Journal: Neuroscience Bulletin

Article Title: Comprehensive Proteomic Profiling of Patients’ Tears Identifies Potential Biomarkers for the Traumatic Vegetative State

doi: 10.1007/s12264-018-0259-x

Figure Lengend Snippet: Gene Ontology analysis revealed 21 proteins involved in response to wounding.

Article Snippet: ELISA and Receiver Operating Characteristic (ROC) Curve Analysis In the verification stage, the levels of 7 promising tear proteins [cystatin B (CTSB), protease, serine 1 (PRSS1), S100 calcium-binding protein A7 (S100A7), glutathione S-transferase P (GSTP1), complement factor H (CFH), kininogen 1 (KNG1), and alpha-1-acid glycoprotein 1 (ORM1)] were measured using the ELISA kits for human CSTB, human PRSS1, human CFH, human KNG1, and human ORM1 (Boster Biological Technology, Wuhan, China) and for human S100A7 and human GSTP1 (from Cloud-clone Corp., Houston, TX).

Techniques:

Journal: Neuroscience Bulletin

Article Title: Comprehensive Proteomic Profiling of Patients’ Tears Identifies Potential Biomarkers for the Traumatic Vegetative State

doi: 10.1007/s12264-018-0259-x

Figure Lengend Snippet: Levels of representative proteins in tears from healthy controls and traumatic vegetative state patients. A List of 7 selected differentially-expressed proteins. Levels of CTSB (B), PRSS1 (C), S100A7 (D), GSTP1 (E), CFH (F), KNG1 (G), and ORM1 (H).

Article Snippet: ELISA and Receiver Operating Characteristic (ROC) Curve Analysis In the verification stage, the levels of 7 promising tear proteins [cystatin B (CTSB), protease, serine 1 (PRSS1), S100 calcium-binding protein A7 (S100A7), glutathione S-transferase P (GSTP1), complement factor H (CFH), kininogen 1 (KNG1), and alpha-1-acid glycoprotein 1 (ORM1)] were measured using the ELISA kits for human CSTB, human PRSS1, human CFH, human KNG1, and human ORM1 (Boster Biological Technology, Wuhan, China) and for human S100A7 and human GSTP1 (from Cloud-clone Corp., Houston, TX).

Techniques:

Journal: International Journal of Environmental Research and Public Health

Article Title: TMT-Based Quantitative Proteomics Reveals Cochlear Protein Profile Alterations in Mice with Noise-Induced Hearing Loss

doi: 10.3390/ijerph19010382

Figure Lengend Snippet: The significant signaling pathway involved by DEPs identified by KEGG pathway enrichment analysis.

Article Snippet: Then, the membranes were blocked at room temperature for 2 h with 5% non-fat milk in a TBST buffer and incubated with primary antibodies against ITGA1 (1:1000, DF2538, Affinity Biosciences, Cincinnati, OH, USA), KNG1 (1:1000, A1670, ABclonal Technology, Wuhan, China), CFI (1:1000, A5623, ABclonal Technology, Wuhan, China), FGF1 (1:1000, DF6124, Affinity), AKT2 (1:1000, AF6264, Affinity), ATG5 (1:1000, DF6010, Affinity Biosciences, Cincinnati, OH, USA) and GAPDH (1:1000, ab8245, Abcam Cambridge, MA, USA) at 4 °C overnight, then incubated for 2 h at room temperature by HRP goat anti-rabbit IgG antibody (1:5000, AS014, ABclonal Technology, Wuhan, China).

Techniques: Coagulation, Activation Assay

Journal: International Journal of Environmental Research and Public Health

Article Title: TMT-Based Quantitative Proteomics Reveals Cochlear Protein Profile Alterations in Mice with Noise-Induced Hearing Loss

doi: 10.3390/ijerph19010382

Figure Lengend Snippet: Representative inflammation and autophagy-related DEPs involving in NIHL identified by tandem mass tag (TMT)-labeling quantitative proteomic analysis.

Article Snippet: Then, the membranes were blocked at room temperature for 2 h with 5% non-fat milk in a TBST buffer and incubated with primary antibodies against ITGA1 (1:1000, DF2538, Affinity Biosciences, Cincinnati, OH, USA), KNG1 (1:1000, A1670, ABclonal Technology, Wuhan, China), CFI (1:1000, A5623, ABclonal Technology, Wuhan, China), FGF1 (1:1000, DF6124, Affinity), AKT2 (1:1000, AF6264, Affinity), ATG5 (1:1000, DF6010, Affinity Biosciences, Cincinnati, OH, USA) and GAPDH (1:1000, ab8245, Abcam Cambridge, MA, USA) at 4 °C overnight, then incubated for 2 h at room temperature by HRP goat anti-rabbit IgG antibody (1:5000, AS014, ABclonal Technology, Wuhan, China).

Techniques: Molecular Weight

Journal: Nature Communications

Article Title: Phenome-wide association studies across large population cohorts support drug target validation

doi: 10.1038/s41467-018-06540-3

Figure Lengend Snippet: PheWAS for contact activation coagulation pathway targets. Three SNPs known to affect plasma protein levels of FXI (rs4253399), FXII (rs2731672), and KNG1 (rs5030062), and previously reported associated with partial thromboplastin time (aPTT) were interrogated in meta-PheWAS. Five phenotypes were observed as significantly associated (FDR < 0.1) with at least one of the three SNPs: blood clots (23andMe, FINRISK, and CHOP: 7487 cases, 273,305 controls), known association with the F11 SNP (*), blood thinners medication (23andMe: 22,985 cases, 236,431 controls), warfarin medication (23andMe: 7142 cases, 94,701 controls), pulmonary embolism (Gplc/UK Biobank: 949 cases, 111,077 controls), and bleeding tendency (23andMe: 1574 cases, 85,223 controls). Odds ratios (OR) and 95% confidence intervals of association of the aPTT-increasing alleles are shown. Detailed association results are provided in the Supplementary Data

Article Snippet: In contrast, carriers of the KNG1 allele rs5030062-A, which reduces plasma kininogen as well as circulating FXI, and increases aPTT, showed both reduced blood clotting (OR meta = 0.93, P meta = 1.6 × 10 −4 ) as well as increased bleeding liability (OR 23andMe = 1.14, P 23andMe = 4.1 × 10 −4 ).

Techniques: Activation Assay, Coagulation, Clinical Proteomics

Journal: Nature Communications

Article Title: Phenome-wide association studies across large population cohorts support drug target validation

doi: 10.1038/s41467-018-06540-3

Figure Lengend Snippet: Candidate drug targets investigated in the study

Article Snippet: In contrast, carriers of the KNG1 allele rs5030062-A, which reduces plasma kininogen as well as circulating FXI, and increases aPTT, showed both reduced blood clotting (OR meta = 0.93, P meta = 1.6 × 10 −4 ) as well as increased bleeding liability (OR 23andMe = 1.14, P 23andMe = 4.1 × 10 −4 ).

Techniques:

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: q‐PCR primers

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques:

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: KNG1 was lowly expressed in glioma and was negatively correlated to miR‐942‐5p which was highly expressed in glioma. (A) The miRNAs which might target KNG1 were predicted through bioinformatics analysis (TargetScan, starBase, miRDB, and miRWalk). (B, C) The correlation between the expression levels of miR‐942‐5p and miR‐455‐5p with the overall survival of brain lower‐grade glioma (LGG) cancer patients was predicted through bioinformatics analysis and analyzed by Kaplan–Meier method (log‐rank test). (D, E) The correlation among miR‐942‐5p copy number, neoplasm histologic grade and new neoplasm event post initial therapy. (F) The expression of KNG1 in clinical glioma tissues was analyzed by RT‐qPCR, with GAPDH serving as an internal control. (G) The expression of KNG1 in glioma was predicted through bioinformatics analysis. (H, I) The expressions of miR‐492‐5p (H) and miR‐455‐5p (I) in clinical glioma tissues were analyzed by RT‐qPCR, with U6 serving as an internal control. (J–M) The correlation between KNG1 and miR‐492‐5p (J, K) or miR‐455‐5p (L, M) in the normal and cancer samples from glioma patients was analyzed by Pearson's correlation analysis. (N–P) The expressions of KNG1 (N, O) and miR‐492‐5p (P) in normal human astrocytes and human glioma cell lines were analyzed by RT‐qPCR or Western blot, with GAPDH or U6 serving as an internal control, respectively. (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NHA).

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Expressing, Quantitative RT-PCR, Control, Western Blot

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: The transfection efficiency of siKNG1 and KNG1 overexpression plasmids in LN‐229 and T98G cells. (A–H) The expression level of KNG1 in LN‐229 and T98G cells after transfection was detected by RT‐qPCR and Western blot. GAPDH was used as an internal control. (*** p < 0.001 vs. siNC; ### p < 0.001 vs. NC). All experiments were conducted three times. (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Transfection, Over Expression, Expressing, Quantitative RT-PCR, Western Blot, Control, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: Silenced KNG1 enhanced the migration and invasion of LN‐229 and T98G cells, whereas KNG1 overexpression did the opposite. (A–D) The migration of LN‐229 and T98G cells after transfection of siKNG1 and KNG1 overexpression plasmids was determined by wound healing assays. (E–H) The invasion of LN‐229 and T98G cells after knockdown and overexpression of KNG1 was detected by transwell assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. siNC; ## p < 0.01, ### p < 0.001 vs. NC). (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Migration, Over Expression, Transfection, Knockdown, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: Silenced KNG1 facilitated the proliferation of LN‐229 and T98G cells by regulating related genes, whereas KNG1 overexpression did conversely. (A–H) The expressions of SNAIL1, TWIST1, Vimentin, ZEB1, N‐Cadherin, and E‐Cadherin in LN‐229 and T98G cells after knockdown and overexpression of KNG1 were quantitated by RT‐qPCR or Western blot, with GAPDH serving as an internal control. (I–L) The proliferation of LN‐229 and T98G cells after knockdown and overexpression of KNG1 was detected by colony formation assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. siNC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. NC) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Over Expression, Knockdown, Quantitative RT-PCR, Western Blot, Control, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: MiR‐942‐5p targeted KNG1 and regulated the expression of KNG1 . (A) KNG1‐3’‐UTR was predicted to contain binding sites of miR‐942‐5p by TargetScan. (B, C) Luciferase reporter assay validated that miR‐942‐5p targeted KNG1 in LN‐229 and T98G cells ( ‡‡‡ p < 0.001 vs. mimics control+KNG1‐3’‐UTR, ††† P < 0.001 vs. mimics + KNG1‐3’‐UTR mut). (D, E) The expression of miR‐942‐5p in LN‐229 and T98G cells after transfection was detected by RT‐qPCR, with U6 serving as an internal control. (F–I) The expression of KNG1 in LN‐229 and T98G cells after transfection was detected by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (*** p < 0.001 vs. inhibitor control; ^^^ p < 0.001 vs. siNC + inhibitor; ### p < 0.001 vs. mimic control; △△△ p < 0.001 vs. NC + mimic) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Expressing, Binding Assay, Luciferase, Reporter Assay, Control, Transfection, Quantitative RT-PCR, Western Blot, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: KNG1 reversed the promoting effect of miR‐942‐5p mimic on the migration, invasion, and proliferation of LN‐229 and T98G cells, and siKNG1 offset the inhibitory effect of miR‐942‐5p inhibitor on the migration and invasion of both cells. (A, B) The migration of LN‐229 and T98G cells after transfection was detected by wound healing assays. (C, D) The invasion of LN‐229 and T98G cells after transfection was detected by Transwell assays. (E, F) The proliferation of LN‐229 and T98G cells after transfection was detected by colony formation assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. inhibitor control; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. siNC + inhibitor; ## p < 0.01, ### p < 0.001 vs. mimic control; △△ p < 0.01, △△△ p < 0.001 vs. NC + mimic) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Migration, Transfection, Control, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 overexpression and knockdown reversed the regulatory effects of miR‐942‐5p mimic and inhibitor on the migration and invasion of LN‐229 and T98G cells, respectively. (A, B) The migration of LN‐229 and T98G cells after transfection was determined by wound healing assays. (C, D) The invasion of LN‐229 and T98G cells after transfection was detected by Transwell assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor). (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Over Expression, Knockdown, Migration, Transfection, shRNA, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 overexpression and knockdown diminished the effects of miR‐942‐5p mimic and inhibitor on cell cycle distribution and related gene expressions in LN‐229 and T98G cells, respectively. (A–D) The expressions of SNAIL1, Vimentin, ZO1, and E‐Cadherin in LN‐229 and T98G cells after transfection were quantified by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (E, F) The cell cycle distribution of LN‐229 and T98G cells after transfection were detected by flow cytometry (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △ p < 0.05, △△△ p < 0.001 vs. shRNA NC; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Over Expression, Knockdown, Transfection, Western Blot, Quantitative RT-PCR, Control, Flow Cytometry, shRNA, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 overexpression and knockdown reversed the effects of miR‐942‐5p mimic and inhibitor on the proliferation of LN‐229 and T98G cells, respectively. (A, B) The proliferation of LN‐229 and T98G cells after transfection was tested by colony formation assays. (C, D) The expressions of CDC25A, cyclin D1, and CDKN2A in LN‐229 and T98G cells after transfection were measured by Western blot, with GAPDH serving as an internal control (** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △ p < 0.05, △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Over Expression, Knockdown, Transfection, Western Blot, Control, shRNA, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate tumor growth in vivo. (A, B) The picture of a solid tumor was exhibited and the tumor weight was calculated. (C, D) The expression of LINC01018 in tumor tissues was measured by RT‐qPCR, with GAPDH serving as an internal control. (E, F) The expression of miR‐942‐5p in tumor tissues was detected by RT‐qPCR, with U6 serving as an internal control (** p < 0.01, *** p < 0.001 vs. NC; ### p < 0.001 vs. LINC01018 + mimic; △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: In Vivo, Expressing, Quantitative RT-PCR, Control, shRNA, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate the expression of KNG1 in vivo. (A, B) The expression of KNG1 in tumor tissues was quantitated by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (C, D) The expression of KNG1 in tumor tissues was determined by immunohistochemical analysis. (*** p < 0.001 vs. NC; ### p < 0.001 vs. LINC01018 + mimic; △△△ p < 0.001 vs. shRNA NC; ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor). (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Expressing, In Vivo, Western Blot, Quantitative RT-PCR, Control, Immunohistochemical staining, shRNA, Negative Control

Journal: CNS Neuroscience & Therapeutics

Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo

doi: 10.1111/cns.14053

Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate the microvessel density (MVD). (A, B) The effect of LINC01018/ miR‐942‐5p axis on MVD was analyzed by immunohistochemistry (*** p < 0.001 vs. NC; # p < 0.05, ### P < 0.001 vs. LINC01018 + mimic; △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)

Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′), siRNA for KNG1 (siKNG1; target senquence: 5’‐CTGGAGATTGTCAAATTCAGTAT‐3′), siRNA NC (siNC; 5’‐UUUGUACUACACAAAAGUACUG‐3′), miR‐942‐5p mimic (5’‐UCUUCUCUGUUUUGGCCAUGUG‐3′), miR‐942‐5p inhibitor (5’‐CACAUGGCCAAAACAGAGAAGA‐3′), mimic control (5’‐UUCUCCGAACGUGUCACGUUU‐3′), and inhibitor control (5′‐ CAGUCCUUUUGUGUAGUACAA‐3′) were obtained from RIBOBIO (Guangzhou, China).

Techniques: Immunohistochemistry, shRNA, Negative Control