lhx2 Search Results


93
Thermo Fisher gene exp lhx2 hs00180351 m1
( A ) Sarcoma cells were distinguished from normal cells by component 1 axis of a principal component analysis, followed by global transcriptome comparison. White and black indicate transcriptional status under neutral (pH 7.4) and acidic (pH 6.5) conditions, respectively. Round and square symbols indicate sarcoma and normal cells, respectively. ( B ) RAB39A (bold black line) shows higher expression values in malignant cells. Each line indicates the expression value of a gene. Genes expressed at low levels in normal cells but abundantly expressed in malignant cells were identified as targeting candidates, and used for shRNA-based screening. ( C ) RAB39A , CPVL , NUP210 and <t>LHX2</t> are primary candidates for targeting cancer cells and CSCs. ( D ) Cell growth inhibition in neutral (pH 7.4) and acidic (pH 6.8) conditions in cells transfected with shRNAs against the selected genes. Black and 2 gray lines indicate growth of shControl and 2 kinds of gene-specific shRNA-treated HOS human osteosarcoma cells, respectively. ( E ) Upper graph, reduced tumor volumes in mice subcutaneously injected with RAB39A -knockdown 143B human osteosarcoma cells (black dotted line). Black, dark gray and light gray lines correspond to shControl, shCPVL and parental 143B cells, respectively. #: ANOVA on Day 30; F (3, 20) = 4.054, p = 0.0211 * p < 0.05, by Fisher’s PLSD, compared to shControl cells. Lower graph, silencing of RAB39A and CPVL expression (black and gray bars, respectively) in 143B xenotransplanted tumors with different cell lines was confirmed by qRT-PCR.
Gene Exp Lhx2 Hs00180351 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/Gene+Exp%2E+LHX2%2C+Hs00180351_m1/pmc05839406-221-17-30
Average 93 stars, based on 1 article reviews
gene exp lhx2 hs00180351 m1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Bioss anti lim homeobox 2
Primer sequences of the target genes.
Anti Lim Homeobox 2, supplied by Bioss, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/LHX2+Polyclonal+Antibody/pmc07693390-64-45-50
Average 93 stars, based on 1 article reviews
anti lim homeobox 2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

92
Addgene inc mouse lhx2 cdna
( A ) IUE of a T α 1-Cre and two-colour reporter plasmid was used to label aIP-derived (GFP + , green) and OP- derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P7 revealed lower levels of <t>Lhx2</t> expression in aIP-derived neurons, compared to higher levels in OP-derived neurons. ( C ) Lhx2 expression levels were quantified (see Methods ) in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units; values above 45 au have been set to 45 to aid visualisation). Normalized Lhx2 expression was significantly lower in aIP-derived neurons than OP-derived L4 neurons (right; n = 88, p < 0.001, one sample t-test). Data represented as mean ± SEM, n = neurons.
Mouse Lhx2 Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/TetO-FUW-Lhx2+(Plasmid+%2361537)/bio_rxiv__2022__03__28__486015-158-3-10
Average 92 stars, based on 1 article reviews
mouse lhx2 cdna - by Bioz Stars, 2026-09
92/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology anti lhx2
( A ) IUE of a T α 1-Cre and two-colour reporter plasmid was used to label aIP-derived (GFP + , green) and OP- derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P7 revealed lower levels of <t>Lhx2</t> expression in aIP-derived neurons, compared to higher levels in OP-derived neurons. ( C ) Lhx2 expression levels were quantified (see Methods ) in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units; values above 45 au have been set to 45 to aid visualisation). Normalized Lhx2 expression was significantly lower in aIP-derived neurons than OP-derived L4 neurons (right; n = 88, p < 0.001, one sample t-test). Data represented as mean ± SEM, n = neurons.
Anti Lhx2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/LHX2+Antibody/pmc04007478-358-13-17
Average 93 stars, based on 1 article reviews
anti lhx2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
OriGene lhx2 cdna
Fig. 1. <t>OP9-Lhx2</t> enhances generation of ESCs-derived hematopoietic cells. (A) Strategy for hematopoietic differentiation by ESC (H1 line)/stromal cell co-culture. (B) Phenotypic identi- fication of hematopoietic cells by FACS analysis. Dead cells and debris were excluded. (C) Statistical analysis of hematopoietic cells derived from co-culture system. Each column represents the mean of triplicate wells. Data are shown as means + SDs (*p b 0.05). (D), (E) Colony-forming assay of CD34+ cells derived from co-culture. The hematopoietic progenitors from OP9-Lhx2/ESCs and OP9-GFP/ESCs co-culture formed CFU-GM, CFU-M and BFU-E colonies.
Lhx2 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/Lhx2+(NM_010710)+Mouse+Tagged+ORF+Clone/pm26339946-80-11-13
Average 90 stars, based on 1 article reviews
lhx2 cdna - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Thermo Fisher gene exp lhx2 mm00839783 m1
Fig. 1. <t>OP9-Lhx2</t> enhances generation of ESCs-derived hematopoietic cells. (A) Strategy for hematopoietic differentiation by ESC (H1 line)/stromal cell co-culture. (B) Phenotypic identi- fication of hematopoietic cells by FACS analysis. Dead cells and debris were excluded. (C) Statistical analysis of hematopoietic cells derived from co-culture system. Each column represents the mean of triplicate wells. Data are shown as means + SDs (*p b 0.05). (D), (E) Colony-forming assay of CD34+ cells derived from co-culture. The hematopoietic progenitors from OP9-Lhx2/ESCs and OP9-GFP/ESCs co-culture formed CFU-GM, CFU-M and BFU-E colonies.
Gene Exp Lhx2 Mm00839783 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/Gene+Exp%2E+lhx2+mm00839783+m1/pm22945646__41388_2013_BFonc2012375_MOESM1_ESM-3-19--1
Average 93 stars, based on 1 article reviews
gene exp lhx2 mm00839783 m1 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

85
Thermo Fisher gene exp lhx2 hs01104717 m1
Target gene expression relative to GAPDH in GIST subtypes
Gene Exp Lhx2 Hs01104717 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/Gene+Exp%2E+LHX2%2C+Hs01104717_m1/pmc03797556-66-63-10
Average 85 stars, based on 1 article reviews
gene exp lhx2 hs01104717 m1 - by Bioz Stars, 2026-09
85/100 stars
  Buy from Supplier

88
Thermo Fisher gene exp lhx2 rn01449595 m1
Target gene expression relative to GAPDH in GIST subtypes
Gene Exp Lhx2 Rn01449595 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/Gene+Exp%2E+lhx2+rn01449595+m1/pmc07648065__41467_2020_19485_MOESM1_ESM-75-52--1
Average 88 stars, based on 1 article reviews
gene exp lhx2 rn01449595 m1 - by Bioz Stars, 2026-09
88/100 stars
  Buy from Supplier

90
Matos labs genes shh and lhx2
Target gene expression relative to GAPDH in GIST subtypes
Genes Shh And Lhx2, supplied by Matos labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/genes+shh+and+lhx2/pm38159590-200-6-26
Average 90 stars, based on 1 article reviews
genes shh and lhx2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Microsynth ag lhx2 mouse primer for rt-qpcr

Lhx2 Mouse Primer For Rt Qpcr, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/lhx2+mouse+primer+for+rt+qpcr/pmc10755723-111-0-6
Average 90 stars, based on 1 article reviews
lhx2 mouse primer for rt-qpcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GeneTex lhx2 gtx129241

Lhx2 Gtx129241, supplied by GeneTex, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/lhx2+gtx129241/pmc10147555__mmc1-74-0-4
Average 90 stars, based on 1 article reviews
lhx2 gtx129241 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
SuperArray Bioscience Corporation hoxd11 primer

Hoxd11 Primer, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lhx2/primer+sets+for+human+hoxd10++hoxd11++hoxd13++lhx2++pparg++pou3f3++and+trim2/pm22227861-59-3-9
Average 90 stars, based on 1 article reviews
hoxd11 primer - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


( A ) Sarcoma cells were distinguished from normal cells by component 1 axis of a principal component analysis, followed by global transcriptome comparison. White and black indicate transcriptional status under neutral (pH 7.4) and acidic (pH 6.5) conditions, respectively. Round and square symbols indicate sarcoma and normal cells, respectively. ( B ) RAB39A (bold black line) shows higher expression values in malignant cells. Each line indicates the expression value of a gene. Genes expressed at low levels in normal cells but abundantly expressed in malignant cells were identified as targeting candidates, and used for shRNA-based screening. ( C ) RAB39A , CPVL , NUP210 and LHX2 are primary candidates for targeting cancer cells and CSCs. ( D ) Cell growth inhibition in neutral (pH 7.4) and acidic (pH 6.8) conditions in cells transfected with shRNAs against the selected genes. Black and 2 gray lines indicate growth of shControl and 2 kinds of gene-specific shRNA-treated HOS human osteosarcoma cells, respectively. ( E ) Upper graph, reduced tumor volumes in mice subcutaneously injected with RAB39A -knockdown 143B human osteosarcoma cells (black dotted line). Black, dark gray and light gray lines correspond to shControl, shCPVL and parental 143B cells, respectively. #: ANOVA on Day 30; F (3, 20) = 4.054, p = 0.0211 * p < 0.05, by Fisher’s PLSD, compared to shControl cells. Lower graph, silencing of RAB39A and CPVL expression (black and gray bars, respectively) in 143B xenotransplanted tumors with different cell lines was confirmed by qRT-PCR.

Journal: Oncotarget

Article Title: Prominent role of RAB39A-RXRB axis in cancer development and stemness

doi: 10.18632/oncotarget.23955

Figure Lengend Snippet: ( A ) Sarcoma cells were distinguished from normal cells by component 1 axis of a principal component analysis, followed by global transcriptome comparison. White and black indicate transcriptional status under neutral (pH 7.4) and acidic (pH 6.5) conditions, respectively. Round and square symbols indicate sarcoma and normal cells, respectively. ( B ) RAB39A (bold black line) shows higher expression values in malignant cells. Each line indicates the expression value of a gene. Genes expressed at low levels in normal cells but abundantly expressed in malignant cells were identified as targeting candidates, and used for shRNA-based screening. ( C ) RAB39A , CPVL , NUP210 and LHX2 are primary candidates for targeting cancer cells and CSCs. ( D ) Cell growth inhibition in neutral (pH 7.4) and acidic (pH 6.8) conditions in cells transfected with shRNAs against the selected genes. Black and 2 gray lines indicate growth of shControl and 2 kinds of gene-specific shRNA-treated HOS human osteosarcoma cells, respectively. ( E ) Upper graph, reduced tumor volumes in mice subcutaneously injected with RAB39A -knockdown 143B human osteosarcoma cells (black dotted line). Black, dark gray and light gray lines correspond to shControl, shCPVL and parental 143B cells, respectively. #: ANOVA on Day 30; F (3, 20) = 4.054, p = 0.0211 * p < 0.05, by Fisher’s PLSD, compared to shControl cells. Lower graph, silencing of RAB39A and CPVL expression (black and gray bars, respectively) in 143B xenotransplanted tumors with different cell lines was confirmed by qRT-PCR.

Article Snippet: Probe and primer sets were prepared for human RAB39A (Hs00380029_m1), RXRB (Hs00232774_m1), CPVL (Hs01073862_m1), NUP210 (Hs00227779_m1), LHX2 (Hs00180351_m1), NCOR2 (Hs00196955_m1), UGT2B15 (Hs00870076_s1), RIIAD1 (Hs01380113_g1) and KLF4 (Hs00358836_m1); and purchased from Thermo.

Techniques: Comparison, Expressing, shRNA, Inhibition, Transfection, Injection, Knockdown, Quantitative RT-PCR

Primer sequences of the target genes.

Journal: Oncology Letters

Article Title: Identification of the potential roles of ring finger protein 8 in TP53-mutant breast cancer

doi: 10.3892/ol.2020.12303

Figure Lengend Snippet: Primer sequences of the target genes.

Article Snippet: Subsequently, the membranes were blocked with 5% BSA (Beyotime Institute of Biotechnology) at room temperature for 30 min and incubated with anti-RNF8 (1:1,000; EMD Millipore; cat. no. 09-813), anti-GAPDH (1:5,000; BIOSS; cat. no. bsm-33033M), anti-EPH receptor B2 (EPHB2; 1:1,000; Sino Biological, Inc.; cat. no. 100091-T08) anti-LIM homeobox 2 (LHX2; 1:1,000; BIOSS; cat. no. bs-11200R;) and anti-BR serine/threonine kinase 1 (BRSK1; 1:1,000; BIOSS; cat. no. bs-7905R;) primary antibodies at 4°C overnight.

Techniques:

Association between 10 differentially expressed genes and the prognosis in patients with breast cancer.

Journal: Oncology Letters

Article Title: Identification of the potential roles of ring finger protein 8 in TP53-mutant breast cancer

doi: 10.3892/ol.2020.12303

Figure Lengend Snippet: Association between 10 differentially expressed genes and the prognosis in patients with breast cancer.

Article Snippet: Subsequently, the membranes were blocked with 5% BSA (Beyotime Institute of Biotechnology) at room temperature for 30 min and incubated with anti-RNF8 (1:1,000; EMD Millipore; cat. no. 09-813), anti-GAPDH (1:5,000; BIOSS; cat. no. bsm-33033M), anti-EPH receptor B2 (EPHB2; 1:1,000; Sino Biological, Inc.; cat. no. 100091-T08) anti-LIM homeobox 2 (LHX2; 1:1,000; BIOSS; cat. no. bs-11200R;) and anti-BR serine/threonine kinase 1 (BRSK1; 1:1,000; BIOSS; cat. no. bs-7905R;) primary antibodies at 4°C overnight.

Techniques:

Kaplan-Meier curve analysis of overall survival based on Kaplan-Meier plotter mRNA expression levels of (A) LHX2, (B) EPHB2, (C) BRSK1 and (D) FGFR1 in patients with breast cancer. HR, hazard ratio; LHX2, LIM homeobox 2; EPHB2, EPH receptor B2; BRSK1, BR serine/threonine kinase 1; FGFR1, fibroblast growth factor receptor 1.

Journal: Oncology Letters

Article Title: Identification of the potential roles of ring finger protein 8 in TP53-mutant breast cancer

doi: 10.3892/ol.2020.12303

Figure Lengend Snippet: Kaplan-Meier curve analysis of overall survival based on Kaplan-Meier plotter mRNA expression levels of (A) LHX2, (B) EPHB2, (C) BRSK1 and (D) FGFR1 in patients with breast cancer. HR, hazard ratio; LHX2, LIM homeobox 2; EPHB2, EPH receptor B2; BRSK1, BR serine/threonine kinase 1; FGFR1, fibroblast growth factor receptor 1.

Article Snippet: Subsequently, the membranes were blocked with 5% BSA (Beyotime Institute of Biotechnology) at room temperature for 30 min and incubated with anti-RNF8 (1:1,000; EMD Millipore; cat. no. 09-813), anti-GAPDH (1:5,000; BIOSS; cat. no. bsm-33033M), anti-EPH receptor B2 (EPHB2; 1:1,000; Sino Biological, Inc.; cat. no. 100091-T08) anti-LIM homeobox 2 (LHX2; 1:1,000; BIOSS; cat. no. bs-11200R;) and anti-BR serine/threonine kinase 1 (BRSK1; 1:1,000; BIOSS; cat. no. bs-7905R;) primary antibodies at 4°C overnight.

Techniques: Expressing

(A) mRNA and (B) protein expression levels of LHX2, EPHB2 and BRSK1 in siRNA-ring finger protein 8 and control siRNA groups. Results are presented as the mean ± SD (n=3). **P<0.01; ***P<0.001. Significance was assessed using an unpaired Student's t-test. siRNA, small interfering RNA; LHX2, LIM homeobox 2; EPHB2, EPH receptor B2; BRSK1, BR serine/threonine kinase 1.

Journal: Oncology Letters

Article Title: Identification of the potential roles of ring finger protein 8 in TP53-mutant breast cancer

doi: 10.3892/ol.2020.12303

Figure Lengend Snippet: (A) mRNA and (B) protein expression levels of LHX2, EPHB2 and BRSK1 in siRNA-ring finger protein 8 and control siRNA groups. Results are presented as the mean ± SD (n=3). **P<0.01; ***P<0.001. Significance was assessed using an unpaired Student's t-test. siRNA, small interfering RNA; LHX2, LIM homeobox 2; EPHB2, EPH receptor B2; BRSK1, BR serine/threonine kinase 1.

Article Snippet: Subsequently, the membranes were blocked with 5% BSA (Beyotime Institute of Biotechnology) at room temperature for 30 min and incubated with anti-RNF8 (1:1,000; EMD Millipore; cat. no. 09-813), anti-GAPDH (1:5,000; BIOSS; cat. no. bsm-33033M), anti-EPH receptor B2 (EPHB2; 1:1,000; Sino Biological, Inc.; cat. no. 100091-T08) anti-LIM homeobox 2 (LHX2; 1:1,000; BIOSS; cat. no. bs-11200R;) and anti-BR serine/threonine kinase 1 (BRSK1; 1:1,000; BIOSS; cat. no. bs-7905R;) primary antibodies at 4°C overnight.

Techniques: Expressing, Small Interfering RNA

( A ) IUE of a T α 1-Cre and two-colour reporter plasmid was used to label aIP-derived (GFP + , green) and OP- derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P7 revealed lower levels of Lhx2 expression in aIP-derived neurons, compared to higher levels in OP-derived neurons. ( C ) Lhx2 expression levels were quantified (see Methods ) in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units; values above 45 au have been set to 45 to aid visualisation). Normalized Lhx2 expression was significantly lower in aIP-derived neurons than OP-derived L4 neurons (right; n = 88, p < 0.001, one sample t-test). Data represented as mean ± SEM, n = neurons.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) IUE of a T α 1-Cre and two-colour reporter plasmid was used to label aIP-derived (GFP + , green) and OP- derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P7 revealed lower levels of Lhx2 expression in aIP-derived neurons, compared to higher levels in OP-derived neurons. ( C ) Lhx2 expression levels were quantified (see Methods ) in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units; values above 45 au have been set to 45 to aid visualisation). Normalized Lhx2 expression was significantly lower in aIP-derived neurons than OP-derived L4 neurons (right; n = 88, p < 0.001, one sample t-test). Data represented as mean ± SEM, n = neurons.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Plasmid Preparation, Derivative Assay, Immunohistochemistry, Expressing

( A ) At E14, animals underwent IUE of a T α 1-Cre and two-colour reporter plasmid to label aIP-derived (GFP + , green) and OP-derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P21 revealed low levels of Lhx2 expression in both aIP-derived and OP-derived neurons (contrast levels enhanced to aid visualisation). ( C ) Lhx2 expression levels were quantified in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units). Normalized Lhx2 expression was not different in aIP-derived and OP-derived L4 neurons at P21 (right; 0.40 ± 0.06; n = 20 and 20; p = 0.23, one sample Wilcoxon test against a median of 0.5). Data represented as mean ± SEM, n = neurons.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) At E14, animals underwent IUE of a T α 1-Cre and two-colour reporter plasmid to label aIP-derived (GFP + , green) and OP-derived (tdTomato + , red) L4 neurons in S1. ( B ) Immunohistochemistry at P21 revealed low levels of Lhx2 expression in both aIP-derived and OP-derived neurons (contrast levels enhanced to aid visualisation). ( C ) Lhx2 expression levels were quantified in aIP-derived neurons and neighbouring OP-derived neurons within the same field of view (left; au, arbitrary units). Normalized Lhx2 expression was not different in aIP-derived and OP-derived L4 neurons at P21 (right; 0.40 ± 0.06; n = 20 and 20; p = 0.23, one sample Wilcoxon test against a median of 0.5). Data represented as mean ± SEM, n = neurons.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Plasmid Preparation, Derivative Assay, Immunohistochemistry, Expressing

( A ) IUE of a T α 1-Cre and reporter plasmid to label aIP-derived (GFP + , green) and OP-derived (tdTomato + , red) L4 neurons, was combined with a CAG-Lhx2 plasmid to increase Lhx2 expression levels. ( B ) Biocytin fills at P21 were used to reconstruct the dendritic morphology of aIP-derived L4 neurons overexpressing Lhx2 (Lhx2 aIP- derived). ( C ) Example reconstruction of an Lhx2 aIP-derived L4 neuron. ( D ) Dendrites of Lhx2 aIP-derived L4 neurons were more likely to target the principal barrel compared to WT (left; WT data from ; n = 17 and 15; p = 0.005, Mann-Whitney U test). Dendrites of both populations exhibited a similar degree of overlap with the adjacent barrel (middle; n = 17 and 15; p = 0.727, Mann-Whitney U test). Dendrites of Lhx2 aIP-derived L4 neurons were less likely to target the area outside of barrels, including septa, compared to WT (right; n = 17 and 15; p = 0.009, Mann-Whitney U test). ( E ) To study thalamic inputs, IUE was performed as in A, then mice received a thalamic injection at P21 of an AAV encoding CAG-ChR2-GFP, into either VPM or POm. ( F ) EPSP peak amplitudes for pairs of Lhx2-overexpressing aIP-derived and OP-derived neurons in response to light stimulation of VPM axons. ( G ) No statistically significant bias was detected in the strength of VPM input (n = 18; p = 0.06, one sample t-test). (H ) EPSP peak amplitudes for pairs of Lhx2-overexpressing aIP-derived and OP- derived neurons in response to light stimulation of POm axons. ( I ) No statistically significant bias was detected in the strength of POm input (n = 22; p = 0.687, one sample t-test). Data represented as mean ± SEM, n = neurons/neuron pairs.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) IUE of a T α 1-Cre and reporter plasmid to label aIP-derived (GFP + , green) and OP-derived (tdTomato + , red) L4 neurons, was combined with a CAG-Lhx2 plasmid to increase Lhx2 expression levels. ( B ) Biocytin fills at P21 were used to reconstruct the dendritic morphology of aIP-derived L4 neurons overexpressing Lhx2 (Lhx2 aIP- derived). ( C ) Example reconstruction of an Lhx2 aIP-derived L4 neuron. ( D ) Dendrites of Lhx2 aIP-derived L4 neurons were more likely to target the principal barrel compared to WT (left; WT data from ; n = 17 and 15; p = 0.005, Mann-Whitney U test). Dendrites of both populations exhibited a similar degree of overlap with the adjacent barrel (middle; n = 17 and 15; p = 0.727, Mann-Whitney U test). Dendrites of Lhx2 aIP-derived L4 neurons were less likely to target the area outside of barrels, including septa, compared to WT (right; n = 17 and 15; p = 0.009, Mann-Whitney U test). ( E ) To study thalamic inputs, IUE was performed as in A, then mice received a thalamic injection at P21 of an AAV encoding CAG-ChR2-GFP, into either VPM or POm. ( F ) EPSP peak amplitudes for pairs of Lhx2-overexpressing aIP-derived and OP-derived neurons in response to light stimulation of VPM axons. ( G ) No statistically significant bias was detected in the strength of VPM input (n = 18; p = 0.06, one sample t-test). (H ) EPSP peak amplitudes for pairs of Lhx2-overexpressing aIP-derived and OP- derived neurons in response to light stimulation of POm axons. ( I ) No statistically significant bias was detected in the strength of POm input (n = 22; p = 0.687, one sample t-test). Data represented as mean ± SEM, n = neurons/neuron pairs.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Plasmid Preparation, Derivative Assay, Expressing, MANN-WHITNEY, Injection

( A ) To raise Lhx2 levels in aIP-derived neurons, a CAG-Lhx2 overexpression plasmid was delivered with T α 1-Cre and a two-colour reporter plasmid by IUE. ( B ) Immunohistochemistry at P7 revealed similarly high levels of Lhx2 expression in aIP-derived neurons and OP-derived electroporated neurons. ( C ) Quantification confirmed increased levels in Lhx2-overexpressing (Lhx2) aIP-derived L4 neurons compared to WT aIP-derived L4 neurons (left; WT expression was 10.18 au ± 1.16, Lhx2 expression was 248.57 ± 19.51). Within the Lhx2 electroporated tissue, expression levels were similar in the aIP-derived and OP-derived electroporated L4 neurons, such that there was no difference in relative expression (right; 0.50 ± 0.02; n = 40 and 40, p = 0.85, one sample t-test). Data represented as mean ± SEM, n = neurons.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) To raise Lhx2 levels in aIP-derived neurons, a CAG-Lhx2 overexpression plasmid was delivered with T α 1-Cre and a two-colour reporter plasmid by IUE. ( B ) Immunohistochemistry at P7 revealed similarly high levels of Lhx2 expression in aIP-derived neurons and OP-derived electroporated neurons. ( C ) Quantification confirmed increased levels in Lhx2-overexpressing (Lhx2) aIP-derived L4 neurons compared to WT aIP-derived L4 neurons (left; WT expression was 10.18 au ± 1.16, Lhx2 expression was 248.57 ± 19.51). Within the Lhx2 electroporated tissue, expression levels were similar in the aIP-derived and OP-derived electroporated L4 neurons, such that there was no difference in relative expression (right; 0.50 ± 0.02; n = 40 and 40, p = 0.85, one sample t-test). Data represented as mean ± SEM, n = neurons.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Derivative Assay, Over Expression, Plasmid Preparation, Immunohistochemistry, Expressing

( A ) Wild-type aIP-derived neurons (WT; left) at P21, labelled via IUE of the T α 1-Cre plasmid and a reporter plasmid at E14. Lhx2-overexpressing aIP-derived neurons (Lhx2; right) at P21, labelled via IUE of the T α 1-Cre plasmid, a reporter plasmid and a CAG-Lhx2 plasmid to increase Lhx2 expression levels in the electroporated neurons. ( B ) The somata of WT and Lhx2 neurons were located at similar distances from the pia mater (WT depth of 445.67 ± 16.04 µm, Lhx2 depth of 459.77 ± 32.80 µm; n = 8 and 5; p = 0.67, t-test). ( C ) WT and Lhx2 neurons occupied similar depths within L4 (WT at 50.64 ± 2.14 %, Lhx2 at 43.32 ± 4.05 %; n = 8 and 5; p = 0.11, t-test). ( D ) Example current clamp recordings from a WT and Lhx2 aIP-derived L4 neuron in response to current steps. ( E ) Resting membrane potential was slightly more depolarised in Lhx2 aIP-derived neurons compared to WT (WT was -69.86 ± 0.71 mV, Lhx2 was -67.74 ± 1.16 mV; n = 25 and 19; p = 0.042, Mann Whitney U test). ( F ) Spike threshold was not statistically different between WT and Lhx2 aIP-derived neurons (WT was -35.18 ± 0.46 mV, Lhx2 was -34.60 ± 0.84 mV; n = 25 and 14; p = 0.51, t-test). ( G ) Spike rate in response to injected current was not statistically different between WT and Lhx2 aIP-derived neurons (100, 200, 300, 400 and 500 pA steps; WT was 4.20 ± 0.98 Hz, 14.30 ± 1.49 Hz, 22.30 ± 2.01 Hz, 30.00 ± 2.65 Hz, 36.00 ± 2.80 Hz; Lhx2 was 7.89 ± 1.27 Hz, 19.73 ± 1.67 Hz, 29.47 ± 2.09 Hz, 37.37 ± 2.95 Hz, 37.50 ± 3.39 Hz; n = 25 and 19; p = 0.067, Mixed ANOVA). ( H ) Example voltage clamp recordings of spontaneous excitatory synaptic currents in a WT and an Lhx2 aIP-derived L4 neuron. ( I ) The amplitude of spontaneous excitatory synaptic currents was not statistically different (WT was 16.40 ± 0.45 pA, Lhx2 was 15.47 ± 0.25 pA; n = 26 and 21; p = 0.09, t-test). ( J ) The frequency of spontaneous excitatory synaptic currents was not statistically different between WT and Lhx2 aIP-derived neurons (WT was 3.43 ± 0.52 Hz, Lhx2 was 3.55 ± 0.49 Hz; n = 26 and 21; p = 0.18, Mann Whitney U). Data represented as mean ± SEM, n = sections or neurons.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) Wild-type aIP-derived neurons (WT; left) at P21, labelled via IUE of the T α 1-Cre plasmid and a reporter plasmid at E14. Lhx2-overexpressing aIP-derived neurons (Lhx2; right) at P21, labelled via IUE of the T α 1-Cre plasmid, a reporter plasmid and a CAG-Lhx2 plasmid to increase Lhx2 expression levels in the electroporated neurons. ( B ) The somata of WT and Lhx2 neurons were located at similar distances from the pia mater (WT depth of 445.67 ± 16.04 µm, Lhx2 depth of 459.77 ± 32.80 µm; n = 8 and 5; p = 0.67, t-test). ( C ) WT and Lhx2 neurons occupied similar depths within L4 (WT at 50.64 ± 2.14 %, Lhx2 at 43.32 ± 4.05 %; n = 8 and 5; p = 0.11, t-test). ( D ) Example current clamp recordings from a WT and Lhx2 aIP-derived L4 neuron in response to current steps. ( E ) Resting membrane potential was slightly more depolarised in Lhx2 aIP-derived neurons compared to WT (WT was -69.86 ± 0.71 mV, Lhx2 was -67.74 ± 1.16 mV; n = 25 and 19; p = 0.042, Mann Whitney U test). ( F ) Spike threshold was not statistically different between WT and Lhx2 aIP-derived neurons (WT was -35.18 ± 0.46 mV, Lhx2 was -34.60 ± 0.84 mV; n = 25 and 14; p = 0.51, t-test). ( G ) Spike rate in response to injected current was not statistically different between WT and Lhx2 aIP-derived neurons (100, 200, 300, 400 and 500 pA steps; WT was 4.20 ± 0.98 Hz, 14.30 ± 1.49 Hz, 22.30 ± 2.01 Hz, 30.00 ± 2.65 Hz, 36.00 ± 2.80 Hz; Lhx2 was 7.89 ± 1.27 Hz, 19.73 ± 1.67 Hz, 29.47 ± 2.09 Hz, 37.37 ± 2.95 Hz, 37.50 ± 3.39 Hz; n = 25 and 19; p = 0.067, Mixed ANOVA). ( H ) Example voltage clamp recordings of spontaneous excitatory synaptic currents in a WT and an Lhx2 aIP-derived L4 neuron. ( I ) The amplitude of spontaneous excitatory synaptic currents was not statistically different (WT was 16.40 ± 0.45 pA, Lhx2 was 15.47 ± 0.25 pA; n = 26 and 21; p = 0.09, t-test). ( J ) The frequency of spontaneous excitatory synaptic currents was not statistically different between WT and Lhx2 aIP-derived neurons (WT was 3.43 ± 0.52 Hz, Lhx2 was 3.55 ± 0.49 Hz; n = 26 and 21; p = 0.18, Mann Whitney U). Data represented as mean ± SEM, n = sections or neurons.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Derivative Assay, Plasmid Preparation, Expressing, Membrane, MANN-WHITNEY, Injection

( A ) IUE of a T α 1-Cre, floxed ChR2-YFP and CAG-Lhx2 plasmid was used to optotag Lhx2-overexpressing aIP- derived L4 neurons in S1. ( B ) ChR2-YFP + Lhx2 aIP-derived L4 neurons at P60. ( C ) The spiking activity of optotagged Lhx2 aIP-derived L4 neurons was recorded in response to the deflection of the PW or AW. ( D ) Mean responses of WT aIP-derived L4 neurons (data from ) and Lhx2 aIP-derived L4 neurons following a single deflection of the PW (left) or AW (right). ( E ) Spiking of an individual WT aIP-derived neuron (left) and an Lhx2 aIP-derived neuron (right) over 100 trials of either a single deflection (inner left) or trains of deflection (inner right) of the PW or AW. ( F ) Responses of individual WT and Lhx2 aIP-derived L4 neurons to single deflection of the PW and AW (left), and the distribution of corresponding SI values (right). Compared to WT, Lhx2 aIP-derived L4 neurons showed greater selectivity for the PW and relatively less responsivity to the AW (n = 29, 19; p = 0.010, Mann Whitney U test). ( G ) Responses to train deflection of the PW and AW (left), and corresponding SI values (right). Compared to WT, Lhx2 aIP-derived L4 neurons showed greater selectivity for the PW and relatively less responsivity to the AW (n = 29, 19; p = 0.024, Mann Whitney U test). Data represented as mean ± SEM, n = neurons, conventions as in .

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) IUE of a T α 1-Cre, floxed ChR2-YFP and CAG-Lhx2 plasmid was used to optotag Lhx2-overexpressing aIP- derived L4 neurons in S1. ( B ) ChR2-YFP + Lhx2 aIP-derived L4 neurons at P60. ( C ) The spiking activity of optotagged Lhx2 aIP-derived L4 neurons was recorded in response to the deflection of the PW or AW. ( D ) Mean responses of WT aIP-derived L4 neurons (data from ) and Lhx2 aIP-derived L4 neurons following a single deflection of the PW (left) or AW (right). ( E ) Spiking of an individual WT aIP-derived neuron (left) and an Lhx2 aIP-derived neuron (right) over 100 trials of either a single deflection (inner left) or trains of deflection (inner right) of the PW or AW. ( F ) Responses of individual WT and Lhx2 aIP-derived L4 neurons to single deflection of the PW and AW (left), and the distribution of corresponding SI values (right). Compared to WT, Lhx2 aIP-derived L4 neurons showed greater selectivity for the PW and relatively less responsivity to the AW (n = 29, 19; p = 0.010, Mann Whitney U test). ( G ) Responses to train deflection of the PW and AW (left), and corresponding SI values (right). Compared to WT, Lhx2 aIP-derived L4 neurons showed greater selectivity for the PW and relatively less responsivity to the AW (n = 29, 19; p = 0.024, Mann Whitney U test). Data represented as mean ± SEM, n = neurons, conventions as in .

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Plasmid Preparation, Derivative Assay, Activity Assay, MANN-WHITNEY

( A ) WT aIP-derived L4 neurons had undergone IUE of a T α 1-Cre and floxed ChR2-YFP plasmid. Lhx2 aIP- derived L4 neurons had undergone IUE of the same plasmids, plus a CAG-Lhx2 plasmid. ( B ) Sensory-evoked plasticity was examined in L2/3 of S1 at P28 using a rhythmic whisker stimulation protocol (RWS; 8 Hz for 60 s). The presence of electroporated L4 neurons at the recording site was confirmed by ChR2 stimulation and subsequent histology. ( C ) Raster plots and PSTHs show multiunit L2/3 spiking activity in a WT animal. Responses to whisker deflections (0.1 Hz) are shown before (Pre) and after (Post) RWS. ( D ) Averaged (left) and separate (right) population data from WT animals reveal that RWS potentiated L2/3 activity (n = 6; p = 0.006, paired t-test). ( E ) Multiunit L2/3 activity in an Lhx2 animal. ( F ) Lhx2 animals did not exhibit potentiation of L2/3 activity following RWS (n = 7; p = 0.547, paired t-test). ( G ) Normalised L2/3 multiunit activity relative to the time of RWS (each data point is mean of five whisker deflections, 0.1 Hz). Shading indicates SEM around the mean. ( H ) Delta spike rate in WT animals that did not experience the RWS protocol (WT control), WT animals that experienced RWS (WT+RWS), or Lhx2 animals that experienced RWS (Lhx2+RWS) (n = 5, 6 and 7; p = 0.007, Kruskall Wallis; WT control vs. WT+RWS, p = 0.016; WT+RWS vs. Lhx2+RWS, p = 0.017, WT control vs. Lhx2+RWS, p = 1.00, Dunn’s test). Data represented as mean ± SEM, n = animals.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) WT aIP-derived L4 neurons had undergone IUE of a T α 1-Cre and floxed ChR2-YFP plasmid. Lhx2 aIP- derived L4 neurons had undergone IUE of the same plasmids, plus a CAG-Lhx2 plasmid. ( B ) Sensory-evoked plasticity was examined in L2/3 of S1 at P28 using a rhythmic whisker stimulation protocol (RWS; 8 Hz for 60 s). The presence of electroporated L4 neurons at the recording site was confirmed by ChR2 stimulation and subsequent histology. ( C ) Raster plots and PSTHs show multiunit L2/3 spiking activity in a WT animal. Responses to whisker deflections (0.1 Hz) are shown before (Pre) and after (Post) RWS. ( D ) Averaged (left) and separate (right) population data from WT animals reveal that RWS potentiated L2/3 activity (n = 6; p = 0.006, paired t-test). ( E ) Multiunit L2/3 activity in an Lhx2 animal. ( F ) Lhx2 animals did not exhibit potentiation of L2/3 activity following RWS (n = 7; p = 0.547, paired t-test). ( G ) Normalised L2/3 multiunit activity relative to the time of RWS (each data point is mean of five whisker deflections, 0.1 Hz). Shading indicates SEM around the mean. ( H ) Delta spike rate in WT animals that did not experience the RWS protocol (WT control), WT animals that experienced RWS (WT+RWS), or Lhx2 animals that experienced RWS (Lhx2+RWS) (n = 5, 6 and 7; p = 0.007, Kruskall Wallis; WT control vs. WT+RWS, p = 0.016; WT+RWS vs. Lhx2+RWS, p = 0.017, WT control vs. Lhx2+RWS, p = 1.00, Dunn’s test). Data represented as mean ± SEM, n = animals.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Derivative Assay, Plasmid Preparation, Whisker Assay, Activity Assay, Control

( A ) Multiunit spiking activity in L4 during the RWS (8 Hz for 60 s) was similar for animals with WT or Lhx2 aIP-derived L4 neurons (WT was 59.10 ± 9.43 Hz, Lhx2 was 56.17 ± 12.66 Hz; n = 6 and 7; p = 0.86, t-test). ( B ) Multiunit spiking activity in L2/3 during RWS was not different for animals with WT or Lhx2 aIP- derived L4 neurons (WT was 64.31 ± 12.00 Hz, Lhx2 was 57.53 ± 14.42; n = 6 and 7; p = 0.73, t-test). Data represented as mean ± SEM, n = animals.

Journal: bioRxiv

Article Title: Cortical integration of higher-order thalamic inputs is lineage-dependent

doi: 10.1101/2022.03.28.486015

Figure Lengend Snippet: ( A ) Multiunit spiking activity in L4 during the RWS (8 Hz for 60 s) was similar for animals with WT or Lhx2 aIP-derived L4 neurons (WT was 59.10 ± 9.43 Hz, Lhx2 was 56.17 ± 12.66 Hz; n = 6 and 7; p = 0.86, t-test). ( B ) Multiunit spiking activity in L2/3 during RWS was not different for animals with WT or Lhx2 aIP- derived L4 neurons (WT was 64.31 ± 12.00 Hz, Lhx2 was 57.53 ± 14.42; n = 6 and 7; p = 0.73, t-test). Data represented as mean ± SEM, n = animals.

Article Snippet: To generate CAG-Lhx2, mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537; http://n2t.net/addgene:61537 ; RRID:Addgene_61537; a gift from Rudolf Jaenisch) and cloned into the AAV backbone derived from pAAVCAG- iCre (Addgene #51904; http://n2t.net/addgene:51904 ; RRID:Addgene_51904; a gift from Jinhyun Kim).

Techniques: Activity Assay, Derivative Assay

Fig. 1. OP9-Lhx2 enhances generation of ESCs-derived hematopoietic cells. (A) Strategy for hematopoietic differentiation by ESC (H1 line)/stromal cell co-culture. (B) Phenotypic identi- fication of hematopoietic cells by FACS analysis. Dead cells and debris were excluded. (C) Statistical analysis of hematopoietic cells derived from co-culture system. Each column represents the mean of triplicate wells. Data are shown as means + SDs (*p b 0.05). (D), (E) Colony-forming assay of CD34+ cells derived from co-culture. The hematopoietic progenitors from OP9-Lhx2/ESCs and OP9-GFP/ESCs co-culture formed CFU-GM, CFU-M and BFU-E colonies.

Journal: Stem cell research

Article Title: OP9-Lhx2 stromal cells facilitate derivation of hematopoietic progenitors both in vitro and in vivo.

doi: 10.1016/j.scr.2015.08.009

Figure Lengend Snippet: Fig. 1. OP9-Lhx2 enhances generation of ESCs-derived hematopoietic cells. (A) Strategy for hematopoietic differentiation by ESC (H1 line)/stromal cell co-culture. (B) Phenotypic identi- fication of hematopoietic cells by FACS analysis. Dead cells and debris were excluded. (C) Statistical analysis of hematopoietic cells derived from co-culture system. Each column represents the mean of triplicate wells. Data are shown as means + SDs (*p b 0.05). (D), (E) Colony-forming assay of CD34+ cells derived from co-culture. The hematopoietic progenitors from OP9-Lhx2/ESCs and OP9-GFP/ESCs co-culture formed CFU-GM, CFU-M and BFU-E colonies.

Article Snippet: To generate a OP9-Lhx2 cell line that stably overexpressed mouse Lhx2, Lhx2 cDNA (OriGene) was subcloned into pMYs-IRES-EGFP (RTV-021, Cell Biolabs, INC) to generate the pMYs-Lhx2-IRES-EGFP vector.

Techniques: Derivative Assay, Co-Culture Assay

Fig. 2. OP9-Lhx2 facilitates derivation of murine hematopoietic progenitors in vivo via teratoma formation. (A) Strategy for producing hematopoietic cells in vivo via teratoma formation. (B) OP9-Lhx2/ESCs (C57/B6 background, CD45.2+)-formed teratomas produced a higher proportion of hematopoietic progenitors compared with OP9-GFP/ESCs teratoma controls. Teratoma-derived blood cells were defined as tdTomato+CD45.2+ cells; teratoma derived hematopoietic progenitors were defined as tdTomato+CD45.2+CD150+CD48−cells. Plots show the analysis of representative teratomas of two groups. (C) Statistic analysis of phenotypic HSCs. Teratomas from three teratoma-bearing mice from each group were analyzed. Data are shown as mean + SD (*p b 0.01). (D) Hematopoietic progenitors derived from OP9-Lhx2/mESCs teratoma are transiently transplantable. Five hundred hematopoietic progenitors (tdTomato+CD45.2+CD48−CD150+) were transplanted into each lethally irradiated recipient (CD45.1+) via an injection into the femur cavity. A flow cytometric analysis of peripheral blood (PB) detected a low engraftment of OP9-Lhx2/mESCs teratoma-derived hematopoietic cells (CD45.2+CD45.1−) four weeks after transplantation. (E) Lineages analysis of engrafted cells in peripheral blood in recipients (n = 3) one month after transplantation.

Journal: Stem cell research

Article Title: OP9-Lhx2 stromal cells facilitate derivation of hematopoietic progenitors both in vitro and in vivo.

doi: 10.1016/j.scr.2015.08.009

Figure Lengend Snippet: Fig. 2. OP9-Lhx2 facilitates derivation of murine hematopoietic progenitors in vivo via teratoma formation. (A) Strategy for producing hematopoietic cells in vivo via teratoma formation. (B) OP9-Lhx2/ESCs (C57/B6 background, CD45.2+)-formed teratomas produced a higher proportion of hematopoietic progenitors compared with OP9-GFP/ESCs teratoma controls. Teratoma-derived blood cells were defined as tdTomato+CD45.2+ cells; teratoma derived hematopoietic progenitors were defined as tdTomato+CD45.2+CD150+CD48−cells. Plots show the analysis of representative teratomas of two groups. (C) Statistic analysis of phenotypic HSCs. Teratomas from three teratoma-bearing mice from each group were analyzed. Data are shown as mean + SD (*p b 0.01). (D) Hematopoietic progenitors derived from OP9-Lhx2/mESCs teratoma are transiently transplantable. Five hundred hematopoietic progenitors (tdTomato+CD45.2+CD48−CD150+) were transplanted into each lethally irradiated recipient (CD45.1+) via an injection into the femur cavity. A flow cytometric analysis of peripheral blood (PB) detected a low engraftment of OP9-Lhx2/mESCs teratoma-derived hematopoietic cells (CD45.2+CD45.1−) four weeks after transplantation. (E) Lineages analysis of engrafted cells in peripheral blood in recipients (n = 3) one month after transplantation.

Article Snippet: To generate a OP9-Lhx2 cell line that stably overexpressed mouse Lhx2, Lhx2 cDNA (OriGene) was subcloned into pMYs-IRES-EGFP (RTV-021, Cell Biolabs, INC) to generate the pMYs-Lhx2-IRES-EGFP vector.

Techniques: In Vivo, Produced, Derivative Assay, Irradiation, Injection, Transplantation Assay

Fig. 3. OP9-Lhx2 facilitates the derivation of human hematopoietic progenitors in vivo via teratoma formation. (A) Flow cytometry analysis of human hematopoietic progenitors derived from OP9/hESCs and OP9-Lhx2/hESCs teratomas. An analysis was conducted 8–10 weeks after ESC injection. Human hematopoietic progenitors were phenotypically defined as mCD45−

Journal: Stem cell research

Article Title: OP9-Lhx2 stromal cells facilitate derivation of hematopoietic progenitors both in vitro and in vivo.

doi: 10.1016/j.scr.2015.08.009

Figure Lengend Snippet: Fig. 3. OP9-Lhx2 facilitates the derivation of human hematopoietic progenitors in vivo via teratoma formation. (A) Flow cytometry analysis of human hematopoietic progenitors derived from OP9/hESCs and OP9-Lhx2/hESCs teratomas. An analysis was conducted 8–10 weeks after ESC injection. Human hematopoietic progenitors were phenotypically defined as mCD45−

Article Snippet: To generate a OP9-Lhx2 cell line that stably overexpressed mouse Lhx2, Lhx2 cDNA (OriGene) was subcloned into pMYs-IRES-EGFP (RTV-021, Cell Biolabs, INC) to generate the pMYs-Lhx2-IRES-EGFP vector.

Techniques: In Vivo, Flow Cytometry, Derivative Assay, ESC Injection

Target gene expression relative to GAPDH in GIST subtypes

Journal: Cancer Medicine

Article Title: Gene expression of the IGF pathway family distinguishes subsets of gastrointestinal stromal tumors wild type for KIT and PDGFRA

doi: 10.1002/cam4.57

Figure Lengend Snippet: Target gene expression relative to GAPDH in GIST subtypes

Article Snippet: Additional targets were detected using commercial TaqMan Gene Expression assays (Applied Biosystems by Life Technologies): IGF1R (64-bp amplicon) assay Hs00609566_m1, IGF1 (63 bp) Hs01547657_m1, IGF2 (81 bp) Hs01005963_m1, INSR (76 bp) Hs00965956_m1, IRS1 (insulin receptor substrate [IRS]) (69 bp) Hs00178563_m1, IRS2 (70 bp) Hs00275843_s1, CDH2 [Cadherin (CDH)] (78 bp) Hs00983062_m1, neurofilament, light polypeptide (NEFL) (71 bp) Hs00196245_m1, LHX2 (LIM homeobox [LHX]) (64 bp) Hs01104717_m1, KIRREL3 kin of IRRE like (KIRREL) (68 bp) Hs01123170_m1, CD34 (61 bp) Hs00990730_m1, and HIF1A (62 bp) Hs00936371_m1.

Techniques: Targeted Gene Expression

Journal: iScience

Article Title: A desmosomal cadherin controls multipotent hair follicle stem cell quiescence and orchestrates regeneration through adhesion signaling

doi: 10.1016/j.isci.2023.108568

Figure Lengend Snippet:

Article Snippet: Lgr6 Mouse Primer for RT-qPCR , Microsynth , Forward: GACCCCCTGACGGCTTACCTAGACCT Reverse: GTGGTTCCCTGAGAGCCGCAG.

Techniques: Western Blot, Immunolabeling, Plasmid Preparation, Recombinant, Blocking Assay, Staining, Software, Flow Cytometry, Microscopy, Imaging