Journal: Communications biology

Article Title: AP-1 cFos/JunB /miR-200a regulate the pro-regenerative glial cell response during axolotl spinal cord regeneration.

doi: 10.1038/s42003-019-0335-4

Figure Lengend Snippet: Fig. 1 Axolotl glial cells express AP-1cFos/JunB after spinal cord injury. a Immunohistochemical analysis of regenerating spinal cords at 1 day post injury shows only NeuN+ neurons express c-Jun. GFAP+ glial cells are negative for c-Jun expression (n = 5) Scale bars = 50 μm. b Schematic diagram of the structure of the axolotl spinal cord, neuronal cell bodies that surround the glial cells are shown in blue, glial cells line the central canal (CC), they have a large nucleus and express GFAP on the membrane (green). c qRT-PCR profiling shows upregulation of c-Fos and JunB during axolotl spinal cord regeneration (n = 3). d In situ hybridization confirms JunB expression in glial cells at 1 day post injury, higher magnification image of panel d, showing JunB transcript in the oval-shaped glial cells that line the central canal (n = 5) Scale bars = 50 μm. ***p ≤0.001. Error bars represent ± S.T.D

Article Snippet: Restriction fragments were ligated together using T4 DNA Ligase (NEB) overnight at 4 °C and heat shock transformed into DH5α competent E. coli (Promega) cFos For Axolomics NheI ATTGCTAGCACCATGTTCCAGGGCTTCTCGGG cFos Rev Axolomics SacII ATCCCGCGGCAGAGCAAGCAAAGTAGGCG cJun For XhoI ATTCTCGAGACCATGGAGCCTACGTTCTACG cJun Rev SalI ATTGTCGACACATGAACGTCTGCAGCTGCTG JunB For NheI ATTGCTAGCACCATGTGCACCAAGATGGACG JunB Rev SacII ATTCCGCGGAAAGGGCTGCATCTTGGCA Sequences for the human versions of c-Fos (#70382), c-Jun (#70398) and JunB (#29687) were cloned from the indicated Addgene plasmids using the following primers (5′–3′) and subcloned into pCMV:GFP (Clontech): cFos FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cFos FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG cJun FL Hs For SalI TATGTCGACACCATGACTGCAAAGATGGAAACGA cJun FL Hs Rev BamHI ACTGGATCCAAATGTTTGCAACTGCTGCGTTAG JunB FL Hs For SalI TATGTCGACACCATGTGCACTAAAATGGAACAGCC JunB FL Hs Rev BamHI ACTGGATCCGAAGGCGTGTCCCTTGAC For 3’ UTR luciferase experiments, primers were designed to amplify the cJun 3’ UTR based off our RACE sequences.

Techniques: Immunohistochemical staining, Expressing, Membrane, Quantitative RT-PCR, In Situ Hybridization

Journal: Frontiers in Cell and Developmental Biology

Article Title: Cancer-Associated Fibroblasts Facilitate Squamous Cell Carcinoma Lung Metastasis in Mice by Providing TGFβ-Mediated Cancer Stem Cell Niche

doi: 10.3389/fcell.2021.668164

Figure Lengend Snippet: Cancer-associated fibroblasts increased self-renewal and invasion of CSCs in a TGFβ-dependent manner via direct contact and paracrine effects. (A) Representative images of GFP + A223 CSCs and RFP + CAFs in spheroid co-culture. (B) Quantification of sphere number in each of the indicated A223 CSC treatment [vehicle (DMSO) or TGFβ inhibitor (“TGFβi”)] ± fibroblast co-culture conditions. (C,D) Representative images and quantification of A223 CSC spheres cultured with the indicated conditioned media (CM) and vehicle (DMSO) or TGFβi. (E) Transwell invasion assay: A223 CSCs were seeded in the top Matrigel-coated chamber, and CAFs or NAFs were cultured in the bottom well. After 48 h, invaded CSCs attached to the underside of the upper chamber were quantified. (F) TGFβ1 concentration in each of the indicated CM was determined by ELISA. Either three or four technical replicates were conducted for each cell type. (G) The CM of CAFs or unconditioned control media was applied to recipient A223 cells in a 24 h sphere initiation assay. RNA harvested from A223 recipient cells was evaluated by RT-qPCR for the expression of TGFβ-target genes Spp1 , Junb , and Vegfa normalized to the expression of Gapdh . n s P > 0.05, * P < 0.05, ** P < 0.01, *** P < 0.001.

Article Snippet: RT-qPCR was performed using 40 ng RNA, Brilliant II QRT-PCR 1-Step Master Mix (Agilent, Santa Clara, CA, United States) and TaqMan gene expression assays for Junb (Mm04243546_s1), Spp1 (Mm00436767_m1), Vegfa (Mm00437306_m1), and Gapdh (Mm99999915_g1) (ThermoFisher, Rockford, IL, United States).

Techniques: Co-Culture Assay, Cell Culture, Transwell Invasion Assay, Concentration Assay, Enzyme-linked Immunosorbent Assay, Control, Quantitative RT-PCR, Expressing