Journal: CNS Neuroscience & Therapeutics

Article Title: GPR30‐mediated estrogenic regulation of actin polymerization and spatial memory involves SRC‐1 and PI3K‐mTORC2 in the hippocampus of female mice

doi: 10.1111/cns.13108

Figure Lengend Snippet: Selective activation of mTORC2 reversed G15‐induced spatial memory disorder and actin depolymerization. The sham animals were in diestrous cycling (evidenced by vaginal smear). The mice injected with DMSO were used as the control. A, Flowchart of the experiments. B, A4 reversed G15‐induced learning impairment from days 3 to day 5. C, The swimming tracks of mice in each quadrant. D, The time spent in the target quadrant of animals. E‐G, The total distance traveled and swimming speed. H, A4 rescued G15‐induced downregulation of p‐AKT. I, A4 reversed G15‐induced decrease in F‐actin/G‐actin ratio. A4: mTORC2 activator A‐443654. Data are shown as the mean ± SEM. ** P < 0.01 compared with other groups (repeated measures of two‐way ANOVA, LSD test for water maze test and one‐way ANOVA, LSD test for Western blot analysis)

Article Snippet: The mTORC2‐specific activator A4 (HY‐10425; Medchem Express, Shanghai, China) was prepared with DMSO and intraperitoneally injected with a dose of 2.5 mg/kg body weight as previous reports., Animals in the DMSO and/or sham groups received an injection of an equal amount of vehicle (60% DMSO + 40% sterile saline solution) as indicated in each experiment.

Techniques: Activation Assay, Injection, Control, Western Blot

Journal: Cell Death & Disease

Article Title: The RNA m 6 A reader IGF2BP3 regulates NFAT1/IRF1 axis-mediated anti-tumor activity in gastric cancer

doi: 10.1038/s41419-024-06566-0

Figure Lengend Snippet: A The relative mRNA expressions of IRF1, IRF2, IRF9, IFI6, IFIT1, IFIT3, MX1, OAS1 and ISG15 in shNC and shIGF2BP3 MKN-45 cells were investigated by qRT-PCR analysis. B Cell apoptosis of shNC and shIGF2BP3 MKN-45 cells after treated with IFN-γ (50 ng/mL) for 48 h were measured by flow cytometric analysis, respectively. C Gene expressions in STTTCRNTTT_IRF_Q6 set of shNC and shIGF2BP3 MKN-45 cells identified by Ribo-seq were performed with GSEA. D The expressions of IRF1 and IRF2 in shNC and shIGF2BP3 MKN-45 and AGS cells were measured by western blot analysis (up) and quantitatively analyzed (down), respectively. E The expressions of IRF1 in shNC and shIGF2BP3 MKN-45 cells after transfected with siRNA targeting IRF1 (si-IRF1_001) or a negative control siRNA (siNC) for 48 h were measured by western blot analysis, respectively. F Colony formation of shNC and shIGF2BP3 MKN-45 cells after transfected with siIRF1(si-IRF1_001, si-IRF1_002) or siNC for 48 h were recorded (left) and quantitatively analyzed (right), respectively. G Wound healing of shNC and shIGF2BP3 MKN-45 cells after transfected with siIRF1 (si-IRF1_001) or siNC for 48 h were recorded (left) and quantitatively analyzed (right), respectively.

Article Snippet: The antibodies used in present study were: IGF2BP3 (Abcam, ab177477, 1:1000), β-Tubulin (Proteintech, 10094-1-AP, 1:1000), METTL3 (Abcam, ab195352, 1:1000), GAPDH (Proteintech, 60004-1-Ig, 1:1000), PARP (CST, 9532, 1:1000), Caspase-3 (CST, 14220, 1:1000), Cytochrome c (CST, 4280, 1:1000), IRF1 (CST, 8478, 1:1000), IRF2 (Abcam, ab124744, 1:1000), Histone H3 (Abbkine, ABL1070, 1:1000), STAT1 (CST, 14994, 1:1000), Phospho-STAT1 (CST, 9167, 1:1000), SP1 (Abcam, ab124804, 1:1000), NFAT1 (Abcam, ab92490, 1:1000), eIF4E (Proteintech, 11149-1-AP, 1:1000). β-Tubulin, GAPDH and Histone H3 were used as the loading control for tissues and cells respectively.

Techniques: Quantitative RT-PCR, Western Blot, Transfection, Negative Control

Journal: Cell Death & Disease

Article Title: The RNA m 6 A reader IGF2BP3 regulates NFAT1/IRF1 axis-mediated anti-tumor activity in gastric cancer

doi: 10.1038/s41419-024-06566-0

Figure Lengend Snippet: A The protein expressions of IRF1 in shNC and shIGF2BP3 MKN-45 cells after treated with CHX (10 μg/mL) for indicated times were examined by western blot analysis (left) and quantitatively analyzed (right). B The relative mRNA expressions of IRF1 in shNC and shIGF2BP3 MKN-45 cells were examined by RT-qPCR analysis. C The relative mRNA expressions of IRF1 in shNC and shIGF2BP3 MKN-45 cells after treated with ACTD (2 μM) for indicated times were examined by RT-qPCR analysis. D IGF2BP3 RIP-qPCR analysis of IRF1 mRNA in MKN-45 cells. E The binding capacity between IRF1 mRNA and IGF2BP3 protein in MKN-45 and AGS cells were examined by RNA pulldown and western blot analysis, respectively. MYC mRNA as the classical target of IGF2BP3 was used as positive control. F Protein expressions of IGF2BP3 in cytoplasm and nucleus of MKN-45 and AGS cells were measured by subcellular fractionation and western blot analysis, respectively. The GAPDH and Histone H3 were used as cytoplasmic control and nuclear control respectively. G Schematic representation of pGL3-Basic-IRF1 promoter reporter plasmid to investigate the role of IGF2BP3 on IRF1 promoter activities. H shNC and shIGF2BP3 MKN-45 cells were co-transfected with pGL3-Basic-IRF1 promoter reporter plasmid and pRL-TK plasmid for 24 h or 48 h. The promoter activities were determined as a relative signal of F-luc divided by R-luc.

Article Snippet: The antibodies used in present study were: IGF2BP3 (Abcam, ab177477, 1:1000), β-Tubulin (Proteintech, 10094-1-AP, 1:1000), METTL3 (Abcam, ab195352, 1:1000), GAPDH (Proteintech, 60004-1-Ig, 1:1000), PARP (CST, 9532, 1:1000), Caspase-3 (CST, 14220, 1:1000), Cytochrome c (CST, 4280, 1:1000), IRF1 (CST, 8478, 1:1000), IRF2 (Abcam, ab124744, 1:1000), Histone H3 (Abbkine, ABL1070, 1:1000), STAT1 (CST, 14994, 1:1000), Phospho-STAT1 (CST, 9167, 1:1000), SP1 (Abcam, ab124804, 1:1000), NFAT1 (Abcam, ab92490, 1:1000), eIF4E (Proteintech, 11149-1-AP, 1:1000). β-Tubulin, GAPDH and Histone H3 were used as the loading control for tissues and cells respectively.

Techniques: Western Blot, Quantitative RT-PCR, Binding Assay, Positive Control, Fractionation, Control, Plasmid Preparation, Transfection

Journal: Cell Death & Disease

Article Title: The RNA m 6 A reader IGF2BP3 regulates NFAT1/IRF1 axis-mediated anti-tumor activity in gastric cancer

doi: 10.1038/s41419-024-06566-0

Figure Lengend Snippet: A The protein expressions of IRF1, p-STAT1 and STAT1 in MKN-45 cells after treated with indicated dose of IFN-γ for 48 h were examined by western blot analysis. B The protein expressions of IRF1 and p-STAT1 in shNC and shIGF2BP3 MKN-45 cells were examined by western blot analysis. C The protein expressions of IRF1, p-STAT1 and STAT1 in shNC and shIGF2BP3 MKN-45 cells after treated with FAMP for 24 h were examined by western blot analysis. D Overlapping genes of TFs of IRF1 predicted by the PROMO (Maximun matrix dissimilarity rate: 10%), downregulation (|fold change| ≥ 1.5) in shIGF2BP3 MKN-45 cells compared with shNC MKN-45 cells based on Ribo-seq data and upregulation in GC tissues based on the GEPIA were identified; E The protein expressions of SP1 and NFAT1 in shNC and shIGF2BP3 MKN-45 and AGS cells were examined by western blot analysis, respectively. F The expressions of IRF1 in shNC and shIGF2BP3 MKN-45 cells after transfected over expression plasmid targeting NFAT1 or vector control for 48 h were measured by western blot analysis, respectively. G shNC and shIGF2BP3 MKN-45 cells were co-transfected with NFAT1 over expression or vector control plasmid, pGL3-Basic-IRF1 promoter reporter plasmid and pRL-TK plasmid for 24 h. The promoter activities were determined as a relative signal of F-luc divided by R-luc. H Protein expressions of NFAT1 in MKN-45 cells were measured by western blot analysis after transfected siRNA or over expression plasmid targeting NFAT1 for 48 h, respectively. I After transfected siRNA or over expression plasmid targeting NFAT1 for 48 h, the relative mRNA expressions of IRF1 in MKN-45 cells were investigated by qRT-PCR analysis. J After transfected siRNA or over expression plasmid targeting NFAT1 for 24 h, MKN-45 cells were co-transfected with pGL3-Basic-IRF1 promoter reporter plasmid and pRL-TK plasmid for 24 h. The promoter activities were determined as a relative signal of F-luc divided by R-luc. K The consensus sequences of TF binding sites in IRF1 promoter region were predicted by motif analysis from the JASPAR database. L The specific TF binding sites in IRF1 promoter region were predicted. M The binding between NFAT1 protein and specific TF binding sites in IRF1 promoter region in MKN-45 cells were measured by ChIP-qPCR assay. N Schematic representation of mutated (TCC to AGG) promoter region of pGL3-Basic-IRF1 promoter reporter plasmid to investigate the role of specific TF binding sites on IRF1 promoter activities. O shNC and shIGF2BP3 MKN-45 cells were co-transfected with wild-type pGL3-Basic-IRF1 promoter reporter plasmid or mutated (TCC to AGG) promoter plasmid and pRL-TK plasmid for 24 h. The promoter activities were determined as a relative signal of F-luc divided by R-luc.

Article Snippet: The antibodies used in present study were: IGF2BP3 (Abcam, ab177477, 1:1000), β-Tubulin (Proteintech, 10094-1-AP, 1:1000), METTL3 (Abcam, ab195352, 1:1000), GAPDH (Proteintech, 60004-1-Ig, 1:1000), PARP (CST, 9532, 1:1000), Caspase-3 (CST, 14220, 1:1000), Cytochrome c (CST, 4280, 1:1000), IRF1 (CST, 8478, 1:1000), IRF2 (Abcam, ab124744, 1:1000), Histone H3 (Abbkine, ABL1070, 1:1000), STAT1 (CST, 14994, 1:1000), Phospho-STAT1 (CST, 9167, 1:1000), SP1 (Abcam, ab124804, 1:1000), NFAT1 (Abcam, ab92490, 1:1000), eIF4E (Proteintech, 11149-1-AP, 1:1000). β-Tubulin, GAPDH and Histone H3 were used as the loading control for tissues and cells respectively.

Techniques: Western Blot, Transfection, Over Expression, Plasmid Preparation, Control, Quantitative RT-PCR, Binding Assay, ChIP-qPCR

Journal: Cell Death & Disease

Article Title: The RNA m 6 A reader IGF2BP3 regulates NFAT1/IRF1 axis-mediated anti-tumor activity in gastric cancer

doi: 10.1038/s41419-024-06566-0

Figure Lengend Snippet: A The shNC and shIGF2BP3 MKN-45 cells were subcutaneously injected into the nude mice ( n = 5). Tumor volume was monitored every five days, and tumor growth curves were generated. B , C Images ( B ) and volumes ( C ) of xenografted tumor tissues were analyzed. D The expressions of IGF2BP3, NFAT1 and IRF1 in xenograft tumor tissues were examined by IHC assay. E , F The relative mRNA expressions of eIF4E ( E ) and NFAT1 ( F ) in GC tissues compared with gastric normal tissues from the GEPIA database. G Correlation between IGF2BP3 and NFAT1 mRNA expressions in GC tissues were analyzed from the OncoDB database. H – J Correlation between the expression of eIF4E ( H ), NFAT1 ( I ), IRF1 ( J ) and OS in GC patients were analyzed by the Kaplan-Meier Plotter. K The graphic illustration of IGF2BP3/NFAT1/IRF1 axis regulate GC progression.

Article Snippet: The antibodies used in present study were: IGF2BP3 (Abcam, ab177477, 1:1000), β-Tubulin (Proteintech, 10094-1-AP, 1:1000), METTL3 (Abcam, ab195352, 1:1000), GAPDH (Proteintech, 60004-1-Ig, 1:1000), PARP (CST, 9532, 1:1000), Caspase-3 (CST, 14220, 1:1000), Cytochrome c (CST, 4280, 1:1000), IRF1 (CST, 8478, 1:1000), IRF2 (Abcam, ab124744, 1:1000), Histone H3 (Abbkine, ABL1070, 1:1000), STAT1 (CST, 14994, 1:1000), Phospho-STAT1 (CST, 9167, 1:1000), SP1 (Abcam, ab124804, 1:1000), NFAT1 (Abcam, ab92490, 1:1000), eIF4E (Proteintech, 11149-1-AP, 1:1000). β-Tubulin, GAPDH and Histone H3 were used as the loading control for tissues and cells respectively.

Techniques: Injection, Generated, Expressing

Journal: Journal of Biological Chemistry

Article Title: Protein Profiling with Epstein-Barr Nuclear Antigen-1 Reveals an Interaction with the Herpesvirus-associated Ubiquitin-specific Protease HAUSP/USP7

doi: 10.1074/jbc.m303977200

Figure Lengend Snippet: FIG. 5. Comparison of turnover rates of EBNA1 and 395–450. 293T cells expressing either EBNA1 or 395–450 were blocked with cycloheximide, and cells were collected and lysed 0, 1, 5, 9, 25, and 32 h post-transfection as indicated. Equal amounts of protein from each cell lysate were analyzed by Western blotting using anti-EBNA1 and anti- IRF-1 antibodies.

Article Snippet: The same lysates were also probed with anti-interferon regulatory factor 1 (IRF-1) antibody (C20, Santa Cruz Biotechnology).

Techniques: Comparison, Expressing, Transfection, Western Blot

Journal: Epigenetics

Article Title: Interferon regulatory factor 1 and histone H4 acetylation in systemic lupus erythematosus.

doi: 10.1080/15592294.2015.1009764

Figure Lengend Snippet: Figure 4. IRF1 gene expression levels in D54MG overexpression and knock-down cells, as

Article Snippet: D ow nl oa de d by [ Se lc uk U ni ve rs ite si ] at 0 1: 33 2 3 Ja nu ar y 20 15 Ac ce pte d M an us cri pt For the IRF1 overexpression experiments, the IRF1-puromycin plasmid was constructed by subcloning the IRF1 human cDNA ORF clone (Origene, Rockville, MD, USA) into pCMV6-A-Puro vector (Origene).

Techniques: Gene Expression, Over Expression, Knockdown

Journal: Epigenetics

Article Title: Interferon regulatory factor 1 and histone H4 acetylation in systemic lupus erythematosus.

doi: 10.1080/15592294.2015.1009764

Figure Lengend Snippet: Figure 5. HAT/HDAC gene expression levels in vector-control D54MG cells versus IRF1

Article Snippet: D ow nl oa de d by [ Se lc uk U ni ve rs ite si ] at 0 1: 33 2 3 Ja nu ar y 20 15 Ac ce pte d M an us cri pt For the IRF1 overexpression experiments, the IRF1-puromycin plasmid was constructed by subcloning the IRF1 human cDNA ORF clone (Origene, Rockville, MD, USA) into pCMV6-A-Puro vector (Origene).

Techniques: Gene Expression, Plasmid Preparation, Control

Journal: Epigenetics

Article Title: Interferon regulatory factor 1 and histone H4 acetylation in systemic lupus erythematosus.

doi: 10.1080/15592294.2015.1009764

Figure Lengend Snippet: Figure 7. The effect of IRF1 on the recruitment of p300 to target genes. A) D54MG cells

Article Snippet: D ow nl oa de d by [ Se lc uk U ni ve rs ite si ] at 0 1: 33 2 3 Ja nu ar y 20 15 Ac ce pte d M an us cri pt For the IRF1 overexpression experiments, the IRF1-puromycin plasmid was constructed by subcloning the IRF1 human cDNA ORF clone (Origene, Rockville, MD, USA) into pCMV6-A-Puro vector (Origene).

Techniques:

Journal: Frontiers in Immunology

Article Title: Identification of interferon-stimulated genes with modulated expression during hepatitis E virus infection in pig liver tissues and human HepaRG cells

doi: 10.3389/fimmu.2023.1291186

Figure Lengend Snippet: List of primers used for the quantification of human gene expression by RT-qPCR.

Article Snippet: The membrane was then incubated with the required dilution of specific antibodies raised against ORF2 (mouse, 1/2000 dilution, clone 1E6, Merck Millipore), actin (mouse, 1/2000 dilution, clone M2, Sigma), DDX58 (mouse, 1/1000 dilution, clone Alme-1, AdipoGen Life Sciences), IFIH1 (rabbit, 1/1000 dilution, AT113, ALX-210-935, Enzo Life Sciences), or IRF1 (rabbit, 1/1000 dilution, VPA00801, Bio-Rad).

Techniques: Gene Expression

Journal: Frontiers in Immunology

Article Title: Identification of interferon-stimulated genes with modulated expression during hepatitis E virus infection in pig liver tissues and human HepaRG cells

doi: 10.3389/fimmu.2023.1291186

Figure Lengend Snippet: Validation of the PCR array data. (A) HepaRG cells were infected or not with HEV-3f for 100 days at MOI 100 and the expression of selected genes shown by PCR array to be up-regulated or unchanged was analyzed by RT-qPCR. The results shown are the geometric means ± SD from 3 to 4 replicate samples and are representative of 2 independent experiments. GUSB , B2M and GAPDH were used as reference genes. Unpaired t-test with Welch’s correction Mann-Whitney test, *: p<0.05 (B) Immunoblot showing the expression of the protein encoded by IFIH1 , DDX58 and IRF1 in HepaRG cells infected with HEV-3f or not (NI) for 100 days at MOI 100 for 3 replicate samples. Representative blots from 2 independent experiments are shown. ORF2 and actin protein levels were also detected as control of infection and loading, respectively. (C) Detection of CXCL10 in the supernatant of non-infected HepaRG (NI) or HepaRG cells infected with HEV-3f for 100 days at MOI 100 (GE/cell) by ELISA. The results shown are the means ± SD from 4 replicate samples and are representative of 2 independent experiments. Unpaired t-test with Welch’s correction, *: p<0.05.

Article Snippet: The membrane was then incubated with the required dilution of specific antibodies raised against ORF2 (mouse, 1/2000 dilution, clone 1E6, Merck Millipore), actin (mouse, 1/2000 dilution, clone M2, Sigma), DDX58 (mouse, 1/1000 dilution, clone Alme-1, AdipoGen Life Sciences), IFIH1 (rabbit, 1/1000 dilution, AT113, ALX-210-935, Enzo Life Sciences), or IRF1 (rabbit, 1/1000 dilution, VPA00801, Bio-Rad).

Techniques: Biomarker Discovery, Infection, Expressing, Quantitative RT-PCR, MANN-WHITNEY, Western Blot, Control, Enzyme-linked Immunosorbent Assay

Journal: Journal of Neuroinflammation

Article Title: Neuronal c-Abl activation leads to induction of cell cycle and interferon signaling pathways

doi: 10.1186/1742-2094-9-208

Figure Lengend Snippet: Primers

Article Snippet: IRF1 , F: TCCAAGTCCAGCCGAGACACTA , OriGene.

Techniques:

Journal: Journal of Neuroinflammation

Article Title: Neuronal c-Abl activation leads to induction of cell cycle and interferon signaling pathways

doi: 10.1186/1742-2094-9-208

Figure Lengend Snippet: Interferon related genes increased at 2 and 4 weeks off doxicycline

Article Snippet: IRF1 , F: TCCAAGTCCAGCCGAGACACTA , OriGene.

Techniques: Binding Assay, Ubiquitin Proteomics, Variant Assay, Glycoproteomics, Virus

Journal: JCI Insight

Article Title: IFN- γ –induced trained immunity enhances killing of priority pathogens in healthy and genetically vulnerable individuals

doi: 10.1172/jci.insight.195866

Figure Lengend Snippet: Enriched monocytes were left untrained (UT; white) or trained with IFN-γ (10 ng/mL; gray) for 24 hours. Cells were differentiated into MDM. ( A ) Schematic of training assay. ( B – G ) Expression of HLA-DR ( B ), CD14 ( C ), CD40 ( D ), CD80 ( E ), H3K27ac ( F ), or H3K4me3 ( G ) on unstimulated MDM on day 7 measured by flow cytometry. MFI, median fluorescence intensity. ( H and I ) Expression (relative to untrained) of NFKB1 ( H ) or IRF1 ( I ) in unstimulated MDM on day 7 measured by qPCR. ( J – O ) On day 6, MDM were stimulated with LPS (10 ng/mL) or irradiated M.tb (10 μg/mL) for 24 hours, and TNF ( J ), IL-6 ( K ), IL-1β ( L ), IL-10 ( M ), CXCL1 ( N ), or MIP-1α ( O ) was measured by ELISA. Each dot represents an individual donor, n = 6 ( B – E , H , and I ), n = 5 ( F and G ), or n = 7 ( J – O ), with paired data joined by a line. * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001 determined using a paired t test ( B – I ) or a 2-way ANOVA with Šidák’s multiple-comparison test ( J – O ).

Article Snippet: The following probes were used (TaqMan: FAM): ATP5B (Hs00969569_m1), CYBA (Hs00609145_m1), CYBB (Hs00166163_m1), GAPDH (Hs02786624_g1), GPI (Hs00976715_m1), HK1 (Hs00175976_m1), IRF1 (Hs00971965_m1), NCF1 (Hs00417167_m1), NCF2 (Hs01084940_m1), NFKB1 (Hs00765730_m1), PFKFB3 (Hs00998698_m1), PKM2 (Hs00761782_s1), and TBX21 (Hs00894392_m1). qPCR was performed using SensiFast Probe Hi-ROX Kit (Meridian Biosciences, BIO-82005) on a QuantStudio 5 Real-Time qPCR System (Applied Biosystems).

Techniques: Expressing, Flow Cytometry, Fluorescence, Irradiation, Enzyme-linked Immunosorbent Assay, Comparison