Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFR proteins in liver tissues of rats in each group. (A) Expression levels of MAT1A protein in liver tissues of rats in each group (n = 3); (B) Expression levels of AHCY protein in liver tissues of rats in each group (n = 3); (C) Expression levels of MYHFR protein in liver tissues of rats in each group (n = 3); (D) Expression levels of ALDH2 protein in liver tissues of rats in each group (n = 3); (E) Expression levels of CBS protein in liver tissues of rats in each group (n = 3). Note: Data are expressed as the mean ± SD. “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques: Expressing

Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: Expression levels of CBS, ALDH2, AHCY, MAT1A and MTHFRmRNA in liver tissues of rats in each group (A) Expression levels of ALDH2 mRNA in liver tissues of rats in each group (n = 3); (B) Expression levels of MTHFRmRNA in liver tissues of rats in each group (n = 3); (C) Expression levels of CBS mRNA in liver tissues of rats in each group (n = 3); (D) Expression levels of AHCY mRNA in liver tissues of rats in each group (n = 3); (E) Expression levels of MAT1A mRNA in liver tissues of rats in each group (n = 3). Note: “#” indicates that P < 0.05 compared with the normal group; “*” indicates that P < 0.05 compared with the model group.

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques: Expressing

Journal: Frontiers in Pharmacology

Article Title: Effect of gentiopicroside on endogenous formaldehyde homocysteine–pathway related proteins in rats with non-alcoholic steatohepatitis

doi: 10.3389/fphar.2025.1700101

Figure Lengend Snippet: The mechanism diagram of endogenous formaldehyde participating in one-carbon metabolism leading to homocysteine accumulation and causing NASH. Note: formaldehyde (Endogenous FA); Glutathione (GSH) Mitochondrial aldehyde dehydrogenase 2 (ALDH2); Formate; Tetrahydrofolate (THF); 5, 10-methylenetetrahydrofolate (5, 10-CH2-THF); Methylenetetrahydrofolate reductase (MTHFR); Homocysteine (HCY); S-adenosine homocysteine (SAH); Reactive oxygen species (ROS); Non-alcoholic steatohepatitis (NASH); Methionine Cystathionine -β -synthase (CBS); 5-methyltetrahydrofolate (5-CH3-THF); S-adenosylmethionine (SAM); Methionine adenosyltransferase 1A (MAT1A); S-adenosine homocysteine hydrolase (AHCY).

Article Snippet: ROS, GSH, MDA, SOD, SAH, SAM, GST, CAT, GSH, HCY were obtained from Jiangsu Enzyme Immunoassay Biotechnology Co., LTD. Their item numbers are MM-88564O1, MM-20251R1, MM-2037H1, MM-20387R1, MM-50456H1, MM-0248H1, MM-21254R1, MM-20447R1, MM-20251R1 and MM-50456H1. β-actin antibody (Proteintech, 20536-1-AP); ALDH2 antibody (Proteintech, 15310-1-AP); MAT1A antibody (Proteintech, 12395-1-AP); MTHFR antibody (Proteintech, 26591-1-AP); CBS antibody (Proteintech, 14787-1-AP); AHCY antibody (Proteintech, 10757-2-AP); PVDF membrane with a thickness of 0.45 μm (IPVH00010, Millipore); Universal total RNA extraction reagent (U7431, Suzhou Youyi Landi Biotechnology Co., LTD.) Taq SYBR® Green qPCR Premix (Universal) (EG0117M, Jiangsu Bishi Mei Biotechnology Co., LTD.) All-in-One First-Strand Synthesis MasterMix (with dsDNase) was obtained from Jiangsu Bestmate Biotechnology Co., LTD. (item number (EG15133S).

Techniques:

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Human MAT1A genetic polymorphisms Exons and untranslated regions (UTRs) are numbered relative to the A (nucleotide 1) in the ATG translation initiation codon in exon 1. Negative numbers were assigned to positions 5′ to that location, and positive numbers were assigned to positions 3′. Nucleotides located within introns are numbered on the basis of their distance from the nearest splice junction, with distances from 3′ splice junctions assigned positive numbers and distances from 5′ splice junctions assigned negative numbers. Exon sequences are bold. Polymorphisms identified previously are noted by reference SNP (rs) number.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques: Sequencing

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Human MAT1A and GNMT polymorphisms observed during gene resequencing. The figure shows a schematic representation of the human (A) MAT1A and (B) GNMT gene structures, with arrows indicating the locations of polymorphisms observed during the resequencing studies. Black rectangles represent exons encoding the opening reading frame, and open rectangles represent portions of exons encoding untranslated region sequences. The colors of arrows indicate minor allele frequencies.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques:

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: MAT1A allozyme functional genomics Values are mean ± S.E.M. for three independent determinations. The variant allozyme values did not differ significantly ( p > 0.05) from those for the WT allozyme for either apparent K m values or enzyme activity (measured using bacterially expressed protein) or relative protein quantity after expression in COS-1 cells.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques: Functional Assay, Variant Assay, Activity Assay, Expressing

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Human hepatic liver MAT1A and GNMT protein levels. A, MAT1A protein-level frequency distribution. B, GNMT protein-level frequency distribution. C, representative Western blot analysis gel with a, b, c, and d representing individual samples assayed in triplicate.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques: Western Blot

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Genotype-phenotype correlations for human hepatic MAT1A and GNMT. Negative log-transformed p values for single SNP associations with human liver (A) GNMT protein levels and (B) MAT1A protein levels using both genotyped SNPs and SNPs imputed by using 1000 Genomes Project data. Figure 4, A and B, shows SNPs within 20 kb of the 3′ and 5′ ends of the genes and includes only imputed SNPs with imputation quality score Rsq values >0.3. Black circles represent genotyped tag SNPs, and red triangles represent imputed SNPs. *, the threshold for significance after Bonferroni correction for GNMT. The structures of both genes are also shown schematically. C, the relationship between SNP genotypes for the GNMT rs9471976 and rs11752813 SNPs and hepatic GNMT protein is shown. Spearman's rank correlation coefficients (r) and p values are also shown.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques: Transformation Assay

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Spearman correlations and p values for correlations of levels of protein expression measured in 268 hepatic biopsy samples The three enzymes that are expressed primarily in liver, GNMT, MAT1A, and BHMT, are bolded. The p values listed in the table have been corrected for multiple comparisons.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques: Expressing

Journal: Drug Metabolism and Disposition

Article Title: Human Liver Methionine Cycle: MAT1A and GNMT Gene Resequencing, Functional Genomics, and Hepatic Genotype-Phenotype Correlation

doi: 10.1124/dmd.112.046953

Figure Lengend Snippet: Correlations between levels of MAT1A and BHMT protein in adult human liver biopsy samples plotted against log GNMT protein levels in the same samples adjusted for age. A, GNMT versus MAT1A. B, GNMT versus BHMT. Spearman's correlation coefficients, r, as well as p values for associations after correction for multiple comparisons are shown. In both panels, the level of log GNMT protein has been corrected for patient age.

Article Snippet: Mammalian expression constructs were created for wild-type (WT) MAT1A by subcloning the open reading frame of MAT1A from the Origene clone SC119881 (Origene, Rockville, MD) into pcDNA3.1D/V5-His-TOPO (Invitrogen, Carlsbad, CA) in frame with the V5-His tag, and site-directed mutagenesis was used to create variant allozyme expression constructs.

Techniques:

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 1 miR-664, miR-485-3p, and miR-495 are induced in HCC and negatively regulate MAT1A expression in liver cancer cell lines. (A) Northern blot analysis showing expression of select miRNAs in HCC compared with adjacent nontumorous (NT) tissue. (B) Northern blot analysis confirming siRNA knockdown efficiency of miR-664, miR-485-3p, and miR-495 in HepG2 and Hep3B cells as compared with scramble siRNA (SC) control. (C and D) Northern (top) and Western (bottom) blot analyses showing the effect of siRNA knockdown of miR-664, miR-485-3p and miR-495, alone or in combination, on MAT1A expression in HepG2 (C) and Hep3B cells (D). Numbers below the blots represent densitometric values expressed as percentage of respective controls. Representative blots are shown for C and D from 3 experiments, *P < 0.01 vs. SC; †P < 0.05 vs. SC, and triple knockdown; ‡P < 0.001 vs. SC and single knockdown.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Expressing, Northern Blot, Knockdown, Control, Western Blot

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 2 MAT1A 3′ UTR-driven reporter activity and the effect of mutating miRNA bind- ing sites. (A) Diagram of MAT1A 3′ UTR fragment containing the putative bind- ing sites for miR-664, miR-485-3p, and miR-495. Mutations created for each miRNA site are denoted in bold ital- ics. Transient transfection assays were performed using a luciferase reporter system with WT and mutated MAT1A 3′ UTR constructs as described in Methods in (B) HepG2 and (C) Hep3B cells. *P < 0.05 vs. control; †P < 0.05 vs. MAT1A 3′ UTR; ‡P < 0.05 vs. triple miRNA siRNA knockdown. n = 3 experi- ments, done in triplicate.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Activity Assay, Transfection, Luciferase, Construct, Control, Knockdown

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 3 Increased cellular apoptosis and decreased cell growth in Hep3B cells by miRNA knockdown requires MAT1A induction. (A) Apoptosis rates were determined by Hoechst staining at 24, 48, and 72 hours after tran- sient miRNA knockdown in Hep3B cells. *P < 0.01, **P < 0.05 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 12 determi- nations. (B) BrdU incorporation assay was measured at 24 hours after transient miRNA knockdown in Hep3B cells. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. single or triple siRNA knockdown. n = 3 experiments, each with 8 determinations. (C) To determine the role of MAT1A induction on growth, Hep3B cells stably trans- fected with miR-664, miR-485-3p, and miR-495 siRNA or scramble siRNA (stable SC) were transiently trans- fected with MAT1A siRNA or SC, and BrdU incorpo- ration and MAT1A protein levels were measured 24 hours later. *P < 0.05, **P < 0.01 vs. SC; †P < 0.05 vs. SC+MAT1Asi and each respective miRNA siRNA+SC. n = 3 experiments, each with 8 determinations for BrdU. Numbers below the Western blot represent mean den- sitometric values expressed as percentage of control.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Knockdown, Staining, BrdU Incorporation Assay, Stable Transfection, Western Blot, Control

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 4 Effect of stably transfected miR-664, miR-485, and miR-495 and their siRNAs on tumor growth in a xenograft mouse model. Nude mice were injected with Hep3B cells subcutaneously containing either (A) stably transfected miR-664, miR-485, and miR-495 (*P < 0.05, **P < 0.01 vs. EV; †P < 0.05 vs. miR-664 or miR-485; n = 8) or (B) stably transfected siRNAs against miR-664, miR-485-3p, and miR-495 (*P < 0.05, **P < 0.0001 vs. SC; †P < 0.05 vs. miR-664-si or miR-485-3psi; n = 8), and tumor volumes were measured over time. (C) Representative pictures of subcutane- ous tumors at 8 weeks following injection of cells containing stably transfected miRNAs (left) and siRNAs (right) (top row), immunohistochemistry stained for PCNA (middle row) and MAT1A protein expression (bottom row) Original magnification, ×200. Numbers below PCNA staining repre- sent percentage of positively stained cells. *P < 0.01 vs. miR-485, miR-664 and EV; †P < 0.05 vs. EV; ‡P < 0.05 vs. miR-485-3psi, miR-664si and SC; §P < 0.05 vs. SC.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Stable Transfection, Transfection, Injection, Immunohistochemistry, Staining, Expressing

Journal: Journal of Clinical Investigation

Article Title: MicroRNAs regulate methionine adenosyltransferase 1A expression in hepatocellular carcinoma

doi: 10.1172/jci63861

Figure Lengend Snippet: Figure 6 Role of MAT1A in tumorigenesis and therapeutic effect of miR-495 siRNA. HepG2 cells were injected into the left hepatic lobe of male BALB/c nude mice and lentiviral vectors containing MAT1A siRNA (MAT1Asi), miR-495 siRNA (miR-495si), and scramble siRNA (SC), alone or together, were injected into the spleen at the time of HepG2 cell injection (n = 8 per group). Control group received only HepG2 cell injection. Two weeks later, lentiviral siRNAs were injected into the tail vein, and this was repeated every 2 weeks until sacrifice at 8 weeks. First row: arrows point to tumors at the site of injection, and tumor volumes are shown below. *P < 0.005 vs. SC+SC; †P < 0.005 vs. MAT1Asi+SC; ‡P < 0.05 vs. miR- 495si+MAT1Asi. Second and third rows show metastasis to lung and pancreas (indicated by arrows) in the various treatment groups, with the incidence shown below. Original magnification, ×200.

Article Snippet: Lenti-MAT1A siRNA was purchased from Applied Biological Material Inc. siRNA to hsa–miR-664 (AGGCTGGGGATAATTGAAT), hsa–miR485-3p (AGAGGAGAGCCGTGTATGAC), and hsa–miR-495 (5′-AGAAGTGCACCATGTTTGTT-3′) were purchased from EXIQON. pMir-Target vector for MAT1A 3′ UTR clone was purchased from OriGene Technologies.

Techniques: Injection, Control