mcerulean Search Results


92
Addgene inc nls sequence atgggccctaaaaagaagcgtaaagtc
Nls Sequence Atgggccctaaaaagaagcgtaaagtc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCerulean+N1+(Plasmid+%2327795)/arxiv__1503__06696-120-0-7
Average 92 stars, based on 1 article reviews
nls sequence atgggccctaaaaagaagcgtaaagtc - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Addgene inc mito mcerulean 433 475 55384
Mito Mcerulean 433 475 55384, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCerulean-Mito-7+(Plasmid+%2355384)/pmc06322684-702-67-33
Average 90 stars, based on 1 article reviews
mito mcerulean 433 475 55384 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

92
Addgene inc pcmv cib1 mcerulean mp
Pcmv Cib1 Mcerulean Mp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/pCMV-CIB1-mCerulean-MP+(Plasmid+%2358366)/pmc05640629-295-9-15
Average 92 stars, based on 1 article reviews
pcmv cib1 mcerulean mp - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

90
Addgene inc mcer 4aa vamp2
Mcer 4aa Vamp2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCer-4aa-VAMP2+(Plasmid+%2353233)/pmc04712786-395-10-20
Average 90 stars, based on 1 article reviews
mcer 4aa vamp2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Addgene inc venus c1
Venus C1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCerulean+C1+(Plasmid+%2327796)/pmc05082789-453-34-38
Average 93 stars, based on 1 article reviews
venus c1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc cre independent pre mgrasp
Cre Independent Pre Mgrasp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/paavCAG-pre-mGRASP-mCerulean+(Plasmid+%2334910)/pmc06705948-244-21-24
Average 93 stars, based on 1 article reviews
cre independent pre mgrasp - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
Addgene inc 220 constructs
220 Constructs, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/pTriEx-mCerulean-PA-Rac1+(Plasmid+%2322030)/10__1128_slash_mcb__00007___15-88-15-12
Average 92 stars, based on 1 article reviews
220 constructs - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

92
Addgene inc h2b mcerulean
H2b Mcerulean, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCerulean-H2B-6+(Plasmid+%2355374)/pm38381793-254-3-4
Average 92 stars, based on 1 article reviews
h2b mcerulean - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Addgene inc human synapsin hsyn promoter
Human Synapsin Hsyn Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/hSyn-BiPOLES-mCerulean+(Plasmid+%23154944)/bio_rxiv__2020__07__15__204347-78-15-20
Average 93 stars, based on 1 article reviews
human synapsin hsyn promoter - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc plm mcerulean cmyc lentiviral construct
Plm Mcerulean Cmyc Lentiviral Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/pLM-mCerulean-cMyc+(Plasmid+%2323244)/pmc05648000-404-43-46
Average 93 stars, based on 1 article reviews
plm mcerulean cmyc lentiviral construct - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Addgene inc jinhyun kim
Jinhyun Kim, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/paavCAG-pre-mGRASP-mCerulean-2A-nls-mCherry+(Plasmid+%2334911)/pm29720664-187-12-14
Average 93 stars, based on 1 article reviews
jinhyun kim - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Addgene inc mcerulean pcna 19 sv40nls 4
Mcerulean Pcna 19 Sv40nls 4, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mcerulean/mCerulean-PCNA-19-SV40NLS-4+(Plasmid+%2355386)/pmc06613105-167-35-45
Average 90 stars, based on 1 article reviews
mcerulean pcna 19 sv40nls 4 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results