not with poly(I:C) for 6 h prior to gene expression analyses. Graphs present mean (±SEM) Ifnβ , Oasl1 , Cxcl10 , and Isg15 mRNA levels ( n = 3 independent experiments). Significance was assessed using a two-sided Student t -test, except when otherwise stated. Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Immunofluorescence, Staining, Enzyme-linked Immunosorbent Assay, Transfection, Gene Expression, Comparison

Journal: Nature Communications

Article Title: The methyl-CpG-binding protein 2 inhibits cGAS-associated signaling

doi: 10.1038/s41467-025-65713-z

Figure Lengend Snippet: a Experimental scheme for b – h. b WT-MEF infected or not with a GFP-expressing HSV-1 KOS64 at 0.5 or 5 multiplicity of infection (MOI) were analyzed by immunofluorescence using anti-MeCP2 antibody and DAPI nuclear staining. Images are representative of 3 independent experiments. Scale bar: 50 µm. c Percent MeCP2 intensity in the cytosol in cells infected as in ( b ); n = 30 cells per condition. d As in c , except that cells were infected with the EGFP-expressing HSV-1 McKrae at 1 MOI; n > 50 cells per condition. e MEF gCTRL or MEF gMecp2 were infected or not with 5 MOI of HSV-1-KOS64 for 6 and 16 h prior to analysis of expression of indicated genes. Graphs present the mean (±SEM) of 3 independent experiments. f Mean (±SEM) plaques per cm2 after 72 h of infection of MEF gCTRL or MEF gMecp2 with 1 MOI of HSV-1 KOS64. 8 replicates, representative of 3 independent experiments. g WT-MEF were infected with conditioned media from HSV-1 KOS64-infected MEF gCTRL or MEF gMecp2 . The graph presents the mean (±SEM) percentage GFP-positive cells in recipient cells ( n = 3 independent experiments). h Representative images of cells in g . Scale bar: 400 µm. i Gene Set Enrichment Analysis (GSEA) was performed looking for Biological Process on DESeq2 results (log2foldchange > 0.01. GSEA p -value cut off = 0.05) from RNAseq data from RAW264.7 gCTRL or RAW264.7 gMecp2 . j Gene expression analysis was performed in the livers of male Mecp2 +/y and Mecp2 -/y mice. Graph presents mean (±SEM) fold increase gene expression in Mecp2 -/y mice as compared to Mecp2 +/y ; n = 4 mice per group. k Mean centroid expression was calculated on the expression of genes indicated in j ( n = 4 mice per group). l Significant DEGs involved in inflammation, interferon-beta, virus response, STING, and innate immunity between hippocampi from control and Mecp2 -silenced mice. X-axis: the False Discovery Rate (FDR). Gene symbols are reported for genes relevant to innate immunity. m Example Gene Set upregulated in patients with severe RTT symptoms. Significance was assessed using a two-sided Student T-test except for h , j and k . Source data are provided as a Source Data file.

Article Snippet: F: CACCGCGCTCCATTATCCGTGACCG; R: CGCGAGGTAATAGGCACTGGCCAAA To generate the FLAG-tagged MeCP2 expressing construct, the MeCP2 gene was amplified by PCR from peGFP-N1-MeCP2 WT plasmid (Addgene #110186) using the Phusion High-Fidelity DNA polymerase kit (M0530L) followed by cloning into the pOZ vector .

Techniques: Infection, Expressing, Immunofluorescence, Staining, Gene Expression, Virus, Control

Journal: PLoS Genetics

Article Title: A Comprehensive Genomic Analysis Reveals the Genetic Landscape of Mitochondrial Respiratory Chain Complex Deficiencies

doi: 10.1371/journal.pgen.1005679

Figure Lengend Snippet: New genetic diagnoses for cases with genes not linked to mitochondrial respiratory chain complex deficiencies.

Article Snippet: Anti-MECP2 antibodies were purchased from Acris Antibodies and Merck Millipore.

Techniques: Biomarker Discovery, Functional Assay

Journal: Translational psychiatry

Article Title: Intranasal delivery of shRNA to knockdown the 5HT-2A receptor enhances memory and alleviates anxiety.

doi: 10.1038/s41398-024-02879-y

Figure Lengend Snippet: Fig. 3 Intranasal adeno-associated virus delivery of AAV9-MeCP2-GFP-mouse HTR2A-shRNA decreases anxiety. Mice were treated intranasally on day 1 with 2.0 × 1011 viral particles and compared to vehicle-controls either at 5-weeks (A, B) or 8-weeks (C, D) later in the light dark test to evaluate the relative anxiety status of mice. Results for 5-week AAV9-shRNA-treated mice indicated a 34% increase in the time spent in the lit box (N = 15, p-value <0.001) as well as an 22% increase in the number of entries into the lit box (p = 0.004). Following a retesting of the same animals at 8-weeks, a slightly diminished response in both parameters was noted, however, there was still a significant increase in the time spent in the lit box (C) (p-value = 0.04). The number of entries into the light box at 8-weeks just missed statistical significance (D) (p- value = 0.058). E Although there was a trend for slightly lower weight in AAV9-shRNA-treated mice, data indicated no significance between the two groups (p = 0.49). *Denotes statistical significance between the two groups (p-value < 0.05). NS denotes non-significant (p-value > 0.05).

Article Snippet: The first AAV9 expressed spCas9 under a neuronal-specific promoter, MeCP2, and the spCas9 vector utilized the PX551 plasmid from Addgene (pAAV-pMecp2-SpCas9-spA) [13].

Techniques: Virus, shRNA