m3567 Search Results


N/A
GeneCopoeia offers the largest collection of ORF cDNA clones, with genome-wide coverage for human and mouse. All ORF cDNAs can be readily expressed in combination with a variety of fusion tags (fluorescence, antibody, solubility, purification
  Buy from Supplier

96
Santa Cruz Biotechnology milk pbs t
Milk Pbs T, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m3567/RPA194+Antibody/bio_rxiv__646471-95-32-37
Average 96 stars, based on 1 article reviews
milk pbs t - by Bioz Stars, 2026-10
96/100 stars
  Buy from Supplier

95
Proteintech m3567
M3567, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m3567/NONO+Antibody/pm41270757-245-144-150
Average 95 stars, based on 1 article reviews
m3567 - by Bioz Stars, 2026-10
95/100 stars
  Buy from Supplier

99
Thermo Fisher milk pbs t
Milk Pbs T, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/m3567/PBS/bio_rxiv__646471-95-32-53
Average 99 stars, based on 1 article reviews
milk pbs t - by Bioz Stars, 2026-10
99/100 stars
  Buy from Supplier


N/A
MicroRNA: mmu-miR-6971-3p Accession Number: MIMAT0027845 Mature Sequence: ACAGCCUCUGCUUCUUCUCAG mmu-miR-6971-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
  Buy from Supplier

N/A
GeneCopoeia offers the largest collection of ORF cDNA clones, with genome-wide coverage for human and mouse. All ORF cDNAs can be readily expressed in combination with a variety of fusion tags (fluorescence, antibody, solubility, purification
  Buy from Supplier

N/A
Difluprednate
  Buy from Supplier

N/A
The Human CD31/PECAM-1 Biotinylated Antibody from R&D Systems is a CD31/PECAM-1 antibody to CD31/PECAM-1. This antibody reacts with Human. The CD31/PECAM-1 antibody has been validated for the following applications: Western Blot, Flow Cytometry.
  Buy from Supplier

N/A
The ZNF346 Antibody (2D10) from Novus is a ZNF346 antibody to ZNF346. This antibody reacts with Human. The ZNF346 antibody has been validated for the following applications: Western Blot, ELISA, Sandwich ELISA, Knockdown Validated.
  Buy from Supplier



Image Search Results