lta Search Results


lta  (InvivoGen)
95
InvivoGen lta
Lta, supplied by InvivoGen, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lta/product/InvivoGen
Average 95 stars, based on 1 article reviews
lta - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier
gene exp lta mm00440229 g1  (Thermo Fisher)
91
Thermo Fisher gene exp lta mm00440229 g1
Gene Exp Lta Mm00440229 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lta mm00440229 g1/product/Thermo Fisher
Average 91 stars, based on 1 article reviews
gene exp lta mm00440229 g1 - by Bioz Stars, 2026-03
91/100 stars
  Buy from Supplier
lipoteichoic acid  (Cusabio)
90
Cusabio lipoteichoic acid
Lipoteichoic Acid, supplied by Cusabio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lipoteichoic acid/product/Cusabio
Average 90 stars, based on 1 article reviews
lipoteichoic acid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier
lta4h proteintech  (Proteintech)
93
Proteintech lta4h proteintech
Lta4h Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lta4h proteintech/product/Proteintech
Average 93 stars, based on 1 article reviews
lta4h proteintech - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
gene exp lta hs00236874 m1  (Thermo Fisher)
98
Thermo Fisher gene exp lta hs00236874 m1
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Gene Exp Lta Hs00236874 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lta hs00236874 m1/product/Thermo Fisher
Average 98 stars, based on 1 article reviews
gene exp lta hs00236874 m1 - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier
tnf β elisa kit  (Boster Bio)
93
Boster Bio tnf β elisa kit
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Tnf β Elisa Kit, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tnf β elisa kit/product/Boster Bio
Average 93 stars, based on 1 article reviews
tnf β elisa kit - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
snp lta c 7514879 10  (Thermo Fisher)
96
Thermo Fisher snp lta c 7514879 10
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Snp Lta C 7514879 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/snp lta c 7514879 10/product/Thermo Fisher
Average 96 stars, based on 1 article reviews
snp lta c 7514879 10 - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier
gene exp lta rn03993492 g1  (Thermo Fisher)
86
Thermo Fisher gene exp lta rn03993492 g1
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Gene Exp Lta Rn03993492 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lta rn03993492 g1/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
gene exp lta rn03993492 g1 - by Bioz Stars, 2026-03
86/100 stars
  Buy from Supplier
gene exp lta mm00440228 gh  (Thermo Fisher)
97
Thermo Fisher gene exp lta mm00440228 gh
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Gene Exp Lta Mm00440228 Gh, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lta mm00440228 gh/product/Thermo Fisher
Average 97 stars, based on 1 article reviews
gene exp lta mm00440228 gh - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier
human tnf alpha picokinetm elisa kit  (Boster Bio)
93
Boster Bio human tnf alpha picokinetm elisa kit
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Human Tnf Alpha Picokinetm Elisa Kit, supplied by Boster Bio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human tnf alpha picokinetm elisa kit/product/Boster Bio
Average 93 stars, based on 1 article reviews
human tnf alpha picokinetm elisa kit - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier
gene exp lta hs04188773 g1  (Thermo Fisher)
85
Thermo Fisher gene exp lta hs04188773 g1
Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and <t>LTA-1.</t> Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Gene Exp Lta Hs04188773 G1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene exp lta hs04188773 g1/product/Thermo Fisher
Average 85 stars, based on 1 article reviews
gene exp lta hs04188773 g1 - by Bioz Stars, 2026-03
85/100 stars
  Buy from Supplier

Image Search Results


Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and LTA-1. Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Journal: The Journal of Experimental Medicine

Article Title: Amelioration of epidermal hyperplasia by TNF inhibition is associated with reduced Th17 responses

doi: 10.1084/jem.20071094

Figure Lengend Snippet: Th17 cell products and downstream mediators are rapidly down-modulated with etanercept treatment compared with Th1 and Th2 cell products. mRNA expression normalized to HARP for (A) Th17 cell products IL-17 and IL-22 and (B) Th1 cell products IFN-γ and LTA-1. Error bars represent the mean ± SEM. (C) Multivariate U-statistics correlating the change in Th17 or Th1 cell products with histological response (epidermal thickness, K16, and Ki67) over time. (D) Downstream effectors of Th17 cells, CCL20, and DEFB4. (E) MX-1, downstream effector of Th1 cells. (F) Th2 cell product IL-4. All mRNA was evaluated in nonlesional skin (NL), lesional skin (LS), and in the lesional index plaque at weeks 1, 2, 4, and 12. Error bars represent the mean ± SEM. Baseline lesional values were compared with other time points. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Article Snippet: Sequences of other primers and probes used in this study were as follows: CCL20 (MIP-3α) forward, GCTTTGATGTCAGTGCTGCTACTC; CCL20 reverse, GTATCCAAGACAGCAGTCAAAGTTG; CCL20 probe, FAM-TGCGGCGAATCAGAAGCAGCAA-TAMRA; IL-6 forward, CCAGGAGCCCAGCTATGAAC; IL-6 reverse, CCCAGGGAGAAGGCAACTG; IL-6 probe, FAM-CCTTCTCCACAAGCGCCTTCGGT-TAMRA; IL-4 forward, CGACTGCACAGCAGTTCCA; IL-4 reverse, AGGTTCCTGTCGAGCCGTTT; IL-4 probe, FAM-AGGCACAAGCAGCTGATCCGATTCC-TAMRA; IL-20 (Hs00218888_m1); IL-12 p35 (Hs00168405_m1); LTA-1 (Hs00236874_m1); MX-1 (Hs00182073_m1); IL-17A (Hs00174383_m1); IL-22 (Hs00220924_m1); defensin (Hs00175474_m1); IL-1β (Hs00174097_m1); and TGF-β1 (Hs00171257_m1; all assays from were obtained from Applied Biosystems).

Techniques: Expressing