Journal: Pharmaceutics

Article Title: In Silico Studies to Support Vaccine Development

doi: 10.3390/pharmaceutics15020654

Figure Lengend Snippet: Results from Phase 2 (Compilation of all in silico models to support vaccine development).

Article Snippet: Cancer vaccine , PBPK , To represent the distribution of certain molecules eluted through a 3D-printed implantable system named ‘NICHE’ , The NICHE platform aims to study immunomodulation for cell therapeutics and cancer vaccines. It is a two-compartment model composed of a vascularized tissue reservoir and a surrounding refillable drug reservoir. The PBPK model was able to recapitulate the biodistribution of the molecules in scope, and together with NICH, they represent a flexible, adaptable platform to investigate local immunomodulation for biomedical applications. , Simbiology (MATLAB 2021b, Mathworks) , Simone Capuani et al.; 2022 [ ] .

Techniques: In Silico, Software, Vaccines, Injection, Adjuvant, In Vivo, Formulation, Infection, Bioprocessing, Virus, Emulsion, Drug discovery, Neutralization, Concentration Assay, Biomarker Discovery, Construct, Binding Assay, Diffusion-based Assay, Recombinant, Immunopeptidomics, Solubility, Cloning

Journal: Cell systems

Article Title: Sparse dictionary learning recovers pleiotropy from human cell fitness screens.

doi: 10.1016/j.cels.2021.12.005

Figure Lengend Snippet: Figure 4. Modular pleiotropy within protein complexes resolves C7orf26 as a member of the Integrator complex INTS10-13-14 module (A) STAGA and ATAC protein complexes share a histone acetyltransferase module. From cancer cell fitness data alone, Webster inferred separate functional effects of STAGA and ATAC depletion while decomposing the effect of knocking out shared subunits as a mixture of STAGA and ATAC depletion. (B) The SWI/SNF family protein complexes consist of specialized subunits bound to the common enzymatic subunit SMARCA4. From cancer cell fitness data alone, Webster inferred separate functional effects of depleting each subcomplex while decomposing the effect of SMARCA4 knockout as affecting all three subcomplexes. (C) The Integrator complex is a modular RNA endonuclease complex. From cancer cell fitness data alone, Webster learned three distinct functional effects involving Integrator complex componentry. Each of the three functions captured the specific effect of knocking out recently discovered structural modules of the

Article Snippet: 2020.05.040, Table S2 Cancer Dependency Map, 19Q4 release (fitness data for Webster input) https://depmap.org/portal/ https://doi.org/10.6084/m9. figshare.11384241.v3 Cancer Dependency Map, 21Q2 release (omics data for biomarker pipeline) https://depmap.org/portal/ https://doi.org/10.6084/m9. figshare.14541774.v2 PRISM Drug Repurposing data (Corsello et al., 2020) https://doi.org/10.6084/m9. figshare.9393293.v4 Human Cell Map (proximity ligation data) (Go et al., 2021) http://doi.org/10.1038/s41586- 021-03592-2 Experimental models: Cell lines 293FT Thermo Fisher Scientific R70007 Oligonucleotides INTS6 Avana gRNA (chr13_51452485_+): ATGGCTGCGCTGGTTCATAG This paper N/A INTS10 Avana gRNA (chr8_19823975_-) : TCTTAAACAACCTCTCCCAA This paper N/A C7orf26 Avana gRNA (chr7_6594465_+) : TTACTGTGTGAGGTTAGCCA This paper N/A Recombinant DNA lentiCRISPR v2-Blast Addgene 83480 pLEX_307 Addgene 41392 pLX_HA This study 178534 pLX_HA-C7orf26v1 This study 178535 pLX_HA-C7orf26v2 This study 178536 pLX_317-C7orf26v1 This study 178537 pLX_317-C7orf26v2 Broad Institute Gene Perturbation Platform TRCN0000477172 (https://portals. broadinstitute.org/gpp/public/gene/ details?geneId=79034) Software and algorithms R R Foundation https://www.r-project.org/ MATLAB MathWorks https://www.mathworks.com/ products/matlab.html gProfiler (Raudvere et al., 2019) https://biit.cs.ut.ee/gprofiler/ DGRDL (Yankelevsky and Elad, 2016) https://elad.cs.technion.ac.il/software/ gene_fn This study https://doi.org/10.5281/zenodo.5773076 graph_dictionary_learning Various open source codebases https://doi.org/10.5281/zenodo.5773078 e1 Cell Systems 13, 286–303.e1–e10, April 20, 2022

Techniques: Functional Assay, Knock-Out