Journal: Communications biology

Article Title: AP-1 cFos/JunB /miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration.

doi: 10.1038/s42003-019-0335-4

Figure Lengend Snippet: Fig. 1 Axolotl glial cells express AP-1cFos/JunB after spinal cord injury. a Immunohistochemical analysis of regenerating spinal cords at 1 day post injury shows only NeuN+ neurons express c-Jun. GFAP+ glial cells are negative for c-Jun expression (n = 5) Scale bars = 50 μm. b Schematic diagram of the structure of the axolotl spinal cord, neuronal cell bodies that surround the glial cells are shown in blue, glial cells line the central canal (CC), they have a large nucleus and express GFAP on the membrane (green). c qRT-PCR profiling shows upregulation of c-Fos and JunB during axolotl spinal cord regeneration (n = 3). d In situ hybridization confirms JunB expression in glial cells at 1 day post injury, higher magnification image of panel d, showing JunB transcript in the oval-shaped glial cells that line the central canal (n = 5) Scale bars = 50 μm. ***p ≤0.001. Error bars represent ± S.T.D

Article Snippet: Restriction fragments were ligated together using T4 DNA Ligase (NEB) overnight at 4 °C and heat shock transformed into DH5α competent E. coli (Promega) cFos For Axolomics NheI ATTGCTAGCACCATGTTCCAGGGCTTCTCGGG cFos Rev Axolomics SacII ATCCCGCGGCAGAGCAAGCAAAGTAGGCG cJun For XhoI ATTCTCGAGACCATGGAGCCTACGTTCTACG cJun Rev SalI ATTGTCGACACATGAACGTCTGCAGCTGCTG JunB For NheI ATTGCTAGCACCATGTGCACCAAGATGGACG JunB Rev SacII ATTCCGCGGAAAGGGCTGCATCTTGGCA Sequences for the human versions of c-Fos (#70382), c-Jun (#70398) and JunB (#29687) were cloned from the indicated Addgene plasmids using the following primers (5′–3′) and subcloned into pCMV:GFP (Clontech): cFos FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cFos FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG cJun FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cJun FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG JunB FL Hs For SalI TATGTCGACACCATGTGCACTAAAATGGAACAGCC JunB FL Hs Rev BamHI ACTGGATCCGAAGGCGTGTCCCTTGAC For 3’ UTR luciferase experiments, primers were designed to amplify the cJun 3’ UTR based off our RACE sequences.

Techniques: Immunohistochemical staining, Expressing, Membrane, Quantitative RT-PCR, In Situ Hybridization

Journal: Journal of Biological Macromolecules

Article Title: Generation of ribonuclease H2 A subunit (RH2A)-knockout HEK293 cells and analysis of the ribonucleotide content of their genomic DNA

doi: 10.14533/jbm.24.33

Figure Lengend Snippet: Fig. 1. Knockout of Rnaseh2a gene of HEK293 cells with the CRISPR/Cas9 system.

Article Snippet: After separation, the proteins were transferred by electroblotting onto a polyvinylidene difluoride (PVDF) membrane Sequi- BlotTM PVDF (BioRad, Hercules, CA) in 25 mM Tris-HCl buffer (pH 8.3), 192 mM glycine, 20% v/v methanol at 25 V for 50 min. After blotting, the membrane was washed with 50 mM Tris-HCl buffer (pH 8.3), 138 mM NaCl, 2.7 mM KCl, 0.05% Tween 20 (TBS-T), blocked with TBS-T containing 2% w/v skim milk, and incubated with mouse anti human RH2A polyclonal antibody, Anti RNASEH2A (Proteintech, Rosemont, IL, 1:1000 in TBS-T containing 1% w/v skim milk).

Techniques: Knock-Out, CRISPR

Journal: Journal of Biological Macromolecules

Article Title: Generation of ribonuclease H2 A subunit (RH2A)-knockout HEK293 cells and analysis of the ribonucleotide content of their genomic DNA

doi: 10.14533/jbm.24.33

Figure Lengend Snippet: Fig. 2. Screening of Rnaseh2a-/- homozygote HEK293 cells.

Article Snippet: After separation, the proteins were transferred by electroblotting onto a polyvinylidene difluoride (PVDF) membrane Sequi- BlotTM PVDF (BioRad, Hercules, CA) in 25 mM Tris-HCl buffer (pH 8.3), 192 mM glycine, 20% v/v methanol at 25 V for 50 min. After blotting, the membrane was washed with 50 mM Tris-HCl buffer (pH 8.3), 138 mM NaCl, 2.7 mM KCl, 0.05% Tween 20 (TBS-T), blocked with TBS-T containing 2% w/v skim milk, and incubated with mouse anti human RH2A polyclonal antibody, Anti RNASEH2A (Proteintech, Rosemont, IL, 1:1000 in TBS-T containing 1% w/v skim milk).

Techniques:

Journal: Journal of Biological Macromolecules

Article Title: Generation of ribonuclease H2 A subunit (RH2A)-knockout HEK293 cells and analysis of the ribonucleotide content of their genomic DNA

doi: 10.14533/jbm.24.33

Figure Lengend Snippet: Fig. 7. Knockout of Rnaseh2a gene of HEK293

Article Snippet: After separation, the proteins were transferred by electroblotting onto a polyvinylidene difluoride (PVDF) membrane Sequi- BlotTM PVDF (BioRad, Hercules, CA) in 25 mM Tris-HCl buffer (pH 8.3), 192 mM glycine, 20% v/v methanol at 25 V for 50 min. After blotting, the membrane was washed with 50 mM Tris-HCl buffer (pH 8.3), 138 mM NaCl, 2.7 mM KCl, 0.05% Tween 20 (TBS-T), blocked with TBS-T containing 2% w/v skim milk, and incubated with mouse anti human RH2A polyclonal antibody, Anti RNASEH2A (Proteintech, Rosemont, IL, 1:1000 in TBS-T containing 1% w/v skim milk).

Techniques: Knock-Out

Journal: Immunity

Article Title: The IRF4 gene regulatory module functions as a read-write integrator to dynamically coordinate T helper cell fate

doi: 10.1016/j.immuni.2017.09.001

Figure Lengend Snippet: Irf4 targets distinct DNA motifs to control Tfh and Teff gene programs. ATAC-seq libraries were generated from the same cells in Figure 5. (A) Five patterns of differentially ChARs, A1-5, are shown as box plots (median ±%75th for the box and ±%25th for the whiskers) plotted as a function of averaged Z-scored values. The number of regions within each cluster are shown. (B) Peak tracks at the Bcl6 and Prdm1 loci from the indicated groups; CD4+ naïve and activated are from (GEO: GSE37074). ChARs from a given cluster are highlighted with a downward facing arrowhead and the parental cluster. Peaks with no arrows are not differentially accessible. (C) Heat map depicting the enrichment ratio (Log2) of given Irf4 DNA binding motifs (x-axis) in clusters A1-5 (y-axis); inset text represents the enrichment p-value (Fisher’s Exact Test). (D) Binding saturation curves of Irf4 to the AICE or ISRE motifs. Binding reactions using the AICE probe derived from Bcl11b were carried out in the presence of a constant amount of BATF and JunB containing nuclear extracts. Irf4 containing nuclear extract was increased in 2-fold increments as indicated. The ISRE probe from Prdm1 was used in binding reactions with Irf4 containing nuclear extracts as for the AICE reaction. Nuclear extracts containing a DNA-binding deficient Irf4 (R98A, C99A) were used at the highest concentration of the wild type Irf4 saturation curve as a specificity control. Arrows indicate complexes; AP-1 (blue), Irf4/AP-1 (red), and Irf4 homodimer (green); asterisk indicates non-specific binding. Densitometry analysis is shown to the right of the gel. Representative of two experiments performed. E) Heat map depicting the enrichment ratio of gene members from RNA clusters R1-6 (x-axis) in ChARs A1-5 (y-axis); inset text represents the enrichment p-value (Fisher’s Exact Test). See also Figure S7 and Tables S1–7.

Article Snippet: Plasmid: pMIG backbone expressing JunB , Addgene , Plasmid #40349.

Techniques: Control, Generated, Binding Assay, Derivative Assay, Concentration Assay

Journal: Immunity

Article Title: The IRF4 gene regulatory module functions as a read-write integrator to dynamically coordinate T helper cell fate

doi: 10.1016/j.immuni.2017.09.001

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Plasmid: pMIG backbone expressing JunB , Addgene , Plasmid #40349.

Techniques: Purification, Control, Recombinant, Transfection, Sensitive Assay, RNA HS Assay, Plasmid Preparation, Expressing, Mutagenesis, Software

Journal: Blood Advances

Article Title: Expression of the prosurvival kinase HCK requires PAX5 and mutated MYD88 signaling in MYD88-driven B-cell lymphomas

doi: 10.1182/bloodadvances.2019000947

Figure Lengend Snippet: Primer sets used for PCR and targeted sequences for knockdown studies

Article Snippet: Western blots were performed for the detection of protein phosphorylation or expression levels in cell lines or following the cell stimulation by LPS (for TLR4) or ODN-2006 (for TLR9); MYD88 overexpression or knockdown; PAX5 knockdown; JunB knockdown or pull-down with biotinylated probes using antibodies for PAX5 (Abcam); phospho-NF-kB-p65(Ser529; Rockland Immunochemicals, Limerick, PA); phospho-JunB (Ser79; OriGene Technologies); phospho-c-Jun (Ser63), phospho-STAT3 (Tyr705), STAT3, NF-kB-p65, JunB, c-Jun, JunD, HCK, MYD88 (Cell Signaling Technology).

Techniques: Knockdown, Cloning

Journal: Blood Advances

Article Title: Expression of the prosurvival kinase HCK requires PAX5 and mutated MYD88 signaling in MYD88-driven B-cell lymphomas

doi: 10.1182/bloodadvances.2019000947

Figure Lengend Snippet: TF expression, activation, and the impact of PAX5 on HCK transcription in MYD88-mutated lymphoma cells. (A) Western blot studies depicting protein expression levels of PAX5, STAT3, NF-kB (NF-κB-p65), and AP-1 complex members (JunB, c-Jun, JunD) predicted by TF promoter-binding assay and PROMO analysis as HCK promoter binding TFs in MYD88-mutated WM and ABC-DLBCL cell lines (BCWM.1, MWCL-1, TMD-8, HBL-1, OCI-Ly3, and SU-DHL-2) and MYD88 wild-type B-cell lymphoma (OCI-Ly7, OCI-Ly19, Ramos) and myeloma cells (RPMI-8226, MM.1S). The HCK protein expression levels and the phosphorylation levels of mutated MYD88–directed TFs STAT3, NF-κB-p65, and AP-1 complex members (JunB, c-Jun) were also detected. GAPDH protein expression was used to demonstrate uniform protein loading. (B) The regulation of HCK transcription by PAX5 was assessed by lentiviral knockdown of PAX5 with 2 distinct shRNAs in MYD88-mutated BCWM.1 and TMD-8 cells and compared with scrambled control vector. Quantitative RT-PCR was performed after day 5 of lentiviral transduction. HCK protein levels and knockdown efficiencies for PAX5 were analyzed by western blot at the same time as the sample collection for HCK mRNA quantification. GAPDH was used for loading control. (C) The regulation of PAX5 by mutated MYD88 was assessed by lentiviral-mediated knockdown of MYD88 in MYD88-mutated BCWM.1 and TMD-8 cells using 2 distinct shRNAs and compared with scrambled control vector. Protein levels of PAX5 are shown, and GADPH served as a protein loading control. (D) Transcriptome analysis depicting PAX5 transcript levels in CD19-selected bone marrow LPCs from MYD88-mutated WM patients, and MYD88 wild-type WM patients; peripheral CD19-selected B cells and CD19- and CD27-selected memory B cells from healthy donors; and CD138-selected bone marrow plasma cells from healthy donors. ***P < .001.

Article Snippet: Western blots were performed for the detection of protein phosphorylation or expression levels in cell lines or following the cell stimulation by LPS (for TLR4) or ODN-2006 (for TLR9); MYD88 overexpression or knockdown; PAX5 knockdown; JunB knockdown or pull-down with biotinylated probes using antibodies for PAX5 (Abcam); phospho-NF-kB-p65(Ser529; Rockland Immunochemicals, Limerick, PA); phospho-JunB (Ser79; OriGene Technologies); phospho-c-Jun (Ser63), phospho-STAT3 (Tyr705), STAT3, NF-kB-p65, JunB, c-Jun, JunD, HCK, MYD88 (Cell Signaling Technology).

Techniques: Expressing, Activation Assay, Western Blot, Binding Assay, Phospho-proteomics, Knockdown, Control, Plasmid Preparation, Quantitative RT-PCR, Transduction, Clinical Proteomics

Journal: Blood Advances

Article Title: Expression of the prosurvival kinase HCK requires PAX5 and mutated MYD88 signaling in MYD88-driven B-cell lymphomas

doi: 10.1182/bloodadvances.2019000947

Figure Lengend Snippet: ChIP studies assessing STAT3, NF-kB, and AP-1 TF binding to the HCK promoter. The fold enrichments of HCK promoter-specific sequence assessed by quantitative PCR following ChIP with ChIP grade antibodies to STAT3, NF-kB-p65, JunB, and c-Jun in MYD88-mutated WM (BCWM.1, MWCL-1) and ABC-DLBCL (TMD-8, HBL-1, OCI-Ly3) cells, and MYD88 wild-type lymphoma cells (OCI-Ly7, OCI-Ly19). Antibody to GAPDH was used as control antibody.

Article Snippet: Western blots were performed for the detection of protein phosphorylation or expression levels in cell lines or following the cell stimulation by LPS (for TLR4) or ODN-2006 (for TLR9); MYD88 overexpression or knockdown; PAX5 knockdown; JunB knockdown or pull-down with biotinylated probes using antibodies for PAX5 (Abcam); phospho-NF-kB-p65(Ser529; Rockland Immunochemicals, Limerick, PA); phospho-JunB (Ser79; OriGene Technologies); phospho-c-Jun (Ser63), phospho-STAT3 (Tyr705), STAT3, NF-kB-p65, JunB, c-Jun, JunD, HCK, MYD88 (Cell Signaling Technology).

Techniques: Binding Assay, Sequencing, Real-time Polymerase Chain Reaction, ChIP-chip, Control

Journal: Blood Advances

Article Title: Expression of the prosurvival kinase HCK requires PAX5 and mutated MYD88 signaling in MYD88-driven B-cell lymphomas

doi: 10.1182/bloodadvances.2019000947

Figure Lengend Snippet: The regulation of JunB by TLR/MYD88 signaling and the impact of JunB on HCK transcription. The phosphorylation of JunB (Ser79) and c-Jun (Ser63) was assessed following TLR4 (by LPS-EB) and TLR9 (by ODN-2006) stimulation (A) as well as the lentiviral cells (C). HCK overexpression of MYD88 L265P mutant vs MYD88 WT (B) in both MYD88-mutated BCWM.1 cells and MYD88 wild-type Ramos cells. The phosphorylation of JunB (Ser79) and c-Jun (Ser63) was determined following MYD88 knockdown in MYD88-mutated BCWM.1 protein levels detected following lentiviral mediated knockdown of JunB in MYD88-mutated BCWM.1 and TMD-8 cells using 2 distinct shRNAs and compared with scrambled control vector (D). Protein levels of MYD88, JunB, c-Jun, and GADPH served as protein expression, knockdown efficiency, and loading controls.

Article Snippet: Western blots were performed for the detection of protein phosphorylation or expression levels in cell lines or following the cell stimulation by LPS (for TLR4) or ODN-2006 (for TLR9); MYD88 overexpression or knockdown; PAX5 knockdown; JunB knockdown or pull-down with biotinylated probes using antibodies for PAX5 (Abcam); phospho-NF-kB-p65(Ser529; Rockland Immunochemicals, Limerick, PA); phospho-JunB (Ser79; OriGene Technologies); phospho-c-Jun (Ser63), phospho-STAT3 (Tyr705), STAT3, NF-kB-p65, JunB, c-Jun, JunD, HCK, MYD88 (Cell Signaling Technology).

Techniques: Phospho-proteomics, Over Expression, Mutagenesis, Knockdown, Control, Plasmid Preparation, Expressing

Journal: BMC Biology

Article Title: Machine learning combined with omics-based approaches reveals T-lymphocyte cellular fate imbalance in abdominal aortic aneurysm

doi: 10.1186/s12915-025-02400-x

Figure Lengend Snippet: Identification of TIRS regulatory mechanisms and key biomarkers. A LASSO-based feature selection, with the optimal lambda determined when the partial likelihood deviance reached the minimum value (left). SVM-RFE-based feature selection, with root mean square error (RMSE) reached the minimum value and R -squared reached the max value (mid). Venn diagram presented the intersection of key biomarkers obtained through both algorithms (right). B Aberrant expression profiles for key biomarkers in Abdominal Aortic Wall Dataset 1 (AAA n = 80 patients, control n = 10 healthy individuals; Student’s t -test). C ROC curve demonstrating the diagnostic efficacy of FOSB, JUNB, CST7, and TBC1D4 in Abdominal Aortic Wall Dataset 1. D Clinical impact plot illustrating the clinical utility of key biomarkers. The “Number high risk” curve closely aligns with the “Number high risk with the event” curve at each threshold probability, indicating exceptional predictive power. E Aberrant expression profiles for key biomarkers in Abdominal Aortic Wall Dataset 2 (AAA n = 9 patients, control n = 10 healthy individuals; Student’s t -test). F ROC curve validating the diagnostic efficacy of FOSB, JUNB, CST7, and TBC1D4 in Abdominal Aortic Wall Dataset 2. G Clinical impact plot demonstrating the clinical utility of key biomarkers. Again, the “Number high risk” curve is closely aligned with the “Number high risk with the event” curve at each threshold probability, highlighting the biomarkers’ strong predictive power. H Aberrant expression profiles for key biomarkers in Perivascular Adipose Tissue Dataset 3 (dilated n = 30, non-dilated n = 30; Student’s t -test). I ROC curve verifying the diagnostic efficacy of FOSB, JUNB, CST7, and TBC1D4 in Perivascular Adipose Tissue Dataset 3. J Impact plots reiterated superior predictive performance probability, indicating outstanding predictive capability

Article Snippet: The primary antibodies against FOSB (1:500, catalog No. ab184938, Abcam) and JUNB (1:50, catalog No. 10486–1-AP, Proteintech) were incubated overnight at 4 °C, followed by incubation with horseradish peroxidase conjugated secondary antibodies.

Techniques: Selection, Expressing, Control, Diagnostic Assay

Journal: BMC Biology

Article Title: Machine learning combined with omics-based approaches reveals T-lymphocyte cellular fate imbalance in abdominal aortic aneurysm

doi: 10.1186/s12915-025-02400-x

Figure Lengend Snippet: Verification of key biomarkers. A Abdominal aortic wall and peripheral blood samples obtained from AAA patients. B Aberrant expression profiles for key biomarkers in the abdominal aortic wall (Inhouse Dataset 1; AAA n = 5 patients, control n = 4 healthy individuals). C ROC curve validating the diagnostic efficacy of FOSB, JUNB, CST7, and TBC1D4 in the abdominal aortic wall (Inhouse Dataset 1). D Clinical impact plot demonstrating the clinical utility of key biomarkers. The “Number high risk” curve closely aligns with the “Number high risk with the event” curve at each threshold probability, indicating exceptional predictive power. E Aberrant expression profiles for key biomarkers in peripheral blood (Inhouse Dataset 2; AAA n = 24 patients, control n = 15 healthy individuals). F ROC curve validating the diagnostic efficacy of FOSB, JUNB, CST7, and TBC1D4 in peripheral blood (Inhouse Dataset 2). G Clinical impact plot illustrating the clinical utility of key biomarkers. Again, the “Number high risk” curve remains closely aligned with the “Number high risk with the event” curve at each threshold probability, highlighting the biomarkers’ strong predictive capability. H Mice were infused with saline or Ang II (1000 ng/kg/min) + BAPN. Gross abdominal aorta images were shown. Scale bar is 1 cm. I Representative images of immunohistochemical stains for elastin fiber (Van Gieson) and representative photomicrographs of hematoxylin and eosin (H&E) staining. Scale bar is 200 μm. J – L Representative immunohistochemical staining of FOSB and JUNB in aortic cross sections. Scale bar is 50 μm. Data are expressed as mean ± SEM (control n = 3 mice, AAA n = 5 or 6 mice). Student’s t -test was utilized to compare continuous variables between the two groups

Article Snippet: The primary antibodies against FOSB (1:500, catalog No. ab184938, Abcam) and JUNB (1:50, catalog No. 10486–1-AP, Proteintech) were incubated overnight at 4 °C, followed by incubation with horseradish peroxidase conjugated secondary antibodies.

Techniques: Expressing, Control, Diagnostic Assay, Saline, Immunohistochemical staining, Staining