lenticrispr sgrna construct Search Results


96
Addgene inc cloning sgrna sequence for erβ caccgtctgcagcgattacgcatc
Cloning Sgrna Sequence For Erβ Caccgtctgcagcgattacgcatc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pmc05739769-241-8-17?v=Addgene+inc
Average 96 stars, based on 1 article reviews
cloning sgrna sequence for erβ caccgtctgcagcgattacgcatc - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

90
Addgene inc heat shock protein 70 promoter
Heat Shock Protein 70 Promoter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/bio_rxiv__078527-154-11-23?v=Addgene+inc
Average 90 stars, based on 1 article reviews
heat shock protein 70 promoter - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

93
Addgene inc lenticrispr aavs1 sgrna construct
Lenticrispr Aavs1 Sgrna Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pmc09868636-80-14-26?v=Addgene+inc
Average 93 stars, based on 1 article reviews
lenticrispr aavs1 sgrna construct - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier

94
Addgene inc lenticrispr sgrna egfp
FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with <t>lentiCRISPR-sgRNA-eGFP#2</t> and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.
Lenticrispr Sgrna Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pmc04581504-42-2-7?v=Addgene+inc
Average 94 stars, based on 1 article reviews
lenticrispr sgrna egfp - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

94
Addgene inc lenticrispr egfp sgrna 1
FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with <t>lentiCRISPR-sgRNA-eGFP#2</t> and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.
Lenticrispr Egfp Sgrna 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pmc06706240-4-4-10?v=Addgene+inc
Average 94 stars, based on 1 article reviews
lenticrispr egfp sgrna 1 - by Bioz Stars, 2026-08
94/100 stars
  Buy from Supplier

98
Addgene inc lenticrispr sgrna construct
FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with <t>lentiCRISPR-sgRNA-eGFP#2</t> and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.
Lenticrispr Sgrna Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pm41196678-319-3-8?v=Addgene+inc
Average 98 stars, based on 1 article reviews
lenticrispr sgrna construct - by Bioz Stars, 2026-08
98/100 stars
  Buy from Supplier

90
Shanghai GenePharma lenticrispr-sirt6-ko-puro construct
FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with <t>lentiCRISPR-sgRNA-eGFP#2</t> and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.
Lenticrispr Sirt6 Ko Puro Construct, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pm31079921-88-1-21?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lenticrispr-sirt6-ko-puro construct - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma lenticrispr-nrf2ko-puro construct
FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with <t>lentiCRISPR-sgRNA-eGFP#2</t> and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.
Lenticrispr Nrf2ko Puro Construct, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+sgrna+construct/pm31079921-88-9-21?v=Shanghai+GenePharma
Average 90 stars, based on 1 article reviews
lenticrispr-nrf2ko-puro construct - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with lentiCRISPR-sgRNA-eGFP#2 and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Journal: BioMed Research International

Article Title: Efficient Mitochondrial Genome Editing by CRISPR/Cas9

doi: 10.1155/2015/305716

Figure Lengend Snippet: FLAG-NLS-Cas9 localizes to mitochondria. (a) Subcellular localization of FLAG-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with lentiCRISPR-sgRNA-eGFP#2 and monitored by Western blot. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as a cytosolic marker, poly(ADP-ribose) polymerase 1 (PARP1) served as a nuclear marker, and succinate dehydrogenase complex subunit A (SDHA) served as a mitochondrial marker. Ponceau staining of the blotted nitrocellulose membrane was presented in the bottom lane to visualize relative protein loading amounts. (b) Immunofluorescence images of FLAG-NLS-Cas9 demonstrating its localization to nucleus, cytoplasm, and mitochondria. HEK-293T cells were immunostained with mouse antibody to FLAG (green) 24 hours following transient transfection with FLAG-NLS-Cas9 construct. Mitochondria or nucleus was stained with mitotracker Red or DAPI, respectively. (c) Illustration of human mitochondrial DNA (mtDNA). Simplified view of mtDNA is presented to depict regions encoding peptides or tRNA for indicated amino acids. Filled triangles indicate sites targeted by gRNAs against Cox1 or Cox3. Arrows indicate primer annealing sites used for real-time PCR of Cox1 or Cox3 regions. (d) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with lentiCRISPR-sgRNA-Cox1 and lentiCRISPR-sgRNA-Cox3 or lentiCRISPR-sgRNA-eGFP#2 as a control, determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (d) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Article Snippet: LentiCRISPR and lentiCRISPR-sgRNA-eGFP#2 constructs were purchased from Addgene.

Techniques: Transfection, Western Blot, Marker, Staining, Immunofluorescence, Construct, Real-time Polymerase Chain Reaction, Two Tailed Test

Alterations in mitochondria-associated proteins following CRISPR/Cas9-mediated mtDNA editing. (a) Mitochondrial proteins in HEK-293T cells after CRISPR/Cas9-mediated cleavage of mtDNA at Cox1 and Cox3 loci as determined by Western blots using indicated antibodies. β -actin was used as a loading control. (b) Quantification of mitochondria proteins in HEK-293T cells transfected with lentiCRISPR-sgRNA-Cox1 + Cox3 or lentiCRISPR-sgRNA-eGFP#2 control as shown in panel (a) normalized to β -actin. (c) Illustration of human mtDNA. Specific loci targeted by lentiCRISPR-sgRNAs (Cox1, Cox2, Cox3, and ATP8/6) are indicated with filled triangles. (d) Representative Western blots showing differential alteration of mitochondrial proteins following cleavage of specific mtDNA loci mediated by indicated sgRNAs in HEK-293T cells. Quantified data (b) are expressed as mean ± s.e.m., ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Journal: BioMed Research International

Article Title: Efficient Mitochondrial Genome Editing by CRISPR/Cas9

doi: 10.1155/2015/305716

Figure Lengend Snippet: Alterations in mitochondria-associated proteins following CRISPR/Cas9-mediated mtDNA editing. (a) Mitochondrial proteins in HEK-293T cells after CRISPR/Cas9-mediated cleavage of mtDNA at Cox1 and Cox3 loci as determined by Western blots using indicated antibodies. β -actin was used as a loading control. (b) Quantification of mitochondria proteins in HEK-293T cells transfected with lentiCRISPR-sgRNA-Cox1 + Cox3 or lentiCRISPR-sgRNA-eGFP#2 control as shown in panel (a) normalized to β -actin. (c) Illustration of human mtDNA. Specific loci targeted by lentiCRISPR-sgRNAs (Cox1, Cox2, Cox3, and ATP8/6) are indicated with filled triangles. (d) Representative Western blots showing differential alteration of mitochondrial proteins following cleavage of specific mtDNA loci mediated by indicated sgRNAs in HEK-293T cells. Quantified data (b) are expressed as mean ± s.e.m., ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Article Snippet: LentiCRISPR and lentiCRISPR-sgRNA-eGFP#2 constructs were purchased from Addgene.

Techniques: CRISPR, Western Blot, Transfection, Two Tailed Test

Construction of mitochondria-targeted MTS-HA-Cas9. (a) Schematic illustration of mitochondria-targeting Cas9 (mitoCas9). Mitochondria-targeting sequence (MTS) and HA tag information are presented. (b) Expression of mitoCas9 in HEK-293T cells transiently transfected with MTS-HA-Cas9 construct determined by Western blots using HA antibody. β -actin was used as a loading control. (c) Subcellular localization of MTS-HA-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with lentiCRISPR-sgRNA-eGFP#2 and monitored by Western blot. GAPDH served as a cytosolic marker, PARP1 served as a nuclear marker, and SDHA served as a mitochondrial marker. (d) Representative immunofluorescence microscopic image of MTS-HA-Cas9 (HA, green) and CoxIV (red) subcellular distributions in HEK-293T cells transfected with MTS-HA-Cas9 construct. The merged image (yellow, right panel) shows colocalization of mitoCas9 and CoxIV. (e) Representative gel images of the PCR product of hU6-sgRMA-eGFP and hU6-sgRNA-Cox1 which were purified by gel extraction (bottom panel). Schematics of primers and lentiCRISPR-sgRNA templates used to amplify U6 promoter and respective sgRNA components for transfection (upper panel). (f) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with indicated constructs (mitoCas9 is a plasmid, while U6-sgRNAs are PCR product.), determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (b) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, analysis of variance (ANOVA) test followed by Student-Newman-Keuls post hoc analysis.

Journal: BioMed Research International

Article Title: Efficient Mitochondrial Genome Editing by CRISPR/Cas9

doi: 10.1155/2015/305716

Figure Lengend Snippet: Construction of mitochondria-targeted MTS-HA-Cas9. (a) Schematic illustration of mitochondria-targeting Cas9 (mitoCas9). Mitochondria-targeting sequence (MTS) and HA tag information are presented. (b) Expression of mitoCas9 in HEK-293T cells transiently transfected with MTS-HA-Cas9 construct determined by Western blots using HA antibody. β -actin was used as a loading control. (c) Subcellular localization of MTS-HA-Cas9 assessed in the cytosolic (Cyt), mitochondrial (Mit), and nuclear (Nu) fractions of HEK-293T cells transfected with lentiCRISPR-sgRNA-eGFP#2 and monitored by Western blot. GAPDH served as a cytosolic marker, PARP1 served as a nuclear marker, and SDHA served as a mitochondrial marker. (d) Representative immunofluorescence microscopic image of MTS-HA-Cas9 (HA, green) and CoxIV (red) subcellular distributions in HEK-293T cells transfected with MTS-HA-Cas9 construct. The merged image (yellow, right panel) shows colocalization of mitoCas9 and CoxIV. (e) Representative gel images of the PCR product of hU6-sgRMA-eGFP and hU6-sgRNA-Cox1 which were purified by gel extraction (bottom panel). Schematics of primers and lentiCRISPR-sgRNA templates used to amplify U6 promoter and respective sgRNA components for transfection (upper panel). (f) Quantification of copy numbers for Cox1, Cox3, and ND1 regions of mtDNA extracted from HEK-293T cells transiently transfected with indicated constructs (mitoCas9 is a plasmid, while U6-sgRNAs are PCR product.), determined by real-time quantitative PCR using primers listed in . GAPDH was used as an internal loading control ( n = 3 per group). Quantified data (b) are expressed as mean ± s.e.m., ∗∗∗ P < 0.001, analysis of variance (ANOVA) test followed by Student-Newman-Keuls post hoc analysis.

Article Snippet: LentiCRISPR and lentiCRISPR-sgRNA-eGFP#2 constructs were purchased from Addgene.

Techniques: Sequencing, Expressing, Transfection, Construct, Western Blot, Marker, Immunofluorescence, Purification, Gel Extraction, Plasmid Preparation, Real-time Polymerase Chain Reaction

MitoCas9-induced mtDNA damage leads to mitochondria dysfunction. (a) Quantification of copy numbers for ND1 region of mtDNA extracted from HEK-293T cells transiently transfected with indicated constructs (gRNA control, mitoCas9 and U6-sgRNA to eGFP; gRNA Cox1, Cox3, mitoCas9, and U6-sgRNA to Cox1 and Cox3), determined by real-time quantitative PCR using primers listed in at the indicated time points (2 days and 5 days after transfection). GAPDH was used as an internal loading control ( n = 3 per group). (b) Quantification of messenger RNAs for ND1, Cox1, and Cox2 genes in HEK-293T cells 5 days following transient transfection with lentiCRISPR-sgRNA-Cox1 + Cox3 or lentiCRISPR-sgRNA-eGFP#2 control determined by real-time PCR and normalized to GAPDH ( n = 3 per group). (c) Representative images of mitotracker Red staining for functional mitochondria in HEK-293T cells transfected with the indicated constructs (upper panel). Quantification of relative mitotracker Red staining intensities in two groups was shown in the bottom panel ( n = 50 mitochondria from three independent cultures per group). (d) Cell counts demonstrating proliferation rate of the HEK-293T cells following cleavage of specific mtDNA loci ( n = 6 individual measurements per group). Days indicate the time intervals proceeded after cell seeding following 5 days of transient transfectin. Quantified data are expressed as mean ± s.e.m., ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Journal: BioMed Research International

Article Title: Efficient Mitochondrial Genome Editing by CRISPR/Cas9

doi: 10.1155/2015/305716

Figure Lengend Snippet: MitoCas9-induced mtDNA damage leads to mitochondria dysfunction. (a) Quantification of copy numbers for ND1 region of mtDNA extracted from HEK-293T cells transiently transfected with indicated constructs (gRNA control, mitoCas9 and U6-sgRNA to eGFP; gRNA Cox1, Cox3, mitoCas9, and U6-sgRNA to Cox1 and Cox3), determined by real-time quantitative PCR using primers listed in at the indicated time points (2 days and 5 days after transfection). GAPDH was used as an internal loading control ( n = 3 per group). (b) Quantification of messenger RNAs for ND1, Cox1, and Cox2 genes in HEK-293T cells 5 days following transient transfection with lentiCRISPR-sgRNA-Cox1 + Cox3 or lentiCRISPR-sgRNA-eGFP#2 control determined by real-time PCR and normalized to GAPDH ( n = 3 per group). (c) Representative images of mitotracker Red staining for functional mitochondria in HEK-293T cells transfected with the indicated constructs (upper panel). Quantification of relative mitotracker Red staining intensities in two groups was shown in the bottom panel ( n = 50 mitochondria from three independent cultures per group). (d) Cell counts demonstrating proliferation rate of the HEK-293T cells following cleavage of specific mtDNA loci ( n = 6 individual measurements per group). Days indicate the time intervals proceeded after cell seeding following 5 days of transient transfectin. Quantified data are expressed as mean ± s.e.m., ∗ P < 0.05, ∗∗ P < 0.01, and ∗∗∗ P < 0.001, unpaired two-tailed Student's t -test.

Article Snippet: LentiCRISPR and lentiCRISPR-sgRNA-eGFP#2 constructs were purchased from Addgene.

Techniques: Transfection, Construct, Real-time Polymerase Chain Reaction, Staining, Functional Assay, Two Tailed Test