Journal: Acta Pharmaceutica Sinica. B

Article Title: Deficiency of anti-inflammatory cytokine IL-4 leads to neural hyperexcitability and aggravates cerebral ischemia–reperfusion injury

doi: 10.1016/j.apsb.2020.05.002

Figure Lengend Snippet: Upregulation of Nav1.1 and downregulations of KCa3.1 and α 6 subunit of GABA A receptors in the cortex from Il-4 −/− mice and supplemental IL-4 increases KCa3.1 and α 6 mRNA expressions. Upregulation of Nav1.1 mRNA expression and downregulations of KCa3.1 and α 6 subunit of GABA A receptors mRNA expression, in cortical tissues (A) and cortical neurons (B) from Il-4 −/− mice. (C) Nav1.1 protein expression in primary mouse cortical neurons by immunostaining and upregulation of Nav1.1 protein in Il-4 −/− mice ( n = 6 mice). (D) The image staining with KCa3.1 antibody (green), NeuN antibody (red, a neuronal-specific nucleus marker) and DAPI (blue, a nucleus marker). Downregulation of KCa3.1 protein in Il-4 −/− mice ( n = 4 mice, Mann Whitney test). (E) Downregulation of α 6 subunit of GABA A protein in Il-4 −/− mice ( n = 4 mice). Increased mRNA expressions of KCa3.1 and α 6 subunit in Il-4 −/− (F) and Il-4 +/+ (G) cortical neurons after supplementing IL-4 (20 ng/mL) in culture for 7 days. Data are expressed as the mean ± SEM, ∗ P < 0.05, ∗∗ P < 0.01 and ∗∗∗ P < 0.001 compared with their controls. The numbers at the bottom of the bars indicate the number of repeats or mice in the group.

Article Snippet: After blocking by 5% milk, PVDF membranes were incubated with primary antibodies at 4 °C overnight such as rat anti-IL-4 antibody (1:500, Abcam, ab11524), mouse monoclonal anti-KCa3.1 antibody (1:250, Alomone, ALM-051), rabbit anti-Nav1.1 antibody (1:250, Alomone, ASC-001), rabbit GABA A R α 6 Polyclonal Antibody (1:200, Alomone, AGA-004), mouse anti- β -actin antibody (1:5000, Abcam) and mouse anti-GAPDH antibody (1:5000, Abcam).

Techniques: Expressing, Immunostaining, Staining, Marker, MANN-WHITNEY

Journal: Acta Pharmaceutica Sinica. B

Article Title: Deficiency of anti-inflammatory cytokine IL-4 leads to neural hyperexcitability and aggravates cerebral ischemia–reperfusion injury

doi: 10.1016/j.apsb.2020.05.002

Figure Lengend Snippet: A proposed molecular mechanism underlying increased neural excitabilities and susceptibility to ischemic injury caused by IL-4 deficiency. IL-4 binding to IL-4R actives IL-4 pathway. IL-4 deficiency alters gene transcriptions by downregulating the Kcnn4 gene encoding KCa3.1 protein and Gabra6 gene encoding GABA A receptor chloride channel and upregulating the Scna1 gene encoding Nav1.1 protein through IL-4 signaling pathways. Downregulation of KCa3.1 channels and tonic GABA A receptors can reduce potassium outflow and chloride inflow in neurons, leading to enhanced neuronal firings through membrane depolarization. The upregulation of Nav1.1 channels can increase sodium inflow in neurons. All these alterations can enhance neuronal hyperexcitability and glutamate release from excitatory axon terminals, ultimately increasing susceptibility to ischemic injury. Conversely, enhancement of IL-4 signaling through supplemental IL-4 can increase KCa3.1 and α 6 subunit of GABA A receptors in cortical neurons and reverse neuronal hyperexcitability, thus exerting neuroprotection against ischemic injury.

Article Snippet: After blocking by 5% milk, PVDF membranes were incubated with primary antibodies at 4 °C overnight such as rat anti-IL-4 antibody (1:500, Abcam, ab11524), mouse monoclonal anti-KCa3.1 antibody (1:250, Alomone, ALM-051), rabbit anti-Nav1.1 antibody (1:250, Alomone, ASC-001), rabbit GABA A R α 6 Polyclonal Antibody (1:200, Alomone, AGA-004), mouse anti- β -actin antibody (1:5000, Abcam) and mouse anti-GAPDH antibody (1:5000, Abcam).

Techniques: Binding Assay

Journal: Cell Biology and Toxicology

Article Title: AP-1 activates KCNN4-mediated Ca2 + signaling to induce the Th1/Th17 differentiation of CD4 + cells in chronic non-bacterial prostatitis

doi: 10.1007/s10565-024-09967-1

Figure Lengend Snippet: KCNN4 is a downstream target of AP-1 in CD4 + T cells. ( a ) Expression of KCNN4 in prostate CD4 + T cells detected by transcriptome sequencing was examined using control and CNP rats. ( b ) DNA binding matrix of the transcription factor AP-1. ( c ) The binding site for AP-1 on the KCNN4 promoter fragment was predicted in Jaspar. ( d ) Effects of T + E treatment and combined use of the AP-1 inhibitor SR11302 on KCNN4 expression in CD4 + T cells were analyzed using RT-qPCR. ( e ) The binding ability of AP-1(FOS, JUN) to the KCNN4 promoter fragment in CD4 + T cells was detected by ChIP-qPCR. ( f ) The effects of T + E treatment and combined use of the AP-1 inhibitor SR11302 on the transcriptional activity of the KCNN4 promoter in CD4 + T cells were examined using reporter assay. Experiments were performed at least in triplicate. Data are shown as mean ± SEM, n = 5, Unpaired t-test or one-way ANOVA

Article Snippet: The primary antibodies used included KCNN4 (1:2000, A1974, ABclonal, Wuhan, Hubei, China), GAPDH (1:2000, A19056, Abclonal), mechanistic target of rapamycin (mTOR, 1:1000, A24743, Abclonal), Phospho (p)-mTOR (S2481) (1:1000, AP0490, Abclonal), Beclin1 (1:2000, ab207612, Abcam, Cambridge, UK), and LC3B (1:2000, ab192890, Abcam).

Techniques: Expressing, Sequencing, Control, Binding Assay, Quantitative RT-PCR, ChIP-qPCR, Activity Assay, Reporter Assay

Journal: Cell Biology and Toxicology

Article Title: AP-1 activates KCNN4-mediated Ca2 + signaling to induce the Th1/Th17 differentiation of CD4 + cells in chronic non-bacterial prostatitis

doi: 10.1007/s10565-024-09967-1

Figure Lengend Snippet: AP-1/KCNN4 promotes Th1/Th17 differentiation in a Ca2 + signaling-dependent manner. ( a ) The effects of T + E treatment and the combined use of the AP-1 inhibitor SR11302 on Ca2 + concentration in CD4 + T cells were analyzed using Fluo-4-AM fluorescent staining. Overexpression efficiency of Vector-KCNN4 detected by RT-qPCR ( b ) and western blot analysis ( c ). ( d ) Effect of overexpression of KCNN4 on intracellular Ca2 + concentration detected by Fluo-4-AM fluorescence staining. ( e ) The effect of overexpression of KCNN4 on Th1/Th17 differentiation of CD4 + T cells was flow cytometry. ( f ) The effect of overexpression of KCNN4 on intracellular Ca2 + concentration in the presence of the calcium chelator BAPTA-AM was analyzed using Fluo-4-AM fluorescence staining. ( g ) The effect of overexpression of KCNN4 on Th1/Th17 differentiation of CD4 + T cells in the presence of the calcium chelator BAPTA-AM was analyzed using flow cytometry. Experiments were performed at least in triplicate. Data are shown as mean ± SEM, Unpaired t-test, or one-way ANOVA

Article Snippet: The primary antibodies used included KCNN4 (1:2000, A1974, ABclonal, Wuhan, Hubei, China), GAPDH (1:2000, A19056, Abclonal), mechanistic target of rapamycin (mTOR, 1:1000, A24743, Abclonal), Phospho (p)-mTOR (S2481) (1:1000, AP0490, Abclonal), Beclin1 (1:2000, ab207612, Abcam, Cambridge, UK), and LC3B (1:2000, ab192890, Abcam).

Techniques: Concentration Assay, Staining, Over Expression, Plasmid Preparation, Quantitative RT-PCR, Western Blot, Fluorescence, Flow Cytometry

Journal: Cell Biology and Toxicology

Article Title: AP-1 activates KCNN4-mediated Ca2 + signaling to induce the Th1/Th17 differentiation of CD4 + cells in chronic non-bacterial prostatitis

doi: 10.1007/s10565-024-09967-1

Figure Lengend Snippet: Activation of autophagy inhibits Th1/Th17 differentiation. ( a ) Effects of T + E treatment and the combination of the AP-1 inhibitor SR11302 on the activity of mTOR and the expression of autophagy-related proteins in CD4 + T cells were analyzed using western blot. ( b ) Effects of overexpression of KCNN4 and combined use of the calcium chelator BAPTA-AM on the activity of mTOR and the expression of autophagy-related proteins in cells were analyzed using western blot. ( c ) The effect of rapamycin on AP-1 activity was analyzed using an AP-1 luciferase reporter assay. ( d ) Effect of rapamycin on the activity of mTOR and the expression of KCNN4 and autophagy-related proteins in CD4 + T cells detected by western blot. ( e ) Effect of rapamycin on Th1/Th17 differentiation of CD4 + T cells detected using flow cytometry. Experiments were performed at least in triplicate. Data are shown as mean ± SEM, Unpaired t-test, or one-way ANOVA

Article Snippet: The primary antibodies used included KCNN4 (1:2000, A1974, ABclonal, Wuhan, Hubei, China), GAPDH (1:2000, A19056, Abclonal), mechanistic target of rapamycin (mTOR, 1:1000, A24743, Abclonal), Phospho (p)-mTOR (S2481) (1:1000, AP0490, Abclonal), Beclin1 (1:2000, ab207612, Abcam, Cambridge, UK), and LC3B (1:2000, ab192890, Abcam).

Techniques: Activation Assay, Activity Assay, Expressing, Western Blot, Over Expression, Luciferase, Reporter Assay, Flow Cytometry

Journal: Cell Biology and Toxicology

Article Title: AP-1 activates KCNN4-mediated Ca2 + signaling to induce the Th1/Th17 differentiation of CD4 + cells in chronic non-bacterial prostatitis

doi: 10.1007/s10565-024-09967-1

Figure Lengend Snippet: CD4 + T cell Th1/Th17 differentiation blocked by autophagy activation slows CNP progression. ( a ) Effect of AAV-KCNN4 as well as rapamycin treatment on body weight, prostate weight, and prostate index in CNP rats. ( b ) Effects of AAV-KCNN4 and rapamycin treatment on the expression of KCNN4, mTOR, and autophagy-related proteins in prostate CD4 + T cells from rats with CNP detected by western blot. ( c ) Effects of AAV-KCNN4 and rapamycin treatment on Th1/Th17 differentiation of prostate CD4 + T cells in CNP rats. ( d ) Effects of AAV-KCNN4 and rapamycin treatment on the reduction of inflammatory infiltrates (red arrowheads), PIN (black arrowheads), and adenocarcinoma (red arrowheads) in the prostate of CNP rats. + Data are shown as mean ± SEM, n = 5

Article Snippet: The primary antibodies used included KCNN4 (1:2000, A1974, ABclonal, Wuhan, Hubei, China), GAPDH (1:2000, A19056, Abclonal), mechanistic target of rapamycin (mTOR, 1:1000, A24743, Abclonal), Phospho (p)-mTOR (S2481) (1:1000, AP0490, Abclonal), Beclin1 (1:2000, ab207612, Abcam, Cambridge, UK), and LC3B (1:2000, ab192890, Abcam).

Techniques: Activation Assay, Expressing, Western Blot

Journal: Cell Biology and Toxicology

Article Title: AP-1 activates KCNN4-mediated Ca2 + signaling to induce the Th1/Th17 differentiation of CD4 + cells in chronic non-bacterial prostatitis

doi: 10.1007/s10565-024-09967-1

Figure Lengend Snippet: Schematic diagram. Aberrant AP-1 activity in CD4 + T cells promotes the transcription of KCNN4, which inhibits autophagy by enhancing Ca2 + signaling to activate mTORC1 activity in the cells. This leads to Th1/Th17 differentiation of CD4 + T cells and the progression of CNP to PIN and adenocarcinoma

Article Snippet: The primary antibodies used included KCNN4 (1:2000, A1974, ABclonal, Wuhan, Hubei, China), GAPDH (1:2000, A19056, Abclonal), mechanistic target of rapamycin (mTOR, 1:1000, A24743, Abclonal), Phospho (p)-mTOR (S2481) (1:1000, AP0490, Abclonal), Beclin1 (1:2000, ab207612, Abcam, Cambridge, UK), and LC3B (1:2000, ab192890, Abcam).

Techniques: Activity Assay

Journal:

Article Title:

doi:

Figure Lengend Snippet: Up-regulation of KCa3.1 in the brains of SAMP8 mice. (A) Western blot analysis of KCa3.1 protein expression in the cortex of 3-, 7- and 12-month-old SAMR1 and SAMP8 mice. β-actin was used as the loading control. (B) The quantification of KCa3.1 protein expression in SAMR1 and SAMP8 mice (n = 3 each group). *p < 0.05, **p < 0.01, SAMP8 mice versus age-matched SAMR1 mice. (C) Quantitative real-time PCR analysis of KCa3.1 gene expression in 7-month-old SAMR1 and SAMP8 mice cortex. Values are shown for steady-state transcripts relative to β-actin in the same preparation. Results are expressed as mean ± SEM (n = 4). **p < 0.01, versus SAMR1 mice.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Western Blot, Expressing, Real-time Polymerase Chain Reaction

Journal:

Article Title:

doi:

Figure Lengend Snippet: Up-regulation of KCa3.1 in reactive astrocytes and neurons of SAMP8 mouse brains. Double immunofluorescence staining of KCa3.1 (green) with GFAP (red), NeuN (red) or Iba1 (red) in brain sections of 7-month-old SAMR1 and SAMP8 mice. (A) Co-staining of KCa3.1 and GFAP in SAMR1 and SAMP8 mice; (B) Co-staining of KCa3.1 and NeuN in SAMR1 and SAMP8 mice; (C) Co-staining of KCa3.1 and Iba1 in SAMR1 and SAMP8 mice. Arrows indicate co-labeling of KCa3.1 and GFAP (A), KCa3.1 and NeuN (B) and KCa3.1 and Iba1 (C), views of which are enlarged in the adjacent panels. Nuclei were stained in blue with DAPI. Scale bar: 25 μm in A; Scale bar: 50 μm in B; Scale bar: 25 μm in C.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Double Immunofluorescence Staining, Staining, Labeling

Journal:

Article Title:

doi:

Figure Lengend Snippet: Up-regulation of KCa3.1 in reactive glial cells and neurons of Alzheimer’s patient brains. Double immunofluorescence staining of KCa3.1 (green) with GFAP (red), NeuN (red) or Iba1 (red) in brain sections of control and AD patients. (A) Co-staining of KCa3.1 and GFAP in control human and AD patients; (B) Co-staining of KCa3.1 and NeuN in control human and AD patients; (C) Co-staining of KCa3.1 and Iba1 in control human and AD patients. Arrows indicate co-labeling of KCa3.1 and GFAP (A), the co-labeling of KCa3.1 and NeuN (B) and the co-labeling of KCa3.1 and Iba1 (C). Nuclei were stained in blue with DAPI. Scale bar: 25 μm.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Double Immunofluorescence Staining, Staining, Labeling

Journal:

Article Title:

doi:

Figure Lengend Snippet: Blockade of KCa3.1 rescued memory deficits in SAMP8 mice using Morris water maze test. Seven-month-old SAMP8 mice (n = 8–10 per group) were treated with vehicle or TRAM-34 (60 or 120 mg/kg, intraperitoneal) daily for 4 weeks with the age-matched vehicle treated SAMR1 mice as normal controls, and three-month-old SAMP8 mice as negative controls. (A) Average daily escape latency; (B) Percentage of time spent in the target quadrant where the escape platform was located. Data represent mean ± SEM. ##p < 0.01, versus SAMR1 mice. *p < 0.05, **p < 0.01, versus vehicle-treated SAMP8 mice.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques:

Journal:

Article Title:

doi:

Figure Lengend Snippet: Blockade of KCa3.1 attenuated the activation of astrocytes and microglia in SAMP8 mice. Seven-month-old SAMP8 mice (n = 6–8 per group) were treated with vehicle or TRAM-34 (60 or 120 mg/kg, intraperitoneal) daily for 4 weeks with age-matched vehicle treated SAMR1 mice as normal controls. Brain sections were immunostained with anti-GFAP and anti-Iba-1 antibodies. (A) Representative images of GFAP-immunoreactive astrocytes from the hippocampal regions of SAMR1, SAMP8 or SAMP8 + TRAM-34 (120 mg/kg) groups. Scale bar: 50 μm. (B) Quantification of reactive astrocyte number/0.01 mm2 in the hippocampus (n = 6–8). Data represent mean ± SEM. ##p < 0.01, versus SAMR1 mice. **p < 0.01, versus vehicle-treated SAMP8 mice. (C) Iba-1 immunoreactivity demonstrated active microglia from the hippocampal regions of SAMR1, SAMP8, and SAMP8 + TRAM-34 (120 mg/kg) groups. Scale bar: 25 μm. (D) Quantification of activated microglia number/0.01 mm2 in the hippocampus (n = 6–8). (E) NeuN immunoreactivity demonstrated neurons in the hippocampal regions of SAMR1, SAMP8, and SAMP8 + TRAM-34 (120 mg/kg) groups. Scale bar: 25 μm. (F) Quantification of neuron number/0.01 mm2 in the hippocampus (n = 6–8). Data represent mean ± SEM. ##p < 0.01, versus SAMR1 mice. **p < 0.01, versus vehicle-treated SAMP8 mice.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Activation Assay

Journal:

Article Title:

doi:

Figure Lengend Snippet: KCa3.1 deletion rescued memory deficits after hippocampal injection of Aβ oligomers. (A) Escape latency; (B) Percentage of time spent in the target quadrant where the escape platform had been located for groups of WT (n = 8–10) and KCa3.1−/− (n = 8–10) mice after intrahippocampal injection of Aβ oligomers. Data represent mean ± SEM. #p < 0.05, ##p < 0.01, versus vehicle treated WT mice. *p < 0.05 versus vehicle treated KCa3.1−/− mice. WT, wild type; KO, knockout.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Injection, Knock-Out

Journal:

Article Title:

doi:

Figure Lengend Snippet: KCa3.1 deletion attenuated gliosis in response to hippocampal injection of Aβ oligomers. (A) Representative images of GFAP-immunoreactive astrocytes from the hippocampal regions of WT or KCa3.1 KO mice at 14 days after Aβ oligomer injection. Scale bar: 50 μm. (B) Quantification of reactive astrocyte number/0.01 mm2 in the hippocampus (n = 6–8). (C) Iba-1 immunoreactivity demonstrated active microglia from the hippocampal regions of WT or KCa3.1 KO mice at 14 days after Aβ oligomer intrahippocampus injection. Scale bar: 25 μm. (D) Quantification of activated microglia number/0.01 mm2 in the hippocampus (n = 6–8). (E) NeuN immunoreactivity demonstrated neurons from the hippocampal regions of WT or KCa3.1 KO mice at 14 days after Aβ oligomer injection. Scale bar: 25 μm. (F) Quantification of activated microglia number/0.01 mm2 in the hippocampus (n = 6–8). Data represent mean ± SEM. **p < 0.01, versus vehicle or Aβ oligomers injected WT mice (n = 6–8). WT, wild type; KO, knockout.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Injection, Knock-Out

Journal:

Article Title:

doi:

Figure Lengend Snippet: Involvement of KCa3.1 in Aβ oligomer induced reactive astrogliosis. (A) Representative western blot showing stimulation with 1 μM Aβ oligomer increased KCa3.1 and GFAP protein expression in cultured astrocytes in a time-dependent fashion. Quantification of western blot for KCa3.1 and GFAP expression in astrocytes after Aβ oligomer treatment (n = 3). Con: control. Data are presented as mean ± SEM. *p < 0.05 versus control. (B) Representative immunocytochemistry showing stimulation with 1 μM Aβ oligomer for 3 days increased KCa3.1 and GFAP protein expression in cultured astrocytes. (C) Representative western blot showing GFAP expression in cultured astrocytes treated with 1 μM Aβ oligomer for 3 days in the presence of TRAM-34 (1, 10 μM). Quantification of western blot for GFAP expression (n = 3). Con: control. Data are presented as mean ± SEM. ##p < 0.01 versus control, *p < 0.05, ***p < 0.001 versus Aβ oligomer alone. (D) Western blot showing the absence of KCa3.1 expression in the astrocytes of KCa3.1 KO mice. (E) Representative western blot and quantification of GFAP expression after Aβ oligomer treatment in WT and KCa3.1 KO astrocytes (n = 3–4). **p < 0.01 versus WT. WT, wild type; KO, knockout.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Western Blot, Expressing, Cell Culture, Immunocytochemistry, Knock-Out

Journal:

Article Title:

doi:

Figure Lengend Snippet: Involvement of KCa3.1 in Aβ oligomer-induced intracellular calcium increase in astrocytes. Astrocytes were loaded with the Ca2+-sensitive dye Fluo-4 AM at 37 ˚C for 30 min and changes in [Ca2+]i were monitored by confocal microscopy. 5 μM Aβ oligomer was added to astrocytes at 30 s with or without pre-treated TRAM-34 (1 μM) (A). Summary of data showing intracellular Ca2+ (B) at 1 s, 180 s (peak of fluorescence) and 1000 s. *p < 0.05 versus Aβ oligomer-stimulated cells.5 μM Aβ oligomer was added to WT and KCa3.1 KO astrocytes at 30 s (C). Summary of data showing intracellular Ca2+ (D) at 1 s, 150 s (peak of fluorescence) and 1000 s. Signal acquisition lasted for 1000 s. Data are presented as means ± SEM (n = 20 cells). **p < 0.01 versus WT cells. WT, wild type; KO, knockout.

Article Snippet: The following primary antibodies were used: anti-KCa3.1 (1:500; Alomone Labs), anti-GFAP (1:2000; Z0334, Dako), and anti-βactin (1:3000; Sigma).

Techniques: Confocal Microscopy, Fluorescence, Knock-Out

Journal:

Article Title:

doi:

Figure Lengend Snippet: Decreased membrane CaM in HNSCC T cells. (A) Representative confocal images of HD and HNSCC T cells stained for CD8 (green; no permeabilization) and CaM (magenta, after permeabilization). Scale bars indicate 10 μm. Representative individual cells highlighted (box) in the merged images are magnified in the extreme right panels. Co-localization is indicated by white color. (B, C) Fluorescence intensities of CaM in the membrane (B) and cytoplasm (C) of HD and HNSCC T cells were measured as described in Materials and Methods . Data represented by a box and whisker plot. The horizontal line represents median value of CaM fluorescence intensities for each group, while the first and third quartiles are represented in the top and bottom boxes respectively. (D) Ratio of CaM fluorescence at the cell membrane and cytoplasm of HD and HNSCC T cells. Bars represent mean ± SEM (E) Representative confocal images of HD and HNSCC T cells stained for KCa3.1 (green). Scale bars indicate 10 μm. (F) Fluorescence intensities of KCa3.1 in the membranes of HD and HNSCC T cells. Bars represent mean ± SEM of 117 cells from 3 HD and 61 cells from 3 HNSCC patients. Shown in (B–D) are values for 96 cells from 3 HD and 110 cells from 3 HNSCC patients. Data in (B–D, F) were analyzed by Mann Whitney rank sum test.

Article Snippet: Cells were then stained overnight at 4°C with either Alexa 488-conjugated mouse anti-human CD8 antibody (Clone SPM548, Novus Biologicals) or biotin-conjugated mouse anti-human KCa3.1 antibody (Clone 6C1, Alomone labs) diluted in blocking solution.

Techniques: Staining, Fluorescence, Whisker Assay, MANN-WHITNEY

Journal:

Article Title:

doi:

Figure Lengend Snippet: Reduced association of KCa3.1 with CaM in HNSCC T cells (A) Linescan analysis of KCa3.1 and CaM association at the cell membrane. (Left) Magnified representative confocal images of HD and HNSCC T cells stained for KCa3.1 (green) and CaM (magenta) from the merged images in Figure S4 (box). Lines were drawn across the cells for linescan analysis, and representative lines drawn for a linescan are shown. (Right) Line scan analyses were generated using ImageJ software and are plotted as KCa3.1 (green line) and CaM (magenta line) fluorescence intensity (y-axis) vs. the length of the lines drawn across the merged cells (distance from the starting point of the line, μm, x-axis). Shown here are linescan graphs from three representative HD and HNSCC T cells, wherein the outmost KCa3.1 (green) peaks correspond to the cell membrane. Correspondence of the peaks for green (KCa3.1) and magenta (CaM) lines is indicative of their colocalization. (B) Comparison of KCa3.1 membrane expression in HD and HNSCC T cells. KCa.31 fluorescence intensities were measured at the cell surface (points corresponding to KCa3.1 fluorescence peaks on the cell membrane) in linescan plots (A) . The data were normalized to mean KCa3.1 fluorescence intensity measured in HD T cells. (C) Comparison of CaM membrane-associated expression in HD and HNSCC T cells. CaM fluorescence intensities were measured at the cell surface (points corresponding to KCa3.1 fluorescence peaks on the cell membrane) in linescan plots (A) . The data were normalized to mean KCa3.1 fluorescence intensity measured in HD T cells, which represents the proportion of CaM associated with membrane KCa3.1. For (B, C) , bars represent mean ± SEM for data from 108 points (corresponding to KCa3.1 fluorescence peaks in the linescans) analyzed in 18 cells from 3 HD, and 120 points analyzed in 20 cells from 3 HNSCC patients. (D) Interaction between KCa3.1 and CaM in cell membranes of HD and HNSCC T cells. Confocal images of representative cells from PLA experiments performed in HD (top) and HNSCC (bottom). Cells were incubated with rabbit anti-human CaM and mouse anti-human KCa3.1 antibodies, after which PLA probe–ligated secondary antibodies were then added and PLA was performed as described in Materials and Methods . Positive PLA signals showing single protein interactions between KCa3.1 and CaM are visualized as magenta fluorescent dots. Cell membranes are labeled with CD8 antibodies (green) and nuclei are labeled with DAPI (blue). Scale bar, 10 μm. (E) 3D views of the PLA dots (red) in relation to the nucleus (DAPI, cyan) and membrane (CD8, green) in a representative HD (left) and HNSCC (right) T cell. (F) Average PLA signals. PLA signals in the cell membranes of in HD and HNSCC T cells were quantified as number of dots per cell membrane and are represented as a box plot. The dots per cell membrane are reported as median (horizontal line), first (top box), and third quartiles (bottom box). Shown are values for 185 cells from 3 HD and 214 cells from 4 HNSCC patients. For (B, C) , significance was determined by Mann Whitney rank sum test, while the significance for (F) was determined by Student's t-test.

Article Snippet: Cells were then stained overnight at 4°C with either Alexa 488-conjugated mouse anti-human CD8 antibody (Clone SPM548, Novus Biologicals) or biotin-conjugated mouse anti-human KCa3.1 antibody (Clone 6C1, Alomone labs) diluted in blocking solution.

Techniques: Staining, Generated, Software, Fluorescence, Expressing, Incubation, Labeling, MANN-WHITNEY

Journal:

Article Title:

doi:

Figure Lengend Snippet: Increased KCa3.1 activity in HNSCC T cells by intracellular delivery of CaM. (A) Representative KCa3.1 currents recorded in whole-cell voltage-clamp configuration in activated T cells from a HNSCC patient and a HD in the presence or absence of 50 μM CAM. The KCa3.1 currents are normalized for the maximum current at +50 mV to ease comparison of the KCa3.1 conductance at hyperpolarizing voltages. (B) KCa3.1 conductance, G (Panel C ) and Kv1.3 peak currents measured in the presence or absence of 50 μM CaM in T cells from HNSCC patients (n = 20 cells without CaM and n = 21 cells with CaM from 4 patients) and HD (n = 20 cells from three individuals). (D) KCa3.1 G measured in the presence 1 μM, 3 μM, and 10 μM free Ca 2+ in the patch pipette in activated HNSCC T cells (n = 18 cells for each conditions from three patients). The values in panels B, C, and D are presented as box and whisker plots. The data are reported as the median (horizontal line), first (top box), and third quartiles (bottom box). The KCa3.1 G or Kv1.3 peak currents were measured in at least five cells for each condition in an individual. Data in (B, C) were analyzed by two-way ANOVA [ (B) : p < 0.001 for HD vs HNSCC and p = 0.046 for + CaM vs. –CaM; (C) : p = 0.359 for HD vs. HNSCC and p = 0.673 for + CaM vs. –CaM], while data in (D) were analyzed by one-way repeated measures ANOVA (p = 0.796).

Article Snippet: Cells were then stained overnight at 4°C with either Alexa 488-conjugated mouse anti-human CD8 antibody (Clone SPM548, Novus Biologicals) or biotin-conjugated mouse anti-human KCa3.1 antibody (Clone 6C1, Alomone labs) diluted in blocking solution.

Techniques: Activity Assay, Transferring, Whisker Assay

Journal:

Article Title:

doi:

Figure Lengend Snippet: Reduction of KCa3.1 activity and increased adenosine sensitivity in HD T cells by CALM1 knockdown. ( A , left) Representative flow cytometry overlay histogram showing CaM expression in activated T cells from one HD transfected with scr-RNA and si CALM1 . (Right) gMFI for CAM expression in T cells from nine HD transfected with scr-RNA and si CALM1 . Transfected cells were identified by positive staining for GFP. (B, C) KCa3.1 conductance (B) and Kv1.3 peak currents (C) in T cells transfected with either si CALM1 (n = 10 cells) or scr-RNA (n = 10 cells) from two HDs. Transfected cells were identified by positive staining for GFP. Horizontal red line represents mean values for each group. (D) Trajectories of T cells co-transfected with GFP and either scr-RNA or si CALM1 migrating along either a CXCL12 gradient (green triangles) or a combination gradient of CXCL12 and adenosine (blue triangles) in a representative HD. Trajectories of GFP positive cells (indicating successful transfection) are shown for each condition. The starting point for each trajectory is artificially set to the same origin. The red triangles represent Y-COM. (E) Y-COM values for cells migrating along either a CXCL12 gradient or a combination gradient of CXCL12 with adenosine in HD T cells transfected with scr-RNA (n = 8 donors) and si CALM1 (n = 8 donors). (F) (Left) Representative flow cytometry plots gated on CD3 + T cells transfected with either scr-RNA or si CALM1 showing IFNγ production after stimulation. Live cell population was identified by exclusion from Zombie Aqua live/dead stain and gated on CD3 + population and transfected cells were identified by positive staining for GFP. IFNγ + T cell populations were selected by drawing rectangle gates. The numbers next to the gates are the percentages of IFNγ + CD3 + T GFP + cells. (Right) Quantification of IFNγ induction in scr-RNA or siCALM1 transfected CD3 + T cells post 48 h activation in three HDs. Bars represent mean ± SEM. All data were analyzed by paired Student's t-test.

Article Snippet: Cells were then stained overnight at 4°C with either Alexa 488-conjugated mouse anti-human CD8 antibody (Clone SPM548, Novus Biologicals) or biotin-conjugated mouse anti-human KCa3.1 antibody (Clone 6C1, Alomone labs) diluted in blocking solution.

Techniques: Activity Assay, Flow Cytometry, Expressing, Transfection, Staining, Activation Assay

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a Structure of TRAM-34 (left) and synthesis of mitoTRAM-34 (right). Reagents and conditions: (i) LiAlH 4 , THF, Et 2 O, room temperature for 3.5 h, 94% yield; (ii) (1) NaH, DMF, 0 °C for 1 h; (2) benzyl bromide, room temperature for 3.5 h, 94% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 80% yield; (iv) acetyl chloride, toluene, reflux for 45 min; (v) pyrazole, CH 3 CN, reflux overnight, 83% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 75 min, 90% yield; (vii) LiCl, 2,4,6-trimethylpyridine, methanesulfonyl chloride, DMF, room temperature for 15 h, 89% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 81% yield. b Synthesis of rev -mitoTRAM. Reagents and conditions: (i) DMAP, 3-chloropropylamine hydrochloride, DCM, THF, room temperature for 3.5 h, 88% yield; (ii) K 2 CO 3 , benzyl bromide, acetone, 70 °C for 15 h, 92% yield; (iii) (1) n-butyllithium, THF, −70 °C for 1 h; (2) 2-chlorobenzophenone, from −70 °C to room temperature overnight, 50% yield; (iv) acetyl chloride, toluene, 100 °C for 1.5 h; (v) pyrazole, CH 3 CN, 100 °C for 17 h, 68% yield; (vi) Pd/C, H 2 , EtOAc, room temperature for 1.5 h, 87% yield; (vii) DMAP, 8, CH 3 CN, 50 °C for 20 h, 82% yield; (viii) NaI, PPh 3 , CH 3 CN, 95 °C for 6 h, 72% yield. c Levels of rev -mitoTRAM and its hydrolysis product (TRAM-34-OH) in the medium and in B16F10 cells after 2, 4, 6, 8, or 24 h of incubation with 5 µM rev -mitoTRAM. Mean ± SEM, N = 3. d MitoTRAM-34 and TRAM-34-OH block plasma membrane K Ca 3.1 currents in GL-15 cells. Left: Time-course of the current at 0 mV measured from the current ramps obtained by applying linear gradients of potential from −100 to 140 mV (Vh of 0 mV) repeated every 5 s. 0 pA current level is indicated by the dashed line. The K Ca 3.1 current was activated by DC-EBIO (1 mM) and ionomycin (500 nM) (EBIO/ionomycin), and the chamber was then perfused sequentially (in the presence of the activators) with mitoTRAM-34, TRAM-34-OH and finally with TRAM-34 (all 2 µM). Individual data points in the trace represent the current conducted by K Ca 3.1 channels following activation by EBIO/ionomycin and inhibition by the indicated drugs. Center: Representative current ramps recorded at the time points indicated on the left panel (same color code). Right: Mean residual K Ca 3.1 current recorded at 0 mV after mitoTRAM-34 and TRAM-34-OH application, expressed as % of the difference between the current recorded after full activation and after complete block of K Ca 3.1 with 3 µM TRAM-34 ( n = 5). Leak current was not subtracted.

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Reflux, Incubation, Blocking Assay, Clinical Proteomics, Membrane, Activation Assay, Inhibition

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a Representative Western Blot showing the mitochondrial localization of K Ca 3.1 in B16F10 cells. f1: whole-cell extract; f2: membrane-enriched fraction; f3: mitochondria-enriched fraction; m1 and m2: Percoll-purified mitochondrial fractions (see “Materials/subjects and methods”). Plasma membrane marker PMCA and mitochondrial membrane markers VDAC-1 and TOM-20 are also shown. b , c Images showing mitochondrial membrane potential changes ( b ) and superoxide production ( c ) in B16F10 cells, as visualized by changes in TMRM ( b ) or mitoSOX ( c ) fluorescence upon addition of mitoTRAM-34 (mitoT.), rev -mitoTRAM ( rev -m.) or TRAM-34 at the indicated time points. FCCP ( b ) and Antimycin A ( c ) were used as controls (not shown). The quantification of the fluorescence signal is shown on the right. Fluorescence is expressed as percentage of the initial intensity (mean + SEM; Two-Way Anova with Dunnett’s multiple comparison test. N = 4. * p < 0.05, ** p < 0.01, *** p < 0.001 compared to control). Scale bar is 100 µm. d Representative images (left) and analysis (right) of mitochondrial ultrastructure assessed by transmission electron microscopy (TEM) after treatment of B16F10 cells with 1.5 µM mitoTRAM (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.) for 30 min. The mitochondrial circularity and number of cristae/area were calculated with ImageJ. For each replicate, mitochondria from at least 5 cells were analyzed (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. **** p < 0.0001 compared to control). Scale bar is 1 µm. e As in ( d ), but cells were treated for 24 h with sublethal doses of mitoTRAM-34 (0.5 µM) and rev -mitoTRAM (5 µM). f Representative confocal images of B16F10 cells treated as in ( e ) showing a fragmented mitochondrial network after 24 h of treatment with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) compared to control cells. Cells were stained for mitochondrial marker TOM-20 (magenta) and DAPI (cyan). Scale bar is 5 µm.

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Western Blot, Membrane, Purification, Clinical Proteomics, Marker, Fluorescence, Comparison, Control, Transmission Assay, Electron Microscopy, Staining

Journal: Cell Death & Disease

Article Title: Pharmacological targeting of the mitochondrial calcium-dependent potassium channel KCa3.1 triggers cell death and reduces tumor growth and metastasis in vivo

doi: 10.1038/s41419-022-05463-8

Figure Lengend Snippet: a MTS assays showing the sensitivity of B16F10 cells to different doses of mitoTRAM-34 and rev -mitoTRAM (24 h). Shown are means + SEM of N = 3–5 (One Sample T Test, *** p -value < 0.001, ** p -value < 0.01, * p -value < 0.05). b Dose-response curves showing the sensitivity of the cancer cell lines B16F10, MDA-MB-231, and COLO-357 and non-tumoral cell lines from the same tissues (Melan-A, MCF-10A, and HPDE, respectively) to mitoTRAM-34, as assessed by MTS assays. The concentrations applied (µM) are plotted on a logarithmic scale. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are means + SEM and nonlinear fit curves of N = 3–5. Statistical differences between curves were analyzed with Two-Way Anova. c EC 50 values for mitoTRAM-34 treatment of different human pancreatic cancer cell lines and a non-tumoral pancreatic epithelial cell line (HPDE) of mitoTRAM-34 treatment assessed with MTS assays plotted against the expression of K Ca 3.1 in the same cells, analyzed with qRT-PCR. The correlation was analyzed with a simple linear regression. Plot of mean ± SEM EC 50 values vs. normalized expression relative to HPDE cells ( N = 3). On the right, representative images of Annexin V-FITC stainings of HPDE and COLO-357 cells treated for 24 h with 1.5 µM mitoTRAM-34. Bright field images, FITC fluorescence and merge are shown. Scale bar is 100 µm. d Quantification of Annexin V-FITC staining shown in ( e ). The fraction of Annexin V-positive cells on total cell count is shown (mean + SEM, One-Way Anova with Dunnett’s posttest. N = 3. * p < 0.05). e Representative images of an Annexin V-FITC cell death assay. B16F10 cells were treated for 24 h with mitoTRAM-34 (mitoT.) or rev -mitoTRAM ( rev -m.) at the indicated concentrations were stained with Annexin V-FITC. Bright field images, FITC fluorescence, Hoechst staining and the merged images are shown. Scale bar is 25 µm. f Sensitivity of HEK-293 cells overexpressing either K Ca 3.1 or the control protein BirA to mitoTRAM-34 or rev -mitoTRAM treatment analyzed with MTS assays. The concentration at which 50% of cells were viable (EC 50 ) is indicated by the dotted line. Shown are mean + SEM and nonlinear fit curves of N = 4. Statistical differences between curves were analyzed using Two-Way Anova. g Cell viability of WT and K Ca 3.1 KO primary breast cancer cells after 24 h of treatment with 2 µM mitoTRAM-34 (mitoT.) or 7.5 µM rev -mitoTRAM ( rev -m.), analyzed by MTS assays. For both WT and KO cells, data from 2 separate primary cultures were put together (mean + SEM, Two-Way Anova with Sidak’s multiple comparisons tests. N = 3. *** p < 0.001).

Article Snippet: The following day, they were transfected with a plasmid codifying K Ca 3.1-myc (Origene #RC204457) or BirA-myc (pcDNA3.1 mycBioID was a gift from Kyle Roux (Addgene plasmid # 35700; http://n2t.net/addgene:35700 )).

Techniques: Concentration Assay, Expressing, Quantitative RT-PCR, Fluorescence, Staining, Cell Counting, Control

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Biotinylation‐based proximity labeling and protein interaction analysis. (A) Cloning strategy for TurboID‐based proximity labeling. The BP reaction transfers the m kcnn4 gene from the pDONR221 vector to the entry clone using BP clonase. The LR reaction integrates m Kcnn4 into the destination vector, creating the final expression clone containing m Kcnn4 ‐TurboID for lentiviral expression. Lentiviral transduction and experimental setup. (B) Cells were transduced with either m Kcnn4 ‐FLAG‐TurboID‐V5 or V5‐ TurboID‐FLAG, followed by blasticidin selection. Cells were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 1 h, 3 h, or 5 h) to capture proximal proteins for further analysis. (C) Western blot analysis showing biotinylated proteins detected with α‐Streptavidin‐HRP in TurboID‐Flag and mK Ca 3.1‐Flag‐TurboID expressing cells at different time points (1 h, 3 h, 5 h). Ponceau staining was used as a loading control. (D) PCR validation of transgene integration in the different cell lines. (E) Experimental workflow for biotinylation‐based proximity labeling and protein identification. Cells expressing TurboID vectors were treated with doxycycline (1 μg/mL for 24 h) to induce expression, followed by biotin labeling (50 μM for 3 h). After cell lysis, biotinylated proteins were isolated via streptavidin pull‐down, analyzed by MS, and subjected to GO/KEGG enrichment analysis to identify functional interactions. (F) Validation of protein expression and biotinylation efficiency. Western blot analysis using α‐FLAG confirms expression of TurboID‐tagged constructs. α‐Streptavidin‐HRP detection shows biotinylated proteins upon biotin treatment, with increased biotinylation observed in K Ca 3.1‐Flag‐TurboID samples compared to controls. (G) Volcano Plot. The plot categorizes proteins into different groups based on their statistical significance and fold‐change: Enriched hits (blue circles): proteins with high statistical significance ( p < 0.05) and positive fold‐change (log2FC > 0.58). Hits (orange circles): proteins that meet statistical thresholds but have lower fold‐changes. Enriched candidates (green squares): proteins with moderate fold‐change and significance ( p < 0.05; 0.3 < log2FC ≤ 0.58). Candidates (red diamonds): potentially relevant proteins that do not meet strict thresholds. No hits (purple triangles): proteins with no significant differential biotinylation. Proteins with no significant differential expression that are still plotted (brown stars). Thresholds: The black dashed line represents log2FC = 0 (no change).

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Labeling, Cloning, Plasmid Preparation, Expressing, Transduction, Selection, Western Blot, Staining, Control, Biomarker Discovery, Lysis, Isolation, Functional Assay, Construct, Quantitative Proteomics

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Functional enrichment and protein–protein interaction network analysis of identified K Ca 3.1 interactors. (A) Heatmap displaying the log2 ratio of gene expression across different experimental conditions. The color scale represents expression changes, where red indicates higher expression levels (log2 ratio > 0) and blue represents lower expression levels. The biotinylated conditions show a marked increase in expression for specific genes compared to the no‐biotin conditions (refer to the attached S2 for high resolution table). (B) Gene Ontology (GO) enrichment analysis highlighting the most significant Biological Processes (BP), Cellular Components (CC), and Molecular Functions (MF) associated with the data set. The enrichment score quantifies the relative representation of each GO term. (C) Correlation between KCNN4 expression and key interactors in pancreatic cancer using correlation analysis. Scatter plots illustrate the correlation between log2(KCNN4 TPM) and the expression levels (log2(TPM)) of selected interacting proteins. The Pearson correlation coefficient ( R ) and p value for each correlation are displayed in the plots. A significant positive correlation was observed with MET ( R = 0.41, p = 1.3e−08), TSG101 ( R = 0.39, p = 1e−07), and CDH1 ( R = 0.36, p = 2.6e−07). (D) PPI network of the 138 membrane proteins identified among the interactors. Functional enrichment analysis of STRING MP network. The figure highlights key biological processes and signaling pathways associated with the analyzed data set. GO:0051049—Regulation of transport (red): 29 of 1998 genes; enrichment score = 0.36; fold change = 0.43; p value = 0.0047. GO: 0005789 Endoplasmic reticulum membrane (yellow): 27 of 1100 genes; enrichment score = 0.59; fold change = 1.0; p value = 1.09e−07. ReacTome: MMU‐194315—Signaling by Rho GTPases (blue): 28 of 603 genes; enrichment score = 0.87; fold change = 1.86; p value = 1.89e−13. WP488–Alpha 6 beta 4 integrin signaling pathway (green): 7 of 66 genes; enrichment score = 1.23; fold change = 1.04; p value = 7.22e−05. Each pathway is color‐coded according to its classification, indicating significant involvement in cellular signaling and transport regulation.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Functional Assay, Gene Expression, Expressing, Membrane, Protein-Protein interactions

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: K Ca 3.1 physically interacts with ITGB4 and promotes cytoskeletal remodeling: (A) K Ca 3.1 immunoprecipitates with ITGB4 in K Ca 3.1 over‐expressing cell line. Immunoprecipitation was performed using an anti‐myc antibody to pull down myc‐tagged K Ca 3.1 in KPCY cells. Western Blot analysis revealed the presence of ITGB4, indicating a physical interaction between K Ca 3.1 and ITGB4. (B) Gene expression correlation analysis between KCNN4 and ITGB4. Scatter plot illustrating a significant positive correlation between KCNN4 and ITGB4 expression levels (Pearson's R = 0.6, p < 0.0001), indicating a potential coregulation or functional association between the two genes. (C) Confocal images of phalloidin staining in KPCY cells over‐expressing K Ca 3.1‐GFP‐myc. Overexpression of K Ca 3.1 in KPCY cells leads to actin cytoskeletal remodeling, characterized by multiple filopodial extensions and well‐defined stress fibers that, in contrast, are largely lacking in the KPCY WT cell line.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Immunoprecipitation, Western Blot, Gene Expression, Functional Assay, Staining, Over Expression

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: Expression of the KCNN4 gene in tumor and normal samples from the TCGA‐PAAD data set: association with disease progression and survival outcomes. (A) KCNN4 expression in TCGA‐PAAD RNA‐seq data: comparison between normal tissues ( n = 4, blue) and primary tumor samples ( n = 178, red). (B) KCNN4 expression in TCGA‐PAAD samples stratified by nodal metastasis status: normal ( n = 4), N0 ( n = 49), and N1 ( n = 124). (C) KCNN4 expression stratified by ethnicity: Caucasian ( n = 156), African American ( n = 6), and Asian ( n = 11), compared to normal samples ( n = 4). (D) Kaplan–Meier survival analysis of TCGA‐PAAD patients stratified by KCNN4 expression (high vs. low); high expression is associated with significantly worse prognosis ( p = 0.0117, HR = 1.31). (E) KCNN4 expression across tumor stages I–IV in TCGA‐PAAD, compared to normal tissues. (F) KCNN4 expression in TCGA‐PAAD samples with TP53 mutation ( n = 82), non‐mutated TP53 ( n = 93), and normal tissues ( n = 4). (G) TP53 mutations are associated with elevated KCNN4 expression across multiple cancer types. Heatmap shows the log2 fold change in KCNN4 expression in TP53‐mutant cancers from TCGA; asterisks (*) indicate statistically significant differences (adjusted p < 0.05). Statistical comparisons in panels (A, B, C, E, and F) were performed using the Kruskal–Wallis test, followed by Dunn's post hoc test for multiple pairwise comparisons. Sample numbers are indicated below each group. Abbreviation: TPM, Transcripts Per Million.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Biomarker Discovery, RNA Sequencing, Comparison, Mutagenesis

Journal: Journal of Cellular Physiology

Article Title: Intermediate Conductance Calcium‐Dependent Potassium Channel (K Ca 3.1) Interacting Proteins Using Turboid‐Based Proximity Labeling Technology: Insights Into Interactome and Related Signaling Pathways in Pancreatic Tumors

doi: 10.1002/jcp.70092

Figure Lengend Snippet: KCNN4 Expression Correlates with Immune Cell Infiltration and Immune Modulation in PAAD. (A) Heatmap displaying correlations between KCNN4 expression and various immune cell populations in PAAD, indicating heterogeneous immune infiltration. Positive correlations (red) indicate an association with immunosuppressive cells (e.g., Tregs, M0 macrophages), while negative correlations (blue) highlight decreased cytotoxic and effector immune cells (e.g., CD8+ T cells, NK cells). (B) Heatmaps illustrating the correlation of KCNN4 with immune stimulatory and immune inhibitory molecules. KCNN4 demonstrates positive associations with immune checkpoint inhibitors (e.g., PD‐L1, TIM‐3, TGFB1). (C and D) Plots depict changes in immune cell abundance in copy number variation (CNV) groups (C) and mutant vs. wild‐type (D). (E) Correlation analysis between KCNN4 expression and immune cell infiltration in PAAD.

Article Snippet: The murine KCNN4 coding sequence was amplified from the KCNN4 ‐Myc‐DDK plasmid (Origene Cat. No. MR206777) with Phusion DNA Polymerase (England Biolabs Cat. No. M0530S) using primers harboring attB recombination sites (Primer FOR: 5′‐GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC ATGGGCGGGGAGCTGGTGA‐3′; Primer REV: 5′‐ GGGGACCACTTTGTACAAGAAAGCTGGGTG TGTGGCCTCCTGGCTGGGTTC).

Techniques: Expressing, Mutagenesis

Journal: bioRxiv

Article Title: Potassium channels mediate the inhibitory effect of exosomes on anti-tumor immunity in head and neck cancer

doi: 10.1101/2025.07.25.666838

Figure Lengend Snippet: (A) (Left) Representative KCa3.1 currents recorded in whole-cell voltage-clamp configuration in activated CD8 + T cells from a healthy donor in the absence (Control) or presence of HNSCC exosomes (EXO; 1.04 X 10 9 particles/ ml). (Right) Violin plots of KCa3.1 and Kv1.3 conductance (normalized to cell capacitance) in activated CD8 + T cells from five healthy donors in the absence (Control) or presence of HNSCC exosomes (EXO) from HNC208, HNC285, and HNC365 (n= 21 cells for control and 23 cells for EXO; some donors’ T cells were treated with exosomes from multiple HNSCC patients). Significance was determined using the Mann-Whitney rank sum test. (B) Fold change in mRNA abundance of CALM1 , CALM2, and CALM3 in PBMCs from healthy donors (n=7) treated with HNC208, HNC285, and HNC365 exosomes (EXO; 1.04 X 10 9 particles/ ml) was determined by RT-qPCR. The PBMCs from some donors in the EXO group were each treated with exosomes from two different HNSCC patients. Each sample was run in triplicate. 18S rRNA was used as the housekeeping gene. Data were normalized to untreated PBMCs (Control). Bars represent means ± SD, and the symbols represent individual treatment conditions. Significance was determined using an unpaired t-test ( CALM2 ) and Mann-Whitney rank sum test ( CALM1 and CALM3 ). (C) Representative flow cytometry staggered histograms showing CaM expression in CD8 + T cells from one healthy donor in the absence (Control) or presence of HNC 208, HNC 285, and HNC 365 exosomes (EXO; 1.04 X 10 9 particles/ ml). The bar graph on the right shows the geometric mean fluorescence intensity (gMFI) for CaM expression in control and EXO-treated cells from four healthy donors. Bars represent mean ± SD; symbols represent individual treatment conditions (some donors were treated with exosomes from multiple HNSCC patients). Significance was determined by Mann-Whitney rank sum test. (D) Representative Ca 2+ response (shown as a ratio of Indo-1 fluorescence at 400 and 480 nm) recorded in activated healthy donor CD8 + T cells in the absence (Control) or presence of HNC208, HNC285, and HNC365 exosomes (EXO; 1.04 X 10 9 particles/ ml). Cells were loaded with Indo-1; and analyzed by flow cytometry, thapsigargin (arrow) was added in 0 mM Ca 2+ to induce intracellular Ca 2+ store depletion, followed by 2 mM Ca 2+ , which yielded a rapid Ca 2+ influx (see Materials and Methods). Right panel shows the average peak Ca²⁺ fold change in CD8 + T cells from n = 5 donors. Bars represent mean ± SD; symbols represent individual treatment conditions (some donors were treated with exosomes from multiple HNSCC patients). Statistical significance was determined by unpaired t-test. (E) IFN-γ levels in healthy donor CD8 + T cells (n =3 healthy donors) treated with HNSCC exosomes (0.13 × 10 9 particles/ml), isolated from supernatants of HNC208, HNC285, and HNC365 cells, and activated with plate-bound anti-CD3 and anti-CD28 antibodies for 72 h in the absence or presence of 1 μM NS309 (KCa3.1 activator). Each donor was exposed to HNC208, HNC285, and HNC365 exosomes, and the samples were run in duplicate on the same ELISA plate. Activated CD8 + T cells that were not exposed to exosomes were used as controls. For each experiment, IFN-γ levels in control samples were normalized to 1 (dotted line), and all other values were expressed relative to this baseline. Symbols represent individual treatment conditions; bars indicate mean ± SD. Significance was determined using a paired t-test.

Article Snippet: The cells were then resuspended in 100 μl PBS, and stained with Zombie UV Live/Dead dye (BioLegend) as per the manufacturer’s instructions, washed with staining buffer (BioLegend), fixed in 4% paraformaldehyde for 30 minutes and stained overnight at 4°C with guinea pig anti-Kv1.3 and mouse anti-KCa3.1 (ATTO-488) primary antibodies (Alomone Labs) in the dark.

Techniques: Control, Exosomes, MANN-WHITNEY, Quantitative RT-PCR, Flow Cytometry, Expressing, Fluorescence, Isolation, Enzyme-linked Immunosorbent Assay, FACS, Patch Clamp

Journal: bioRxiv

Article Title: Potassium channels mediate the inhibitory effect of exosomes on anti-tumor immunity in head and neck cancer

doi: 10.1101/2025.07.25.666838

Figure Lengend Snippet: (A) Fold change in mRNA abundance of KCa3.1 (KCNN4 ), Kv1.3 ( KCNA3 ), Orai ( ORAI1 ) and Stim1 ( STIM1 ) in PBMCs from healthy donors (n=7) treated with HNC208, HNC285 and HNC365 exosomes (EXO, 1.04 X 10 9 particles/ ml) was determined by RT-qPCR. PBMCs from some donors in the EXO group were each treated with exosomes from two different HNSCC patients. Each sample was run in triplicate. 18S rRNA was used as the housekeeping gene. Data were normalized to untreated PBMCs (Control). Bars represent means ± SD, and symbols represent individual treatment conditions. Significance was determined by unpaired t-test ( ORAI1 and STIM1 ) and Mann-Whitney rank sum test ( KCNN4 and KCNA3 ). (B-E) Mean fluorescence intensity (MFI) of KCa3.1, Kv1.3, and CD69 in CD3 + (B), CD4 + (C), CD8 + (D), and CD56 dim CD16 + NK cells (E) from four healthy donors treated with HNSCC exosomes from HNC208, HNC285, and HNC365 (same protocol as in A, some donors were treated with exosomes from multiple HNSCC patients). Untreated PBMC were used as controls. Significance was determined by unpaired t-test and Mann-Whitney rank sum test (CD3 + CD69, CD4 + KCa3.1, CD4 + CD69, NK + Kv1.3, NK + CD69). Bars represent means ± SD, symbols represent individual treatment conditions.

Article Snippet: The cells were then resuspended in 100 μl PBS, and stained with Zombie UV Live/Dead dye (BioLegend) as per the manufacturer’s instructions, washed with staining buffer (BioLegend), fixed in 4% paraformaldehyde for 30 minutes and stained overnight at 4°C with guinea pig anti-Kv1.3 and mouse anti-KCa3.1 (ATTO-488) primary antibodies (Alomone Labs) in the dark.

Techniques: Exosomes, Quantitative RT-PCR, Control, MANN-WHITNEY, Fluorescence