|
Sino Biological
recombinant kininogen protein Recombinant Kininogen Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/Human+KNG1+%2F+BDK+%2F+Kininogen-1+Protein/pm40680670-48-1-8 Average 93 stars, based on 1 article reviews
recombinant kininogen protein - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
Cusabio
kng1 ![]() Kng1, supplied by Cusabio, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/KNG1/pmc05376940-125-10-17 Average 94 stars, based on 1 article reviews
kng1 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Proteintech
kng1 ![]() Kng1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/Kininogen+1+Antibody/pmc12589820-112-23-33 Average 93 stars, based on 1 article reviews
kng1 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
|
ABclonal Biotechnology
anti kng1 ![]() Anti Kng1, supplied by ABclonal Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/KNG1+Rabbit+pAb/pmc12992019-110-12-15 Average 94 stars, based on 1 article reviews
anti kng1 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
|
Boster Bio
human kng1 ![]() Human Kng1, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/Human+Kininogen-1+%2F+KNG1+%2F+HMW+Kininogen+ELISA+Kit+PicoKine/pmc06060216-177-60-65 Average 90 stars, based on 1 article reviews
human kng1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
USCN Life
kininogen 1 (kng1 ![]() Kininogen 1 (Kng1, supplied by USCN Life, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/kininogen+1++kng1/pm38167532-84-47-52 Average 90 stars, based on 1 article reviews
kininogen 1 (kng1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
GL Biochem
his-tagged kng1 fragments his 3 -kng1 k438-r457 -his 3 ![]() His Tagged Kng1 Fragments His 3 Kng1 K438 R457 His 3, supplied by GL Biochem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/his+tagged+kng1+fragments++his+3++kng1+e434+l461++his+3+and+his+3++kng1+k438+r457++his+3+/pmc05124559-105-9-30 Average 90 stars, based on 1 article reviews
his-tagged kng1 fragments his 3 -kng1 k438-r457 -his 3 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Abnova
kng1 antibody ![]() Kng1 Antibody, supplied by Abnova, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/kng1+antibody/pm30068373-101-18-20 Average 90 stars, based on 1 article reviews
kng1 antibody - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
23andMe
kng1 allele rs5030062-a ![]() Kng1 Allele Rs5030062 A, supplied by 23andMe, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/kng1+allele+rs5030062+a/pmc06191429-161-5-44 Average 90 stars, based on 1 article reviews
kng1 allele rs5030062-a - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Ribobio co
sirna for kng1 ![]() Sirna For Kng1, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/kng1/sirna+for+kng1/pmc09873518-65-7-35 Average 90 stars, based on 1 article reviews
sirna for kng1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
|
Kng1l1 Rat 3 unique 27mer siRNA duplexes 2 nmol each
|
Buy from Supplier |
|
Lenti ORF particles Kng1 GFP tagged Mouse kininogen 1 Kng1 transcript variant 1 200ul 10 7 TU mL
|
Buy from Supplier |
Image Search Results
Journal: Evidence-based Complementary and Alternative Medicine : eCAM
Article Title: Identification of Tengfu Jiangya Tablet Target Biomarkers with Quantitative Proteomic Technique
doi: 10.1155/2017/7594805
Figure Lengend Snippet: Bioinformatics analysis of differentially expressed proteins. GO analysis results showed cellular component (a), molecular function (b), and biological process (c). STRING analysis indicated visualization of protein-protein interactions for 20 candidate proteins (d). The notes for different color lines were in the bottom of (d). In addition, 5 candidate biomarkers verified by ELISA and Western Blot were marked with ∗ .
Article Snippet: The concentration of bradykinin, which was the downstream product of
Techniques: Protein-Protein interactions, Enzyme-linked Immunosorbent Assay, Western Blot
Journal: Evidence-based Complementary and Alternative Medicine : eCAM
Article Title: Identification of Tengfu Jiangya Tablet Target Biomarkers with Quantitative Proteomic Technique
doi: 10.1155/2017/7594805
Figure Lengend Snippet: The molecular function, biological process, and expression levels of 20 candidate serum proteins quantified by iTRAQ technique.
Article Snippet: The concentration of bradykinin, which was the downstream product of
Techniques: Expressing, Multiplex sample analysis, Binding Assay, Chemotaxis Assay, Activity Assay, Antioxidant Activity Assay, Protein Binding, Transduction, Activation Assay
Journal: Evidence-based Complementary and Alternative Medicine : eCAM
Article Title: Identification of Tengfu Jiangya Tablet Target Biomarkers with Quantitative Proteomic Technique
doi: 10.1155/2017/7594805
Figure Lengend Snippet: Validation of Kininogen-1, Keratin 1, Myeloperoxidase, Retinol binding protein 4, Serum amyloid A protein, and bradykinin in serum. (a) Levels of these candidate biomarkers and downstream substance were measured by ELISA in serum of EH patients ( n = 30) and TJT treated patients ( n = 30). p values were calculated with ANOVA test ( ∗ p = 0.000). (b) With Western Blot results, the expression of Kininogen 1 and Retinol binding protein 4 was significantly differentiated between two groups. Transferrin was applied as loading control.
Article Snippet: The concentration of bradykinin, which was the downstream product of
Techniques: Biomarker Discovery, Binding Assay, Enzyme-linked Immunosorbent Assay, Western Blot, Expressing, Control
Journal: Evidence-based Complementary and Alternative Medicine : eCAM
Article Title: Identification of Tengfu Jiangya Tablet Target Biomarkers with Quantitative Proteomic Technique
doi: 10.1155/2017/7594805
Figure Lengend Snippet: This map directly summarized the pathway of 5 target proteins (green ovals). The arrowheads represented variation trends of target protein after TJT treatment. KNG1, KRT1, and MPO were involved in bradykinin production; meanwhile MPO and RBP4 played vital role in vascular oxidative and inflammatory injury. SAA was an acute-phase marker for vascular injury.
Article Snippet: The concentration of bradykinin, which was the downstream product of
Techniques: Marker
Journal: Immunity, Inflammation and Disease
Article Title: Electroacupuncture of Guanyuan (CV4) Acupoint Improved Pelvic Inflammatory Disease Pain by Inhibiting Neuroinflammation and Sympathetic Activity
doi: 10.1002/iid3.70299
Figure Lengend Snippet: EA stimulation of Guanyuan acupoint reduces the expression of pain‐causing substances and inflammatory mediators in rats with PID. 5‐HT3R, CGRP, HA, KNG1, PGI2, and TFF2 expressions in EA stimulation of Guanyuan acupoint skin (A) and plantar skin (B) were detected using western blot analysis. Values are expressed as mean ± SD ( n = 6), ** p < 0.01, versus control group; # p < 0.05, ## p < 0.01, ns p > 0.05, versus model group. 5‐HT3R, 5‐hydroxytryptamine receptor 3; CGRP, calcitonin‐gene‐related peptide; HA, hyaluronic acid; KNG1, Kininogen 1; PGI2, prostaglandin I2; TFF2, trefoil factor 2.
Article Snippet: The antibodies used were as follows: β‐actin (AC026, Abclonal, 1:50,000); 5‐HT3R (BS‐34076R, Bioss, 1:2,000); CGRP (A5542, Abclonal, 1:1,000); HA Tag (AF0039, Beyotime, 1:1,000);
Techniques: Expressing, Western Blot, Control
Journal: Neuroscience Bulletin
Article Title: Comprehensive Proteomic Profiling of Patients’ Tears Identifies Potential Biomarkers for the Traumatic Vegetative State
doi: 10.1007/s12264-018-0259-x
Figure Lengend Snippet: Gene Ontology analysis revealed 21 proteins involved in response to wounding.
Article Snippet: ELISA and Receiver Operating Characteristic (ROC) Curve Analysis In the verification stage, the levels of 7 promising tear proteins [cystatin B (CTSB), protease, serine 1 (PRSS1), S100 calcium-binding protein A7 (S100A7), glutathione S-transferase P (GSTP1), complement factor H (CFH), kininogen 1 (KNG1), and alpha-1-acid glycoprotein 1 (ORM1)] were measured using the ELISA kits for human CSTB, human PRSS1, human CFH,
Techniques:
Journal: Neuroscience Bulletin
Article Title: Comprehensive Proteomic Profiling of Patients’ Tears Identifies Potential Biomarkers for the Traumatic Vegetative State
doi: 10.1007/s12264-018-0259-x
Figure Lengend Snippet: Levels of representative proteins in tears from healthy controls and traumatic vegetative state patients. A List of 7 selected differentially-expressed proteins. Levels of CTSB (B), PRSS1 (C), S100A7 (D), GSTP1 (E), CFH (F), KNG1 (G), and ORM1 (H).
Article Snippet: ELISA and Receiver Operating Characteristic (ROC) Curve Analysis In the verification stage, the levels of 7 promising tear proteins [cystatin B (CTSB), protease, serine 1 (PRSS1), S100 calcium-binding protein A7 (S100A7), glutathione S-transferase P (GSTP1), complement factor H (CFH), kininogen 1 (KNG1), and alpha-1-acid glycoprotein 1 (ORM1)] were measured using the ELISA kits for human CSTB, human PRSS1, human CFH,
Techniques:
Journal: Nature Communications
Article Title: Phenome-wide association studies across large population cohorts support drug target validation
doi: 10.1038/s41467-018-06540-3
Figure Lengend Snippet: PheWAS for contact activation coagulation pathway targets. Three SNPs known to affect plasma protein levels of FXI (rs4253399), FXII (rs2731672), and KNG1 (rs5030062), and previously reported associated with partial thromboplastin time (aPTT) were interrogated in meta-PheWAS. Five phenotypes were observed as significantly associated (FDR < 0.1) with at least one of the three SNPs: blood clots (23andMe, FINRISK, and CHOP: 7487 cases, 273,305 controls), known association with the F11 SNP (*), blood thinners medication (23andMe: 22,985 cases, 236,431 controls), warfarin medication (23andMe: 7142 cases, 94,701 controls), pulmonary embolism (Gplc/UK Biobank: 949 cases, 111,077 controls), and bleeding tendency (23andMe: 1574 cases, 85,223 controls). Odds ratios (OR) and 95% confidence intervals of association of the aPTT-increasing alleles are shown. Detailed association results are provided in the Supplementary Data
Article Snippet: In contrast, carriers of the
Techniques: Activation Assay, Coagulation, Clinical Proteomics
Journal: Nature Communications
Article Title: Phenome-wide association studies across large population cohorts support drug target validation
doi: 10.1038/s41467-018-06540-3
Figure Lengend Snippet: Candidate drug targets investigated in the study
Article Snippet: In contrast, carriers of the
Techniques:
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: q‐PCR primers
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques:
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: KNG1 was lowly expressed in glioma and was negatively correlated to miR‐942‐5p which was highly expressed in glioma. (A) The miRNAs which might target KNG1 were predicted through bioinformatics analysis (TargetScan, starBase, miRDB, and miRWalk). (B, C) The correlation between the expression levels of miR‐942‐5p and miR‐455‐5p with the overall survival of brain lower‐grade glioma (LGG) cancer patients was predicted through bioinformatics analysis and analyzed by Kaplan–Meier method (log‐rank test). (D, E) The correlation among miR‐942‐5p copy number, neoplasm histologic grade and new neoplasm event post initial therapy. (F) The expression of KNG1 in clinical glioma tissues was analyzed by RT‐qPCR, with GAPDH serving as an internal control. (G) The expression of KNG1 in glioma was predicted through bioinformatics analysis. (H, I) The expressions of miR‐492‐5p (H) and miR‐455‐5p (I) in clinical glioma tissues were analyzed by RT‐qPCR, with U6 serving as an internal control. (J–M) The correlation between KNG1 and miR‐492‐5p (J, K) or miR‐455‐5p (L, M) in the normal and cancer samples from glioma patients was analyzed by Pearson's correlation analysis. (N–P) The expressions of KNG1 (N, O) and miR‐492‐5p (P) in normal human astrocytes and human glioma cell lines were analyzed by RT‐qPCR or Western blot, with GAPDH or U6 serving as an internal control, respectively. (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NHA).
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Expressing, Quantitative RT-PCR, Control, Western Blot
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: The transfection efficiency of siKNG1 and KNG1 overexpression plasmids in LN‐229 and T98G cells. (A–H) The expression level of KNG1 in LN‐229 and T98G cells after transfection was detected by RT‐qPCR and Western blot. GAPDH was used as an internal control. (*** p < 0.001 vs. siNC; ### p < 0.001 vs. NC). All experiments were conducted three times. (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Transfection, Over Expression, Expressing, Quantitative RT-PCR, Western Blot, Control, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: Silenced KNG1 enhanced the migration and invasion of LN‐229 and T98G cells, whereas KNG1 overexpression did the opposite. (A–D) The migration of LN‐229 and T98G cells after transfection of siKNG1 and KNG1 overexpression plasmids was determined by wound healing assays. (E–H) The invasion of LN‐229 and T98G cells after knockdown and overexpression of KNG1 was detected by transwell assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. siNC; ## p < 0.01, ### p < 0.001 vs. NC). (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Migration, Over Expression, Transfection, Knockdown, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: Silenced KNG1 facilitated the proliferation of LN‐229 and T98G cells by regulating related genes, whereas KNG1 overexpression did conversely. (A–H) The expressions of SNAIL1, TWIST1, Vimentin, ZEB1, N‐Cadherin, and E‐Cadherin in LN‐229 and T98G cells after knockdown and overexpression of KNG1 were quantitated by RT‐qPCR or Western blot, with GAPDH serving as an internal control. (I–L) The proliferation of LN‐229 and T98G cells after knockdown and overexpression of KNG1 was detected by colony formation assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. siNC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. NC) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Over Expression, Knockdown, Quantitative RT-PCR, Western Blot, Control, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: MiR‐942‐5p targeted KNG1 and regulated the expression of KNG1 . (A) KNG1‐3’‐UTR was predicted to contain binding sites of miR‐942‐5p by TargetScan. (B, C) Luciferase reporter assay validated that miR‐942‐5p targeted KNG1 in LN‐229 and T98G cells ( ‡‡‡ p < 0.001 vs. mimics control+KNG1‐3’‐UTR, ††† P < 0.001 vs. mimics + KNG1‐3’‐UTR mut). (D, E) The expression of miR‐942‐5p in LN‐229 and T98G cells after transfection was detected by RT‐qPCR, with U6 serving as an internal control. (F–I) The expression of KNG1 in LN‐229 and T98G cells after transfection was detected by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (*** p < 0.001 vs. inhibitor control; ^^^ p < 0.001 vs. siNC + inhibitor; ### p < 0.001 vs. mimic control; △△△ p < 0.001 vs. NC + mimic) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Expressing, Binding Assay, Luciferase, Reporter Assay, Control, Transfection, Quantitative RT-PCR, Western Blot, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: KNG1 reversed the promoting effect of miR‐942‐5p mimic on the migration, invasion, and proliferation of LN‐229 and T98G cells, and siKNG1 offset the inhibitory effect of miR‐942‐5p inhibitor on the migration and invasion of both cells. (A, B) The migration of LN‐229 and T98G cells after transfection was detected by wound healing assays. (C, D) The invasion of LN‐229 and T98G cells after transfection was detected by Transwell assays. (E, F) The proliferation of LN‐229 and T98G cells after transfection was detected by colony formation assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. inhibitor control; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. siNC + inhibitor; ## p < 0.01, ### p < 0.001 vs. mimic control; △△ p < 0.01, △△△ p < 0.001 vs. NC + mimic) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Migration, Transfection, Control, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 overexpression and knockdown reversed the regulatory effects of miR‐942‐5p mimic and inhibitor on the migration and invasion of LN‐229 and T98G cells, respectively. (A, B) The migration of LN‐229 and T98G cells after transfection was determined by wound healing assays. (C, D) The invasion of LN‐229 and T98G cells after transfection was detected by Transwell assays (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor). (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Over Expression, Knockdown, Migration, Transfection, shRNA, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 overexpression and knockdown diminished the effects of miR‐942‐5p mimic and inhibitor on cell cycle distribution and related gene expressions in LN‐229 and T98G cells, respectively. (A–D) The expressions of SNAIL1, Vimentin, ZO1, and E‐Cadherin in LN‐229 and T98G cells after transfection were quantified by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (E, F) The cell cycle distribution of LN‐229 and T98G cells after transfection were detected by flow cytometry (* p < 0.05, ** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △ p < 0.05, △△△ p < 0.001 vs. shRNA NC; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Over Expression, Knockdown, Transfection, Western Blot, Quantitative RT-PCR, Control, Flow Cytometry, shRNA, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 overexpression and knockdown reversed the effects of miR‐942‐5p mimic and inhibitor on the proliferation of LN‐229 and T98G cells, respectively. (A, B) The proliferation of LN‐229 and T98G cells after transfection was tested by colony formation assays. (C, D) The expressions of CDC25A, cyclin D1, and CDKN2A in LN‐229 and T98G cells after transfection were measured by Western blot, with GAPDH serving as an internal control (** p < 0.01, *** p < 0.001 vs. NC; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. LINC01018 + mimic; △ p < 0.05, △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^ p < 0.05, ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Over Expression, Knockdown, Transfection, Western Blot, Control, shRNA, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate tumor growth in vivo. (A, B) The picture of a solid tumor was exhibited and the tumor weight was calculated. (C, D) The expression of LINC01018 in tumor tissues was measured by RT‐qPCR, with GAPDH serving as an internal control. (E, F) The expression of miR‐942‐5p in tumor tissues was detected by RT‐qPCR, with U6 serving as an internal control (** p < 0.01, *** p < 0.001 vs. NC; ### p < 0.001 vs. LINC01018 + mimic; △△ p < 0.01, △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: In Vivo, Expressing, Quantitative RT-PCR, Control, shRNA, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate the expression of KNG1 in vivo. (A, B) The expression of KNG1 in tumor tissues was quantitated by Western blot and RT‐qPCR, with GAPDH serving as an internal control. (C, D) The expression of KNG1 in tumor tissues was determined by immunohistochemical analysis. (*** p < 0.001 vs. NC; ### p < 0.001 vs. LINC01018 + mimic; △△△ p < 0.001 vs. shRNA NC; ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor). (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Expressing, In Vivo, Western Blot, Quantitative RT-PCR, Control, Immunohistochemical staining, shRNA, Negative Control
Journal: CNS Neuroscience & Therapeutics
Article Title: LncRNA LINC01018 / miR ‐942‐5p/ KNG1 axis regulates the malignant development of glioma in vitro and in vivo
doi: 10.1111/cns.14053
Figure Lengend Snippet: LINC01018 targeted miR‐942‐5p to regulate the microvessel density (MVD). (A, B) The effect of LINC01018/ miR‐942‐5p axis on MVD was analyzed by immunohistochemistry (*** p < 0.001 vs. NC; # p < 0.05, ### P < 0.001 vs. LINC01018 + mimic; △△△ p < 0.001 vs. shRNA NC; ^^ p < 0.01, ^^^ p < 0.001 vs. shRNA LINC01018 + inhibitor) (NC: negative control)
Article Snippet: ShRNA for LINC01018 (5’‐TCCCAAAGAGGTTACAATCATTA‐3′), shRNA NC (5’‐AATTCTCCGAACGTGTCACGT‐3′),
Techniques: Immunohistochemistry, shRNA, Negative Control