map4k4 Search Results


86
Thermo Fisher gene exp map4k4 mm00500812 m1
Gene Exp Map4k4 Mm00500812 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp map4k4 mm00500812 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp map4k4 mm00500812 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

92
MedChemExpress map4k4 in 3
(A) Representative images of Vinculin-mIFP-transfected HT1080 cells carrying the OptoKANK constructs before and after blue light illumination of the focal adhesion (yellow dotted line) for control cells, cells treated with a calpain inhibitor, calpastatin, a kinesin-V inhibitor, monastrol, a dynamic inhibitor, dynasore, a MMP inhibitor, Batimastat, a <t>MAP4K4</t> inhibitor, MAP4K4-IN-3, and depleted for BNIP2 and ARP2. Graph shows the normalized mean vinculin intensity after the illumination of cells treated as indicated (Data are presented as mean ± s.e.m; Ctrl, n =19; Nocodazole, n = 12; Calpastatin, n = 10; Monastrol, n = 8; Dynasore, n = 10; MMP inhibitor, n = 7; CNO3, n = 8; Tubacin, n = 12, MAP4-K4-IN3, n = 9; siRNA BNIP2, n = 16; siRNA AR2, n = 10). Immunoblots of BNIP2, ARP2, acetylated tubulin and GAPDH are shown in the black box.
Map4k4 In 3, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/map4k4 in 3/product/MedChemExpress
Average 92 stars, based on 1 article reviews
map4k4 in 3 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

hgk  (OriGene)
90
OriGene hgk
a Western-assisted analysis of <t>HGK</t> after TIIA treatment as indicated for 24 h in 143B and MG63 cells. b 143B cells were pretreated with GNE-495 (8 nM, 1 h) followed by TIIA treatment as indicated for 24 h. Total lysates were immunoblotted for LC3B, HGK, and p-SAPK/JNK expression. c , <t>d</t> <t>shRNA</t> HGK was stably transfected into 143B ( c ) and MG63 cells ( d ). Following treatment with TIIA (20 μM) for indicated time intervals, total lysates were immunoblotted for LC3B, HGK, SESN2, p-SAPK/JNK, JNK1, p-c-Jun, and total c-Jun expression. β-actin served as loading control. e , f Representative images of colonies of 143B-HGK KD (shHGK) and 143B-mock (nonsense) cells in a soft agar colony formation assay in the absence or presence of various concentrations of TIIA were captured using a microscope. Scale bar: 500 μm ( e ). Results were expressed as average number of colonies counted (in six microfields) ( f ). g , h 143B cells were transiently transfected with the AP-1 luciferase reporter construct ( g ) or SESN2 promoter luciferase reporter construct ( h ). After 24 h, the cells were treated with various concentrations of TIIA for another 12 h and the relative luciferase activity was measured and presented as relative AP-1 activity or relative SESN2 promoter activity. The results were expressed as the means ± SD from three independent experiments ( n ≥ 3, * P < 0.05 compared with untreated control)
Hgk, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hgk/product/OriGene
Average 90 stars, based on 1 article reviews
hgk - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Proteintech anti map4k4
a Western-assisted analysis of <t>HGK</t> after TIIA treatment as indicated for 24 h in 143B and MG63 cells. b 143B cells were pretreated with GNE-495 (8 nM, 1 h) followed by TIIA treatment as indicated for 24 h. Total lysates were immunoblotted for LC3B, HGK, and p-SAPK/JNK expression. c , <t>d</t> <t>shRNA</t> HGK was stably transfected into 143B ( c ) and MG63 cells ( d ). Following treatment with TIIA (20 μM) for indicated time intervals, total lysates were immunoblotted for LC3B, HGK, SESN2, p-SAPK/JNK, JNK1, p-c-Jun, and total c-Jun expression. β-actin served as loading control. e , f Representative images of colonies of 143B-HGK KD (shHGK) and 143B-mock (nonsense) cells in a soft agar colony formation assay in the absence or presence of various concentrations of TIIA were captured using a microscope. Scale bar: 500 μm ( e ). Results were expressed as average number of colonies counted (in six microfields) ( f ). g , h 143B cells were transiently transfected with the AP-1 luciferase reporter construct ( g ) or SESN2 promoter luciferase reporter construct ( h ). After 24 h, the cells were treated with various concentrations of TIIA for another 12 h and the relative luciferase activity was measured and presented as relative AP-1 activity or relative SESN2 promoter activity. The results were expressed as the means ± SD from three independent experiments ( n ≥ 3, * P < 0.05 compared with untreated control)
Anti Map4k4, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti map4k4/product/Proteintech
Average 93 stars, based on 1 article reviews
anti map4k4 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Addgene inc map4k4 grnas
HGK is upregulated in PCa patient samples and cell lines. ( A ) <t>MAP4K4</t> mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .
Map4k4 Grnas, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/map4k4 grnas/product/Addgene inc
Average 93 stars, based on 1 article reviews
map4k4 grnas - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

91
Addgene inc map4k4 sg1
HGK is upregulated in PCa patient samples and cell lines. ( A ) <t>MAP4K4</t> mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .
Map4k4 Sg1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/map4k4 sg1/product/Addgene inc
Average 91 stars, based on 1 article reviews
map4k4 sg1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier

93
Bethyl anti map4k4 hgk antibody
HGK is upregulated in PCa patient samples and cell lines. ( A ) <t>MAP4K4</t> mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .
Anti Map4k4 Hgk Antibody, supplied by Bethyl, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti map4k4 hgk antibody/product/Bethyl
Average 93 stars, based on 1 article reviews
anti map4k4 hgk antibody - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

86
Thermo Fisher gene exp map4k4 rn01437980 m1
HGK is upregulated in PCa patient samples and cell lines. ( A ) <t>MAP4K4</t> mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .
Gene Exp Map4k4 Rn01437980 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp map4k4 rn01437980 m1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp map4k4 rn01437980 m1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier

94
Thermo Fisher gene exp map4k4 hs01101394 m1
HGK is upregulated in PCa patient samples and cell lines. ( A ) <t>MAP4K4</t> mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .
Gene Exp Map4k4 Hs01101394 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp map4k4 hs01101394 m1/product/Thermo Fisher
Average 94 stars, based on 1 article reviews
gene exp map4k4 hs01101394 m1 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Thermo Fisher gene exp map4k4 hs00377415 m1
( a ) SLC2A1 expression in hiPSC-CMs after 8 and 24 h hypoxia in control (C, n 8h = 6, n 24h = 5) and hypoxia (H, n 8h = 5, n 24h = 6) samples as well as 8 and 24 h hypoxia-reoxygenation (HR) in control (C, n 8h = 4, n 24h = 4) and hypoxia (H, n 8h = 4, n 24h = 4) samples from qPCR analysis presented as mean + standard deviation. SLC2A1 encodes glucose transporter 1 and is related to glucose uptake of the cells. As can be seen, SLC2A1 expression increases during hypoxia, and decreases during reoxygenation. However, after 24 h hypoxia-reoxygenation, the expression levels are still higher than in control. ( b ) SLC8A1 expression in hiPSC-CMs after 8 and 24 h hypoxia as well as 8 and 24 h hypoxia-reoxygenation. SLC8A1 encodes sodium/calcium exchanger and is related to calcium handling of hiPSC-CMs. As can be seen from the figure, the expression decreases after 8 and 24 h hypoxia-reoxygenation, but does not change significantly during hypoxia only. ( c ) Expression of several genes after 24 h hypoxia-reoxygenation. The expression of metabolic genes (ACADM and PFKM), sarcomeric genes (TNNT2 and MYBPC3), calcium handling genes (RYR2 and ATP2A2) and hypoxia marker <t>MAP4K4</t> are all decreasing when compared to control. *p < 0.05.
Gene Exp Map4k4 Hs00377415 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp map4k4 hs00377415 m1/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
gene exp map4k4 hs00377415 m1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Thermo Fisher gene exp map4k4 hs00377405 m1
( a ) SLC2A1 expression in hiPSC-CMs after 8 and 24 h hypoxia in control (C, n 8h = 6, n 24h = 5) and hypoxia (H, n 8h = 5, n 24h = 6) samples as well as 8 and 24 h hypoxia-reoxygenation (HR) in control (C, n 8h = 4, n 24h = 4) and hypoxia (H, n 8h = 4, n 24h = 4) samples from qPCR analysis presented as mean + standard deviation. SLC2A1 encodes glucose transporter 1 and is related to glucose uptake of the cells. As can be seen, SLC2A1 expression increases during hypoxia, and decreases during reoxygenation. However, after 24 h hypoxia-reoxygenation, the expression levels are still higher than in control. ( b ) SLC8A1 expression in hiPSC-CMs after 8 and 24 h hypoxia as well as 8 and 24 h hypoxia-reoxygenation. SLC8A1 encodes sodium/calcium exchanger and is related to calcium handling of hiPSC-CMs. As can be seen from the figure, the expression decreases after 8 and 24 h hypoxia-reoxygenation, but does not change significantly during hypoxia only. ( c ) Expression of several genes after 24 h hypoxia-reoxygenation. The expression of metabolic genes (ACADM and PFKM), sarcomeric genes (TNNT2 and MYBPC3), calcium handling genes (RYR2 and ATP2A2) and hypoxia marker <t>MAP4K4</t> are all decreasing when compared to control. *p < 0.05.
Gene Exp Map4k4 Hs00377405 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp map4k4 hs00377405 m1/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
gene exp map4k4 hs00377405 m1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Addgene inc algorithms fiji nih
( a ) SLC2A1 expression in hiPSC-CMs after 8 and 24 h hypoxia in control (C, n 8h = 6, n 24h = 5) and hypoxia (H, n 8h = 5, n 24h = 6) samples as well as 8 and 24 h hypoxia-reoxygenation (HR) in control (C, n 8h = 4, n 24h = 4) and hypoxia (H, n 8h = 4, n 24h = 4) samples from qPCR analysis presented as mean + standard deviation. SLC2A1 encodes glucose transporter 1 and is related to glucose uptake of the cells. As can be seen, SLC2A1 expression increases during hypoxia, and decreases during reoxygenation. However, after 24 h hypoxia-reoxygenation, the expression levels are still higher than in control. ( b ) SLC8A1 expression in hiPSC-CMs after 8 and 24 h hypoxia as well as 8 and 24 h hypoxia-reoxygenation. SLC8A1 encodes sodium/calcium exchanger and is related to calcium handling of hiPSC-CMs. As can be seen from the figure, the expression decreases after 8 and 24 h hypoxia-reoxygenation, but does not change significantly during hypoxia only. ( c ) Expression of several genes after 24 h hypoxia-reoxygenation. The expression of metabolic genes (ACADM and PFKM), sarcomeric genes (TNNT2 and MYBPC3), calcium handling genes (RYR2 and ATP2A2) and hypoxia marker <t>MAP4K4</t> are all decreasing when compared to control. *p < 0.05.
Algorithms Fiji Nih, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/algorithms fiji nih/product/Addgene inc
Average 93 stars, based on 1 article reviews
algorithms fiji nih - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

Image Search Results


(A) Representative images of Vinculin-mIFP-transfected HT1080 cells carrying the OptoKANK constructs before and after blue light illumination of the focal adhesion (yellow dotted line) for control cells, cells treated with a calpain inhibitor, calpastatin, a kinesin-V inhibitor, monastrol, a dynamic inhibitor, dynasore, a MMP inhibitor, Batimastat, a MAP4K4 inhibitor, MAP4K4-IN-3, and depleted for BNIP2 and ARP2. Graph shows the normalized mean vinculin intensity after the illumination of cells treated as indicated (Data are presented as mean ± s.e.m; Ctrl, n =19; Nocodazole, n = 12; Calpastatin, n = 10; Monastrol, n = 8; Dynasore, n = 10; MMP inhibitor, n = 7; CNO3, n = 8; Tubacin, n = 12, MAP4-K4-IN3, n = 9; siRNA BNIP2, n = 16; siRNA AR2, n = 10). Immunoblots of BNIP2, ARP2, acetylated tubulin and GAPDH are shown in the black box.

Journal: bioRxiv

Article Title: Focal adhesions are controlled by microtubules through local contractility regulation

doi: 10.1101/2023.04.17.535593

Figure Lengend Snippet: (A) Representative images of Vinculin-mIFP-transfected HT1080 cells carrying the OptoKANK constructs before and after blue light illumination of the focal adhesion (yellow dotted line) for control cells, cells treated with a calpain inhibitor, calpastatin, a kinesin-V inhibitor, monastrol, a dynamic inhibitor, dynasore, a MMP inhibitor, Batimastat, a MAP4K4 inhibitor, MAP4K4-IN-3, and depleted for BNIP2 and ARP2. Graph shows the normalized mean vinculin intensity after the illumination of cells treated as indicated (Data are presented as mean ± s.e.m; Ctrl, n =19; Nocodazole, n = 12; Calpastatin, n = 10; Monastrol, n = 8; Dynasore, n = 10; MMP inhibitor, n = 7; CNO3, n = 8; Tubacin, n = 12, MAP4-K4-IN3, n = 9; siRNA BNIP2, n = 16; siRNA AR2, n = 10). Immunoblots of BNIP2, ARP2, acetylated tubulin and GAPDH are shown in the black box.

Article Snippet: Pharmacological treatments were performed using the following concentrations of inhibitors or activators: 1 μM for Nocodazole (Sigma-Aldrich), 0.4 μM for Y-27632 dihydrochloride (Sigma-Aldrich), 20 mM for Acetyl-Calpastatin (Tocris, Cat. No. 2950), Monastrol (Merk, cat. No. 254753-54-3), 80 µM for Dynasore (Abcam Cat. No. 120192), Batimastat (Tocris Cat. No. 2961), Tubacin (Cat. No. 3402), MAP4K4-IN-3 (MedChemExpress, Cat. No.: HY-125012), 1 µM for FRAX1036 (MedChemExpress Cat. No. HY-19538), 50 µM for Kinesore (Cat. No. 6664), 5 µM for PF-57328 (Tocris, Cat. No. 3239), and 1 μg ml - for Rho activator II (CNO3, Cytoskeleton).

Techniques: Transfection, Construct, Control, Western Blot

a Western-assisted analysis of HGK after TIIA treatment as indicated for 24 h in 143B and MG63 cells. b 143B cells were pretreated with GNE-495 (8 nM, 1 h) followed by TIIA treatment as indicated for 24 h. Total lysates were immunoblotted for LC3B, HGK, and p-SAPK/JNK expression. c , d shRNA HGK was stably transfected into 143B ( c ) and MG63 cells ( d ). Following treatment with TIIA (20 μM) for indicated time intervals, total lysates were immunoblotted for LC3B, HGK, SESN2, p-SAPK/JNK, JNK1, p-c-Jun, and total c-Jun expression. β-actin served as loading control. e , f Representative images of colonies of 143B-HGK KD (shHGK) and 143B-mock (nonsense) cells in a soft agar colony formation assay in the absence or presence of various concentrations of TIIA were captured using a microscope. Scale bar: 500 μm ( e ). Results were expressed as average number of colonies counted (in six microfields) ( f ). g , h 143B cells were transiently transfected with the AP-1 luciferase reporter construct ( g ) or SESN2 promoter luciferase reporter construct ( h ). After 24 h, the cells were treated with various concentrations of TIIA for another 12 h and the relative luciferase activity was measured and presented as relative AP-1 activity or relative SESN2 promoter activity. The results were expressed as the means ± SD from three independent experiments ( n ≥ 3, * P < 0.05 compared with untreated control)

Journal: Cell Death & Disease

Article Title: HGK-sestrin 2 signaling-mediated autophagy contributes to antitumor efficacy of Tanshinone IIA in human osteosarcoma cells

doi: 10.1038/s41419-018-1016-9

Figure Lengend Snippet: a Western-assisted analysis of HGK after TIIA treatment as indicated for 24 h in 143B and MG63 cells. b 143B cells were pretreated with GNE-495 (8 nM, 1 h) followed by TIIA treatment as indicated for 24 h. Total lysates were immunoblotted for LC3B, HGK, and p-SAPK/JNK expression. c , d shRNA HGK was stably transfected into 143B ( c ) and MG63 cells ( d ). Following treatment with TIIA (20 μM) for indicated time intervals, total lysates were immunoblotted for LC3B, HGK, SESN2, p-SAPK/JNK, JNK1, p-c-Jun, and total c-Jun expression. β-actin served as loading control. e , f Representative images of colonies of 143B-HGK KD (shHGK) and 143B-mock (nonsense) cells in a soft agar colony formation assay in the absence or presence of various concentrations of TIIA were captured using a microscope. Scale bar: 500 μm ( e ). Results were expressed as average number of colonies counted (in six microfields) ( f ). g , h 143B cells were transiently transfected with the AP-1 luciferase reporter construct ( g ) or SESN2 promoter luciferase reporter construct ( h ). After 24 h, the cells were treated with various concentrations of TIIA for another 12 h and the relative luciferase activity was measured and presented as relative AP-1 activity or relative SESN2 promoter activity. The results were expressed as the means ± SD from three independent experiments ( n ≥ 3, * P < 0.05 compared with untreated control)

Article Snippet: For knockdown of SESN2, BECN1, and HGK, pGFP-V-RS plasmid encoding shRNA against human SESN2 (TG301755), BECN1 (TG314484), and HGK (TG320615) were purchased from OriGene (Rockville, MD).

Techniques: Western Blot, Expressing, shRNA, Stable Transfection, Transfection, Soft Agar Assay, Microscopy, Luciferase, Construct, Activity Assay

HGK is upregulated in PCa patient samples and cell lines. ( A ) MAP4K4 mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .

Journal: Scientific Reports

Article Title: HGK promotes metastatic dissemination in prostate cancer

doi: 10.1038/s41598-021-91292-2

Figure Lengend Snippet: HGK is upregulated in PCa patient samples and cell lines. ( A ) MAP4K4 mRNA levels in PCa patients and normal tissue obtained from indicated databases. ( B ) MAP4K4 mRNA levels in the indicated PCa cell lines. ( C ) Western-blot analysis of HGK protein levels in the indicated PCa cell lines normalized with β-actin. Densitometric quantification of HGK/tubulin is shown. Full-length blots are presented in Supplementary Figure .

Article Snippet: Specific MAP4K4 gRNAs were annealed and cloned in plasmid lentiGuide-puro plasmid (Addgene #52963) using BsmBI cloning site (Forward seq 5′- CACCG AGTTGGTCATCATGTCCTGG-3′ and reverse AAAC CCAGGACATGATGACCAACTC).

Techniques: Western Blot

High levels of HGK predict a poor prognosis in PCa patients. ( A ) Kaplan–Meier curves showing the difference in BCR-free survival between patients with high and low expression levels of MAP4K4 . ( B ) Kaplan–Meier curves showing the difference in BCR-free survival between hormonal-therapy treated patients with high and low expression levels of MAP4K . ( C ) MAP4K4 expression in hormonal-therapy resistant and sensitive PCa patients (TCGA, cutoff for resistance: relapse before 40 months, n = 32). ( D ) Schematic summarizing of the regulation of Focal Adhesion (FA) turnover and its impact on cellular motility by HGK.

Journal: Scientific Reports

Article Title: HGK promotes metastatic dissemination in prostate cancer

doi: 10.1038/s41598-021-91292-2

Figure Lengend Snippet: High levels of HGK predict a poor prognosis in PCa patients. ( A ) Kaplan–Meier curves showing the difference in BCR-free survival between patients with high and low expression levels of MAP4K4 . ( B ) Kaplan–Meier curves showing the difference in BCR-free survival between hormonal-therapy treated patients with high and low expression levels of MAP4K . ( C ) MAP4K4 expression in hormonal-therapy resistant and sensitive PCa patients (TCGA, cutoff for resistance: relapse before 40 months, n = 32). ( D ) Schematic summarizing of the regulation of Focal Adhesion (FA) turnover and its impact on cellular motility by HGK.

Article Snippet: Specific MAP4K4 gRNAs were annealed and cloned in plasmid lentiGuide-puro plasmid (Addgene #52963) using BsmBI cloning site (Forward seq 5′- CACCG AGTTGGTCATCATGTCCTGG-3′ and reverse AAAC CCAGGACATGATGACCAACTC).

Techniques: Expressing

( a ) SLC2A1 expression in hiPSC-CMs after 8 and 24 h hypoxia in control (C, n 8h = 6, n 24h = 5) and hypoxia (H, n 8h = 5, n 24h = 6) samples as well as 8 and 24 h hypoxia-reoxygenation (HR) in control (C, n 8h = 4, n 24h = 4) and hypoxia (H, n 8h = 4, n 24h = 4) samples from qPCR analysis presented as mean + standard deviation. SLC2A1 encodes glucose transporter 1 and is related to glucose uptake of the cells. As can be seen, SLC2A1 expression increases during hypoxia, and decreases during reoxygenation. However, after 24 h hypoxia-reoxygenation, the expression levels are still higher than in control. ( b ) SLC8A1 expression in hiPSC-CMs after 8 and 24 h hypoxia as well as 8 and 24 h hypoxia-reoxygenation. SLC8A1 encodes sodium/calcium exchanger and is related to calcium handling of hiPSC-CMs. As can be seen from the figure, the expression decreases after 8 and 24 h hypoxia-reoxygenation, but does not change significantly during hypoxia only. ( c ) Expression of several genes after 24 h hypoxia-reoxygenation. The expression of metabolic genes (ACADM and PFKM), sarcomeric genes (TNNT2 and MYBPC3), calcium handling genes (RYR2 and ATP2A2) and hypoxia marker MAP4K4 are all decreasing when compared to control. *p < 0.05.

Journal: Scientific Reports

Article Title: Human induced pluripotent stem cell-based platform for modeling cardiac ischemia

doi: 10.1038/s41598-021-83740-w

Figure Lengend Snippet: ( a ) SLC2A1 expression in hiPSC-CMs after 8 and 24 h hypoxia in control (C, n 8h = 6, n 24h = 5) and hypoxia (H, n 8h = 5, n 24h = 6) samples as well as 8 and 24 h hypoxia-reoxygenation (HR) in control (C, n 8h = 4, n 24h = 4) and hypoxia (H, n 8h = 4, n 24h = 4) samples from qPCR analysis presented as mean + standard deviation. SLC2A1 encodes glucose transporter 1 and is related to glucose uptake of the cells. As can be seen, SLC2A1 expression increases during hypoxia, and decreases during reoxygenation. However, after 24 h hypoxia-reoxygenation, the expression levels are still higher than in control. ( b ) SLC8A1 expression in hiPSC-CMs after 8 and 24 h hypoxia as well as 8 and 24 h hypoxia-reoxygenation. SLC8A1 encodes sodium/calcium exchanger and is related to calcium handling of hiPSC-CMs. As can be seen from the figure, the expression decreases after 8 and 24 h hypoxia-reoxygenation, but does not change significantly during hypoxia only. ( c ) Expression of several genes after 24 h hypoxia-reoxygenation. The expression of metabolic genes (ACADM and PFKM), sarcomeric genes (TNNT2 and MYBPC3), calcium handling genes (RYR2 and ATP2A2) and hypoxia marker MAP4K4 are all decreasing when compared to control. *p < 0.05.

Article Snippet: MAP4K4 , Mitogen-activated protein kinase kinase kinase kinase 4 , Hypoxia marker , Hs00377415_m1.

Techniques: Expressing, Control, Standard Deviation, Marker

TaqMan 20 × Assays used in qPCR.

Journal: Scientific Reports

Article Title: Human induced pluripotent stem cell-based platform for modeling cardiac ischemia

doi: 10.1038/s41598-021-83740-w

Figure Lengend Snippet: TaqMan 20 × Assays used in qPCR.

Article Snippet: MAP4K4 , Mitogen-activated protein kinase kinase kinase kinase 4 , Hypoxia marker , Hs00377415_m1.

Techniques: Functional Assay, Binding Assay, Marker