j&w hp-plot molesieve Search Results


86
Jackson Laboratory c57bl
C57bl, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/6+apctm1tyj+c57bl+j/pm34407392-525-209-211
Average 86 stars, based on 1 article reviews
c57bl - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory b6 129 p2 c ccr7tm1rfor j jackson laboratory 006621 ubi gfp mice
B6 129 P2 C Ccr7tm1rfor J Jackson Laboratory 006621 Ubi Gfp Mice, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/129s7+b6+j+rag1tm1mom/pmc07237890__mmc10-424-17-18
Average 86 stars, based on 1 article reviews
b6 129 p2 c ccr7tm1rfor j jackson laboratory 006621 ubi gfp mice - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory mice jax laboratory rrid imsr jax
Mice Jax Laboratory Rrid Imsr Jax, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/029213+1apat+all+b6+cg+imsr+j+jax+mice+piezo1tm2+purchased+rrid+were/pm36368316-576-9-10
Average 86 stars, based on 1 article reviews
mice jax laboratory rrid imsr jax - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory dr d schlessigner nia nih n a mouse
KEY RESOURCES TABLE
Dr D Schlessigner Nia Nih N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/a+dr+j+leonard+mouse+n+nhlbi+nih+w/pmc06532063-849-82-90
Average 86 stars, based on 1 article reviews
dr d schlessigner nia nih n a mouse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory cba j jackson laboratory
Data and Software Availability
Cba J Jackson Laboratory, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/cba+j/pmc07271821-861-48-49
Average 86 stars, based on 1 article reviews
cba j jackson laboratory - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
J&K Scientific acid
Data and Software Availability
Acid, supplied by J&K Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/acid/pm40882356-52-65-107
Average 86 stars, based on 1 article reviews
acid - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory b6 129s cybbtm1din j
Data and Software Availability
B6 129s Cybbtm1din J, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/129s6+b6+cybbtm1din+j/pmc12461889-301-33-39
Average 86 stars, based on 1 article reviews
b6 129s cybbtm1din j - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory b6 cg
Data and Software Availability
B6 Cg, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/26sortm14+b6+cag+cg+gt+hze+j+rosa+tdtomato/pm40279248-234-44-49
Average 86 stars, based on 1 article reviews
b6 cg - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory ahrtm3 1 bra j jackson laboratory jax
Data and Software Availability
Ahrtm3 1 Bra J Jackson Laboratory Jax, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/006203+1bra+ahrtm3+j+jackson+jax+laboratory/pm40178975-135-6-7
Average 86 stars, based on 1 article reviews
ahrtm3 1 bra j jackson laboratory jax - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Jackson Laboratory il15ratm1ama j
Data and Software Availability
Il15ratm1ama J, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/j%26w+hp-plot+molesieve/il15ratm1ama+j/pm34343496-430-219-220
Average 86 stars, based on 1 article reviews
il15ratm1ama j - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Homeostatic Control of Sebaceous Glands by Innate Lymphoid Cells Regulates Commensal Bacteria Equilibrium

doi: 10.1016/j.cell.2018.12.031

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Park (NCI/NIH) N/A Mouse: Tslp −/− Dr. S. Nakae (University of Tokyo) CDB0777K (RIKEN) Mouse: Il7 −/− Tslp −/− Dr. K. Moro (RIKEN) N/A Mouse: Tslpr −/− Dr. W. J. Leonard (NHLBI/NIH) N/A Mouse: B6.129S6- Ccr6 tm1(EGFP)Irw /J ( Ccr6 GFP/GFP ) Jackson Laboratory Stock No: 013061 Mouse: Tnf −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Lta −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Ltb −/− Dr. D. Schlessigner (NIA/NIH) N/A Mouse: Tnf −/− Lta − / − Ltb − / − Dr. D. Schlessigner (NIA/NIH) N/A Mouse: B6.FVB-Tg(Rorc-cre)1Litt/J (Rorc-Cre) Jackson Laboratory Stock No: 022791 Mouse: B6.129X1- Gt(ROSA)26Sor tm1(EYFP)Cos /J (ROSA-EYFP) Jackson Laboratory Stock No: 006148 Mouse: B6;SJL-Tg(Krt1–15-cre/PGR)22Cot/J Jackson Laboratory Stock No: 005249 Mouse: Adam10 tm1.1Khr (Adam10 flox ) Dr. K. Horiuchi (National Defense Medical College) N/A Software and Algorithms FlowJo FlowJo, LLC https://www.flowjo.com/solutions/flowjo Partek Flow Partek http://www.partek.com/partekflow Partek Genomics Suite Partek http://www.partek.com/pgs nSolver Analysis Software 4.0 NanoString Technologies https://www.nanostring.com/products/analysis-software/nsolver GraphPad Prism GraphPad Software https://www.graphpad.com/ Imaris Bitplane http://www.bitplane.com/ Seurat Satija Lab https://satijalab.org/seurat/ Open in a separate window KEY RESOURCES TABLE

Techniques: Purification, Virus, Isolation, Recombinant, Staining, Transfection, Electron Microscopy, dsDNA Assay, Software

Data and Software Availability

Journal: Cell

Article Title: Adrenergic signaling in muscularis macrophages limits infection-induced neuronal loss

doi: 10.1016/j.cell.2019.12.002

Figure Lengend Snippet: Data and Software Availability

Article Snippet: NCBI GSE140309 Experimental Models: Organisms/Strains Mouse: C57BL6/J Jackson Laboratory #000664 Mouse: Lyz2 Cre Jackson Laboratory #004781 Mouse: Rosa26 tdTomato Jackson Laboratory #007914 Mouse: VGLUT2 Cre Jackson Laboratory #016963 Mouse: 129S1/SvImJ Jackson Laboratory #002448 Mouse: Ccr2 −/− Jackson Laboratory #004999 Mouse: Casp1 −/− Casp11 −/− Jackson Laboratory #016621 Mouse: CBA/J Jackson Laboratory #000656 Mouse: Rpl22 HA Jackson Laboratory #011029 Mouse: Snap25 Cre Jackson Laboratory #023525 Mouse: Adrb2 flox G. Karsenty N/A Mouse: Arg1 flox Jackson Laboratory #008817 Mouse: Cx3cr1 GFP Mouse: Nestin GFP P. Frenette, G. Enikolopov N/A Mouse: Casp11 −/− Jackson Laboratory #024698 Mouse: R26-CAG-ASC-citrine Jackson Laboratory #030744 Mouse: NSG Jackson Laboratory #005557 Mouse: Phox2b cre Jackson Laboratory # 016223 #Mouse: Plp1 CreERT Jackson Laboratory # 005975 Mouse: Rosa26 DTA Jackson Laboratory # 009669 Mouse: R26-hM4Di/mCitrine Jackson Laboratory # 026219 Mouse: Sox10 CreERT2 B. Gulbransen, V. Pachnis N/A Mouse: SNS cre R. Kuhner N/A Mouse: Nlrp6 flox P. Rosenstiel N/A Mouse: Casp11 flox KOMP N/A Oligonucleotides Casp11 forward 5’-AGGCATATCTATAATCCCTTCACTG-3’ IDT N/A Casp11 reverse 5’-GAATATATCAAAGAGATGACAAGAGC- 3’ IDT N/A Arg1 forward 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ IDT N/A Arg1 reverse 5’-AGGAGCTGTCATTAGGGACATC-3’ IDT N/A Ym1 forward 5’-AGACTTGCGTGACTATGAAGCATT-3’ IDT N/A Ym1 reverse 5’-GCAGGTCCAAACTTCCATCCTC-3’ IDT N/A Rpl32 forward 5’-ACAATGTCAAGGAGCTGGAG-3’ IDT N/A Rpl32 reverse 5’-TTGGGATTGGTGACTCTGATG-3’ IDT N/A Nlrp6 E1 forward 5’-TTGACTGTCAGCAAGAGTCC-3’ IDT N/A Nlrp6 E1 reverse 5’-GGTGATCCTTTCTGGGCTAAA-3’ IDT N/A Nlrp6 E4 forward 5’-CAGACGCTGTGGACCTTGT-3’ IDT N/A Nlrp6 E4 reverse 5’- ACGTGCTCGCGGTACTTCTT-3’ IDT N/A Elavl4 forward 5’-GAT CAGGGATGCTAACCTGTATG-3’ IDT N/A Elavl4 reverse 5’- GGTGATGATGCGACCGTATT -3’ IDT N/A Recombinant DNA AAV9-hSyn-eGFP-WPRE-bGH Addgene #105539-AAV9 AAV9-hSyn-HI-eGFP-Cre-WPRE-SV40 Addgene #105540-AAV9 Software and Algorithms GraphPad Prism version 8 for MacOS Graphpad Software Inc. https://www.graphpad.com RStudio RStudio® https://www.rstudio.com DEseq2 Bioconstructor https://bioconductor.org/packages/release/bioc/html/DESeq2.html Imaris (v. 8.4) Bitplane Fiji ImageJ https://imagej.net/Welcome Microsoft Excel for MacOS Microsoft https://products.office.com/en-us/excel Other Salmonella Shigella Agar (SS Agar) BD Cat# 211597 Luria’s Broth base (LB) Thermo-Fisher Scientific Cat# 12795027 O.C.T.

Techniques: Software, Staining, Recombinant, Saline, DNA Extraction, RNAscope, Binding Assay, Enzyme-linked Immunosorbent Assay, Isolation, Generated, RNA Sequencing, Gene Expression